|
|
||||||||
Environmental Microbiology |
Microbiology Laboratory1 and Synthetic Organic Chemistry Laboratory2, The Institute of Physical and Chemical Research (RIKEN), Hirosawa 2-1, Wako, Saitama 351-0198, Japan
Author for correspondence: Toshiaki Kudo. Tel: +81 48 467 9544. Fax: +81 48 462 4672. e-mail: tkudo{at}postman.riken.go.jp
| ABSTRACT |
|---|
|
|
|---|
Keywords: 3-(3-hydroxyphenyl)propionate, trans-3-hydroxycinnamate, meta pathway, biodegradation, Comamonas testosteroni
Abbreviations: 3HCI, trans-3-hydroxycinnamate; 3HPA, 3-hydroxyphenylacetate; 3HPP, 3-(3-hydroxyphenyl)propionate; 3MC, 3-methylcatechol; 4MC, 4-methylcatechol; DHBP, 2,3-dihydroxybiphenyl; DHCI, trans-2,3-dihydroxycinnamate; DHPP, 3-(2,3-dihydroxyphenyl)propionate; CFE, cell-free extract
The DDBJ/EMBL/GenBank accession number for the sequence reported in this paper is AB024335.
a Present address: Department of Biotechnology, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan.
| INTRODUCTION |
|---|
|
|
|---|
| METHODS |
|---|
|
|
|---|
|
Preparation of cell-free extract.
For preparation of cell-free extract (CFE), bacterial cells were cultured overnight. The cells were harvested by centrifugation, washed with 50 mM potassium phosphate buffer (pH 7·5), resuspended in the same buffer and disrupted by sonication. The cell debris was removed by centrifugation and the supernatant was used as CFE. Protein concentration was determined by the method of Bradford (1976)
using the Bio-Rad protein assay kit, with bovine serum albumin as standard.
Enzyme assays.
Extradiol dioxygenase activity was determined spectrophotometrically by monitoring the increase in the yellow ring-fission products upon addition of CFE to 50 mM potassium phosphate buffer (pH 7·5) containing 0·8 mM diol substrate at 30 °C. The molar extinction coefficient values (
) for the ring-fission products were as follows (M-1 cm-1): DHBP,
434=13200; DHPP,
394=19150; catechol,
375=36000; 3-methylcatechol (3MC),
388=15000; 4-methylcatechol (4MC),
375=13500 (Barnes et al., 1997
; Eltis et al., 1993
).
The substrates for the assay of hydrolase activity were prepared enzymically from diol compounds using recombinant extradiol dioxygenases. pYT103, pYT40, pUC18-xylE and pUC19-todE express DHPP dioxygenase of strain TA441, DHBP dioxygenase of R. erythropolis TA421 (Maeda et al., 1995
), catechol 2,3-dioxygenase of the TOL plasmid (Burlage et al., 1989
) and methylcatechol dioxygenase of Pseudomonas putida F1 (Zylstra & Gibson, 1989
), respectively. DHPP, DHBP, catechol or 3MC were converted to the ring-fission products in 50 mM potassium phosphate buffer (pH 7·5) using the CFE of E. coli JM109 harbouring the plasmid encoding the appropriate dioxygenase. After the ring-fission reaction was completed, the CFE for the hydrolase assay was added to the reaction mixture. The activity was measured spectrophotometrically by monitoring the disappearance of the yellow ring-fission compounds.
Recombinant DNA techniques.
DNA manipulations were performed by standard methods (Sambrook et al., 1989
) or as described previously (Arai et al., 1998
). An ABI 377 DNA sequencer was used for sequence determination (Applied Biosystems). A BigDye terminator cycle sequence kit (Perkin-Elmer) was used for dideoxy chain-termination reactions. Synthetic oligonucleotides used as primers for sequence determination were purchased from Sawady Technology.
Cloning of the mhp gene cluster.
For isolation of the extradiol dioxygenase gene (mhpB), total DNA of strain TA441 was digested with SalI and ligated with the SalI digest of pUC19. E. coli JM109 was transformed with the ligation mixture and plated onto LB agar plates containing ampicillin (Ap) and IPTG. Colonies that expressed the extradiol dioxygenase were identified by spraying with a DHBP solution (20 mM in acetone). A 4·3 kb SalI fragment (pYT10) was obtained from the plasmid in a positive clone which turned yellow. A 5·5 kb BglII fragment (pYT11) and a 6·0 kb BglII fragment (pYT12), which hybridized with the upstream SalISacI fragment and the downstream SacISalI fragment of pYT10, respectively, were cloned from the total DNA of strain TA441 and identified by colony hybridization.
Construction of plasmids and mutant strains.
The mhpB gene of pYT10 was disrupted by insertion of a blunt-ended 1·5 kb HindIII-SalI fragment of pSUP5011, which contained a kanamycin (Km) resistance gene (Simon, 1984
), into the EcoRV site (Fig. 1
). The resultant plasmid, pYT101, was introduced into strain TA441 by electroporation and the transformed cells were plated on agar plates containing Km. The Km-resistant colonies were transferred to plates containing carbenicillin (Cb). A Cb-sensitive and Km-resistant colony, whose mhpB gene was exchanged for the disrupted mhpB gene by double crossover reactions, was selected and designated as strain TTM101. orf4 and orf5 were disrupted in the same way by use of pYT107, which was constructed by replacement of the BglIIBpu1102I fragment with the Km resistance gene (Fig. 1
). The resultant mutant was designated strain TTM107. The mhpR mutant strain TTM112 was constructed by use of pYT112, whose mhpR gene was disrupted by insertion of the Km resistance gene at the KpnI site. Insertion of the Km resistance gene into the chromosome of the mutant strains was confirmed by PCR (data not shown).
|
pUC18-xylE was constructed by ligation of a 1·8 kb BamHIXhoI fragment of pTS1045 that carries the xylE gene (Inouye et al., 1986
) with BamHI/SalI-digested pUC18. pUC19-todE was constructed by subcloning a BamHI/EcoRI digest of the 1·0 kb PCR fragment, which carries todE of P. putida F1 (Zylstra & Gibson, 1989
), into pUC19. The fragment was amplified from a fresh colony of strain F1 with oligonucleotides TodE1 (GGCGCACGGATCCACAAGCACTTCGG) and TodE2 (CATATGGGAATTCAGGTAGAAGCAGGAC), which were designed to introduce BamHI and EcoRI sites, respectively.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
Sequence comparisons
The deduced amino acid sequences of the mhp genes from strain TA441 were compared with the genes for other aromatic hydrocarbon degradation enzymes (Table 2
). The mhpA gene encodes a protein consisting of 589 aa residues showing a high level of identity with the 3HPP hydroxylase of E. coli K-12 (MhpA) and that of R. globerulus PWD1 (HppA) (Barnes et al., 1997
; Ferrández et al., 1997
), suggesting that MhpA of strain TA441 is a 3HPP hydroxylase. MhpA also shows low similarity to single-component flavin-type hydroxylases, including phenol hydroxylase (PheA) from P. putida EST1001 (Nurk et al., 1991
) and 2,4-dichlorophenoxyacetate hydroxylase (TfdB) from Ralstonia eutropha JMP134 (Perkins et al., 1990
).
|
|
The mhpR gene encodes a protein consisting of 261 aa residues that belongs to the IclR family of transcriptional regulators. This family includes regulators for degradation of 4-hydroxybenzoate (PobR) and protocatechuate (PcaU and PcaR) (DiMarco et al., 1993
; Harwood et al., 1994
; Kowalchuk et al., 1994
). The product of the corresponding gene from E. coli K-12 was identified as a transcriptional activator that regulates transcription of the mhp genes (Ferrández et al., 1997
). Because expression of the enzymes for 3HPP degradation is responsive to 3HPP, it seems likely that MhpR acts as a regulator for the mhp genes in strain TA441, as in the case of E. coli.
The two ORFs, orf4 and orf5, encode proteins consisting of 325 and 278 aa residues, respectively. The deduced sequences of orf4 and orf5 are highly similar to each other, with 63% of the amino acid residues being identical. The orf4 gene product has a typical N-terminal signal sequence for membrane translocation, whereas the deduced sequence of orf5 lacks the N-terminal signal, indicating that the orf4 and orf5 gene products are probably located in the periplasm and in the cytoplasm, respectively. Genes similar to orf4 and orf5 have been found in the gene cluster for the ortho degradation pathway of chlorocatechol in Pseudomonas sp. P51 (ORF3 of the tcb gene cluster) (van der Meer et al., 1991
) and in the catabolic plasmid pAC27 (ORF3 of the clc gene cluster) (Frantz & Chakrabarty, 1987
), and in the gene cluster for biosynthesis of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) in Alcaligenes eutrophus H16 (ORF7) (Valentin et al., 1995
). ORF3 of the tcb gene cluster and ORF7 in A. eutrophus H16 encode putative proteins with N-terminal signal sequences, whereas ORF3 in the clc gene cluster does not encode a protein with an N-terminal signal sequence. orf4-like genes were also found in the gene clusters for the metabolism of tartrate and urea (McMillan et al., 1998
; Salomone et al., 1996
). Most of the gene clusters that contain an orf4-like gene are associated with the metabolism of hydroxyacids or ketoacids; however, the function of these genes has not been identified.
Substrate specificity of the mhpB and mhpC gene products
The mhpB and mhpC gene fragments were cloned in pUC19, resulting in pYT103 and pYT121, respectively (Fig. 1
). CFEs of E. coli JM109 harbouring the plasmids were prepared from cells grown in LB medium containing 0·5 M IPTG. The extradiol dioxygenase activity in the CFE of JM109(pYT103) and the hydrolase activity in the CFE of JM109(pYT121) were measured with several substrates. The activities of DHPP dioxygenase and 2-hydroxy-6-ketonona-2,4-dienedioate hydrolase of strain JM109 harbouring pUC19 were not detected under the culture conditions used, indicating that the corresponding enzymes derived from the E. coli chromosome were not expressed (data not shown). Table 3
shows the substrate specificity of the recombinant enzymes. DHPP was the most preferable substrate for MhpB. MhpB also showed relatively high activity with DHBP as substrate, but the activity with catechol or methylcatechols was low. MhpC was highly specific for the meta cleavage compound produced from DHPP (2-hydroxy-6-ketonona-2,4-dienedioate) and showed very low activity with other substrates.
|
|
We have reported another gene cluster (aphKLMNOPQB) encoding a set of enzymes, including a hydroxylase and an extradiol dioxygenase, which is required for adaptive growth of strain TA441 on phenol (Arai et al., 1998
). The phenol hydroxylase encoded by the aphKLMNOP genes belongs to a family of multicomponent-type monooxygenases that differ from the flavin-type MhpA. The aphB gene encodes catechol 2,3-dioxygenase which has low specificity for substituted catechols. Möbus et al. (1997)
reported that a protein (TIP1), whose N-terminal sequence was similar to that of the DHBP dioxygenase, was expressed when C. testosteroni was grown with testosterone as a carbon source. Comparing the N-terminal sequences, neither that of MhpB nor that of AphB was identical to that of TIP1. The extradiol dioxygenase activity was found to be induced when strain TA441 was grown on steroids such as testosterone or bile acids as a carbon source. The aphB- mhpB- double mutant of strain TA441 could also grow on steroids and expressed dioxygenase activity (unpublished data). These results indicate that strain TA441 has at least one more meta cleavage enzyme involved in steroid utilization.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barnes, M. R., Duetz, W. A. & Williams, P. A. (1997). A 3-(3-hydroxyphenyl)propionic acid catabolic pathway in Rhodococcus globerulus PWD1: cloning and characterization of the hpp operon. J Bacteriol 179, 6145-6153.
Blakley, E. R. & Simpson, F. J. (1964). The microbial metabolism of cinnamic acid. Can J Microbiol 10, 175-185.[Medline]
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem 72, 248-254.[Medline]
Burlage, R. S., Hooper, S. W. & Sayler, G. S. (1989). The TOL (pWW0) catabolic plasmid. Appl Environ Microbiol 55, 1323-1328.
Burlingame, R. & Chapman, P. J. (1983). Catabolism of phenylpropionic acid and its 3-hydroxy derivative by Escherichia coli. J Bacteriol 155, 113-121.
Chung, S.-Y., Maeda, M., Song, E., Horikoshi, K. & Kudo, T. (1994). A gram-positive polychlorinated biphenyl-degrading bacterium, Rhodococcus erythropolis strain TA421, isolated from a termite ecosystem. Biosci Biotechnol Biochem 58, 2111-2113.
DiMarco, A. A., Averhoff, B. & Ornston, L. N. (1993). Identification of the transcriptional activator pobR and characterization of its role in the expression of pobA, the structural gene for p-hydroxybenzoate hydroxylase in Acinetobacter calcoaceticus. J Bacteriol 175, 4499-4506.
Eltis, L. D. & Bolin, J. T. (1996). Evolutionary relationships among extradiol dioxygenases. J Bacteriol 178, 5930-5937.
Eltis, L. D., Hofmann, B., Hecht, H.-J., Lünsdorf, H. & Timmis, K. N. (1993). Purification and crystalization of 2,3-dihydroxybiphenyl 1,2-dioxygenase. J Biol Chem 268, 2727-2732.
Erickson, B. D. & Mondello, F. J. (1992). Nucleotide sequencing and transcriptional mapping of genes encoding biphenyl dioxygenase, a multicomponent PCB-degrading enzyme in Pseudomonas strain LB400. J Bacteriol 174, 2903-2912.
Ferrández, A., García, J. L. & Díaz, E. (1997). Genetic characterization and expression in heterologous hosts of the 3-(3-hydroxyphenyl)propionate catabolic pathway of Escherichia coli K-12. J Bacteriol 179, 2573-2581.
Frantz, B. & Chakrabarty, A. M. (1987). Organization and nucleotide sequence determination of a gene cluster involved in 3-chlorocatechol degradation. Proc Natl Acad Sci USA 84, 4460-4464.
Harayama, S. & Rekik, M. (1990). The meta cleavage operon of TOL degradative plasmid pWW0 comprises 13 genes. Mol Gen Genet 221, 113-120.[Medline]
Harwood, C. S., Nichols, N. N., Kim, M. K., Ditty, J. L. & Parales, R. E. (1994). Identification of the pcaRKF gene cluster from Pseudomonas putida: involvement in chemotaxis, biodegradation, and transport of 4-hydroxybenzoate. J Bacteriol 176, 6479-6488.
Hofer, B., Backhaus, S. & Timmis, K. N. (1994). The biphenyl/polychlorinated biphenyl-degradation locus (bph) of Pseudomonas sp. LB400 encodes four additional metabolic enzymes. Gene 144, 9-16.[Medline]
Hofer, B., Eltis, L. D., Dowling, D. N. & Timmis, K. N. (1993). Genetic analysis of a Pseudomonas locus encoding a pathway for biphenyl/polychlorinated biphenyl degradation. Gene 130, 47-55.[Medline]
Inouye, S., Asai, Y., Nakazawa, A. & Nakazawa, T. (1986). Nucleotide sequence of a DNA segment promoting transcription in Pseudomonas putida. J Bacteriol 166, 739-745.
Kowalchuk, G. A., Hartnett, G. B., Benson, A., Houghton, J. E., Ngai, K.-L. & Ornston, L. N. (1994). Contrasting patterns of evolutionary divergence within the Acinetobacter calcoaceticus pca operon. Gene 146, 23-30.[Medline]
Kulakov, L. A., Delcroix, V. A., Larkin, M. J., Ksenzenko, V. N. & Kulakova, A. N. (1998). Cloning of new Rhodococcus extradiol dioxygenase genes and study of their distribution in different Rhodococcus strains. Microbiology 144, 955-963.
Lau, P. C. K., Bergeron, H., Labbe, D., Wang, Y., Brousseau, R. & Gibson, D. T. (1994). Sequence and expression of the todGIH genes involved in the last three steps of toluene degradation by Pseudomonas putida F1. Gene 146, 7-13.[Medline]
McMillan, D. J., Mau, M. & Walker, M. J. (1998). Characterisation of the urease gene cluster in Bordetella bronchiseptica. Gene 208, 243-251.[Medline]
Maeda, M., Chung, S. Y., Song, E. & Kudo, T. (1995). Multiple genes encoding 2,3-dihydroxybiphenyl 1,2-dioxygenase in the gram-positive polychlorinated biphenyl-degrading bacterium Rhodococcus erythropolis TA421, isolated from a termite ecosystem. Appl Environ Microbiol 61, 549-555.[Abstract]
van der Meer, J. R., Eggen, R. I., Zehnder, A. J. & de Vos, W. M. (1991). Sequence analysis of the Pseudomonas sp. strain P51 tcb gene cluster, which encodes metabolism of chlorinated catechols: evidence for specialization of catechol 1,2-dioxygenases for chlorinated substrates. J Bacteriol 173, 2425-2434.
Möbus, E., Jahn, M., Schmid, R., Jahn, D. & Maser, E. (1997). Testosterone-regulated expression of enzymes involved in steroid and aromatic hydrocarbon catabolism in Comamonas testosteroni. J Bacteriol 179, 5951-5955.
Noda, Y., Nishikawa, S., Shiozuka, K. & 7 other authors (1990). Molecular cloning of the protocatechuate 4,5-dioxygenase genes of Pseudomonas paucimobilis. J Bacteriol 172, 27042709.
Nurk, A., Kasak, L. & Kivisaar, M. (1991). Sequence of the gene (pheA) encoding phenol monooxygenase from Pseudomonas sp. EST1001: expression in Escherichia coli and Pseudomonas putida. Gene 102, 13-18.[Medline]
Perkins, E. J., Gordon, M. P., Caceres, O. & Lurquin, P. F. (1990). Organization and sequence analysis of the 2,4-dichlorophenol hydroxylase and dichlorocatechol oxidative operons of plasmid pJP4. J Bacteriol 172, 2351-2359.
Prieto, M. A., Díaz, E. & García, J. L. (1996). Molecular characterization of the 4-hydroxyphenylacetate catabolic pathway of Escherichia coli W: engineering a mobile aromatic degradative cluster. J Bacteriol 178, 111-120.
Roper, D. I. & Cooper, R. A. (1990). Subcloning and nucleotide sequence of the 3,4-dihydroxyphenylacetate (homoprotocatechuate) 2,3-dioxygenase gene from Escherichia coli C. FEBS Lett 275, 53-57.[Medline]
Roper, D. I., Stringfellow, J. M. & Cooper, R. A. (1995). Sequence of the hpcC and hpcG genes of the meta-fission homoprotocatechuic acid pathway of Escherichia coli C: nearly 40% amino-acid identity with the analogous enzymes of the catechol pathway. Gene 156, 47-51.[Medline]
Salomone, J.-Y., Crouzet, P., De Ruffray, P. & Otten, L. (1996). Characterization and distribution of tartrate utilization genes in the grapevine pathogen Agrobacterium vitis. Mol Plant Microbe Interact 9, 401-408.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Shingler, V., Powlowski, J. & Marklund, U. (1992). Nucleotide sequence and functional analysis of the complete phenol/3,4-dimethylphenol catabolic pathway of Pseudomonas sp. strain CF600. J Bacteriol 174, 711-724.
Simon, R. (1984). High frequency mobilization of gram-negative bacterial replicons by the in vitro constructed Tn5-Mob transposon. Mol Gen Genet 196, 413-420.[Medline]
Spence, E. L., Kawamukai, M., Sanvoisin, J., Braven, H. & Bugg, T. D. (1996). Catechol dioxygenases from Escherichia coli (MhpB) and Alcaligenes eutrophus (MpcI): sequence analysis and biochemical properties of a third family of extradiol dioxygenases. J Bacteriol 178, 5249-5256.
Tamaoka, J., Ha, D.-M. & Komagata, K. (1987). Reclassification of Pseudomonas acidovorans den Dooren de Jong 1926 and Pseudomonas testosteroni Marcus and Talalay 1956 as Comamonas acidovorans comb. nov. and Comamonas testosteroni comb. nov., with an emended description of the genus Comamonas. Int J Syst Bacteriol 37, 52-59.
Valentin, H. E., Zwingmann, G., Schonebaum, A. & Steinbuchel, A. (1995). Metabolic pathway for biosynthesis of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) from 4-hydroxybutyrate by Alcaligenes eutrophus. Eur J Biochem 227, 43-60.[Medline]
Zylstra, G. J. & Gibson, D. T. (1989). Toluene degradation by Pseudomonas putida F1. Nucleotide sequence of the todC1C2BADE genes and their expression in Escherichia coli. J Biol Chem 264, 14940-14946.
Received 22 March 1999;
revised 19 May 1999;
accepted 28 May 1999.
This article has been cited by other articles:
![]() |
N. J. Poysti, E. D. M. Loewen, Z. Wang, and I. J. Oresnik Sinorhizobium meliloti pSymB carries genes necessary for arabinose transport and catabolism Microbiology, March 1, 2007; 153(3): 727 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Garcia-Estepa, M. Argandona, M. Reina-Bueno, N. Capote, F. Iglesias-Guerra, J. J. Nieto, and C. Vargas The ectD Gene, Which Is Involved in the Synthesis of the Compatible Solute Hydroxyectoine, Is Essential for Thermoprotection of the Halophilic Bacterium Chromohalobacter salexigens J. Bacteriol., June 1, 2006; 188(11): 3774 - 3784. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, E. Wan, C.-J. Kim, H. G. Floss, and T. Mahmud Identification of tailoring genes involved in the modification of the polyketide backbone of rifamycin B by Amycolatopsis mediterranei S699 Microbiology, August 1, 2005; 151(8): 2515 - 2528. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pruneda-Paz, M. Linares, J. E. Cabrera, and S. Genti-Raimondi TeiR, a LuxR-Type Transcription Factor Required for Testosterone Degradation in Comamonas testosteroni J. Bacteriol., March 1, 2004; 186(5): 1430 - 1437. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Radianingtyas, G. K. Robinson, and A. T. Bull Characterization of a soil-derived bacterial consortium degrading 4-chloroaniline Microbiology, November 1, 2003; 149(11): 3279 - 3287. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Torres, G. Porras, J. L. Garcia, and E. Diaz Regulation of the mhp Cluster Responsible for 3-(3-Hydroxyphenyl)propionic Acid Degradation in Escherichia coli J. Biol. Chem., July 18, 2003; 278(30): 27575 - 27585. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Horinouchi, T. Hayashi, H. Koshino, T. Yamamoto, and T. Kudo Gene Encoding the Hydrolase for the Product of the meta-Cleavage Reaction in Testosterone Degradation by Comamonas testosteroni Appl. Envir. Microbiol., April 1, 2003; 69(4): 2139 - 2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Diaz, A. Ferrandez, M. A. Prieto, and J. L. Garcia Biodegradation of Aromatic Compounds by Escherichia coli Microbiol. Mol. Biol. Rev., December 1, 2001; 65(4): 523 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Horinouchi, T. Yamamoto, K. Taguchi, H. Arai, and T. Kudo Meta-cleavage enzyme gene tesB is necessary for testosterone degradation in Comamonas testosteroni TA441 Microbiology, December 1, 2001; 147(12): 3367 - 3375. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nojiri, H. Sekiguchi, K. Maeda, M. Urata, S.-I. Nakai, T. Yoshida, H. Habe, and T. Omori Genetic Characterization and Evolutionary Implications of a car Gene Cluster in the Carbazole Degrader Pseudomonas sp. Strain CA10 J. Bacteriol., June 15, 2001; 183(12): 3663 - 3679. [Abstract] [Full Text] |
||||
![]() |
N.-Y. Zhou, S. L. Fuenmayor, and P. A. Williams nag Genes of Ralstonia (Formerly Pseudomonas) sp. Strain U2 Encoding Enzymes for Gentisate Catabolism J. Bacteriol., January 15, 2001; 183(2): 700 - 708. [Abstract] [Full Text] |
||||
![]() |
H. Arai, T. Ohishi, M. Y. Chang, and T. Kudo Arrangement and regulation of the genes for meta-pathway enzymes required for degradation of phenol in Comamonas testosteroni TA441 Microbiology, July 1, 2000; 146(7): 1707 - 1715. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |