Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 145 (1999), 3419-3429
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reizer, J.
Right arrow Articles by Stülke, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reizer, J.
Right arrow Articles by Stülke, J.
Agricola
Right arrow Articles by Reizer, J.
Right arrow Articles by Stülke, J.
Microbiology (1999), 145, 3419-3429.
© 1999 Society for General Microbiology


Genomics

Novel phosphotransferase system genes revealed by genome analysis – the complete complement of PTS proteins encoded within the genome of Bacillus subtilis

Jonathan Reizer1, Steffi Bachem2, Aiala Reizer1, Maryvonne Arnaud3, Milton H. Saier Jr1 and Jörg Stülke2

Department of Biology, University of California at San Diego, La Jolla, CA 92093-0116, USA1
Lehrstuhl für Mikrobiologie, Institut für Mikrobiologie, Biochemie und Genetik der Friedrich-Alexander-Universität Erlangen-Nürnberg, Staudtstr. 5, D-91058 Erlangen, Germany2
Unité de Biochimie Microbienne, D épartement des Biotechnologies, Institut Pasteur, 25 rue du Dr Roux, F-75724 Paris Cedex 15, France 3

Author for correspondence: Jörg Stülke. Tel: +49 9131 8528818. Fax: +49 9131 8528082. e-mail: jstuelke{at}biologie.uni-erlangen.de


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacillus subtilis can utilize several sugars as single sources of carbon and energy. Many of these sugars are transported and concomitantly phosphorylated by the phosphoenolpyruvate:sugar phosphotransferase system (PTS). In addition to its role in sugar uptake, the PTS is one of the major signal transduction systems in B. subtilis. In this study, an analysis of the complete set of PTS proteins encoded within the B. subtilis genome is presented. Fifteen sugar-specific PTS permeases were found to be present and the functions of novel PTS permeases were studied based on homology to previously characterized permeases, analysis of the structure of the gene clusters in which the permease encoding genes are located and biochemical analysis of relevant mutants. Members of the glucose, sucrose, lactose, mannose and fructose/mannitol families of PTS permeases were identified. Interestingly, nine pairs of IIB and IIC domains belonging to the glucose and sucrose permease families are present in B. subtilis; by contrast only five Enzyme IIA Glc-like proteins or domains are encoded within the B. subtilis genome. Consequently, some of the EIIAGlc-like proteins must function in phosphoryl transfer to more than one IIB domain of the glucose and sucrose families. In addition, 13 PTS- associated proteins are encoded within the B. subtilis genome. These proteins include metabolic enzymes, a bifunctional protein kinase/phosphatase, a transcriptional cofactor and transcriptional regulators that are involved in PTS-dependent signal transduction. The PTS proteins and the auxiliary PTS proteins represent a highly integrated network that catalyses and simultaneously modulates carbohydrate utilization in this bacterium.

Keywords: sugar transport, PTS, phosphorylation, gene regulation, Bacillus subtilis

Abbreviations: EI and EII, Enzymes I and II; HPr, histidine-containing phosphoprotein; PTS, phosphotransferase system; PRD, PTS regulation domain


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacteria have evolved a highly sophisticated multiprotein sugar transport and phosphorylation system, the phosphoenolpyruvate:sugar phosphotransferase system (PTS). The PTS is composed of two general energy-coupling proteins, Enzyme I (EI), a histidine-containing phosphoprotein (HPr) and several sugar-specific Enzymes II (EII). The phosphorylation chain from phosphoenolpyruvate to the incoming sugar proceeds via EI, HPr and EII. EIIs are multidomain proteins, the domains of which may be organized in a single protein or as several individual polypeptides. Two of the EII domains (EIIA and EIIB) are hydrophilic and involved in phosphoryl transfer, while domain IIC (and IID, if present) is membrane-bound and catalyses sugar transport. In the PTS, transport of the sugar occurs only if the substrate is concomitantly phosphorylated (Postma et al., 1993Down ; Saier & Reizer, 1992Down ).

In addition to its function in sugar transport, the PTS is one of the major signal transduction systems of the bacterial cell, as suggested by the multitude of regulatory functions exerted by PTS components. In both Gram-positive and Gram-negative bacteria proteins of the PTS are involved in carbon catabolite repression. They also control the induced expression of several catabolic operons in response to inducer availability by modifying the activities of transcriptional regulators, transport proteins and enzymes. Moreover, the PTS is involved in the regulation of nitrogen metabolism, chemotaxis towards carbohydrates and genetic competence (Postma et al., 1993 Down ; Powell et al., 1995Down ; Saier & Reizer, 1994Down ; Stülke & Hillen, 1998Down ). Many, but not all of these regulatory processes involve phosphotransfer between PTS proteins and the proteins whose activities are modulated by the PTS. These phosphorylation reactions link the activities of the target proteins to PTS activity and thus to the availability of PTS substrates. Glycerol kinase from low-GC Gram-positive bacteria is phosphorylated by HPr in the absence of repressing carbon sources. This phosphorylation stimulates the catalytic activity of the enzyme (Charrier et al., 1997 Down ). Similarly, lactose transport activity in Streptococcus thermophilus is controlled by HPr-dependent phosphorylation of a IIA-like regulatory domain fused to the C-terminal end of the membrane-bound lactose:H+ symporter (Gunnewijk et al., 1999Down ). Moreover, several positively acting transcriptional regulators have been shown to possess conserved PTS regulation domains (PRDs) (Tortosa et al., 1997Down ; St ülke et al., 1998Down ). The activator and antiterminator proteins that contain PRDs are often subject to dual control by the PTS: in the absence of the inducer of the controlled operon, they are phosphorylated and thus inactivated, but their activity may also depend on an additional HPr-dependent phosphorylation. This latter phosphorylation occurs only in the absence of a repressing carbon source, thus providing a means for hierarchical expression of genes required for the utilization of secondary carbon sources (for review see Stülke et al. , 1998Down ).

The PTSs of enteric bacteria and of low-GC Gram-positive bacteria have been the subject of intensive investigation (see Saier & Reizer, 1994Down ). More recently, the potential regulatory roles of PTS components of Mycoplasma spp., non-enteric Gram- negative bacteria such as Haemophilus influenzae and Alcaligenes eutrophus, and the high-GC Gram-positive bacterium Streptomyces coelicolor have been investigated (Zhu et al. , 1993Down ; Macfayden et al., 1996Down ; Pries et al., 1991Down ; Titgemeyer et al., 1995 Down ). The advent of complete genome sequence analysis of the complete set of PTS proteins encoded within a given genome has resulted in the identification of several novel genes and proteins (see Reizer et al., 1996Down ; Reizer & Reizer, 1996Down ).

Here, we present an analysis of the complete set of genes encoding PTS and PTS-associated proteins in the model Gram-positive bacterium Bacillus subtilis. We show that B. subtilis encodes 15 complete PTS permeases of which only seven have been characterized previously. Sequence and functional analyses have allowed us to propose substrates for seven of the eight novel permeases. Moreover, 13 PTS- associated proteins are also encoded in the B. subtilis genome. The significance of these findings is discussed.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacterial strains, plasmids and culture media.
The Bacillus subtilis strains used in this work are listed in Table 1Down. Escherichia coli DH5{alpha} (Sambrook et al., 1989Down ) and TGI (Gibson, 1984Down ) were used for cloning experiments.


View this table:
[in this window]
[in a new window]
 
Table 1. B. subtilis strains used in this work

 
Plasmid pGP109, used to disrupt malP, was constructed as follows. A 1024 bp fragment internal to malP was amplified by PCR using the primers SB17 (5'-TATGAATTCTTTG- GAAGCGCGATGTTTGTGCC) and SB18 (5'- TATGGATCCCATTGTGGCGGCAAGCACGGCGTG). The resulting PCR product was cut with EcoRI and BamHI (these sites were generated by PCR). The PCR product was then cloned into pBluescript SK- (Stratagene) linearized with the same enzymes to give pGP108. A 1·4 kb EcoRI fragment from pSpec (P. Trieu-Cuot, Institut Pasteur, France) containing the spc gene, which confers resistance to spectinomycin, was inserted into the unique MfeI site of pGP108. The resulting plasmid was pGP109.

gamP (ybfS) was disrupted as follows. A fragment of 977 bp internal to gamP was amplified by PCR using the oligonucleotides X1 (5'-GGGCGAGGGAATTCCGATTAT) and X2 (5'- CTGGTTCAGAAGCTTTGCCG). The PCR product was cut with EcoRI (generated by PCR) and HindIII and cloned into the integrative plasmid pHT181 (Lereclus & Arantè s, 1992Down ) to give pX1. B. subtilis 168 was transformed with pX1 and the plasmid was integrated into the chromosome. The DNA of the B. subtilis strain harbouring pX1 was extracted, hydrolysed by EcoRI and religated. E. coli TGI was transformed with the ligation mixture, yielding plasmid pHT181::X1 carrying a 3 kb EcoRI fragment. This fragment contained the PCR-amplified region and about 2 kb upstream of that region. A StuI digestion of pHT181::X1 provided a fragment of 947 bp corresponding to the last 677 bp of gamP, the first 93 bp of gltP and 147 bp of the gamP/gltP intergenic region. This StuI fragment was then replaced by an aphA3 cassette (Trieu-Cuot & Courvalin, 1983 Down ) located on a 1·5 kb ClaI fragment, leading to plasmid pHT181::X1::aphA3.

ypqE was disrupted by the following approach. A fragment of 594 bp, carrying ypqE and 90 bp downstream of the stop codon of this gene was amplified by PCR using the primers ypq-1 (5'-GAAGAATTCATATGCTGAAAAAATTATTCGGAAT) and ypq-2 (5'- CCCCCCGGGTCGACTACAGT TTACCGAATATTTG). The amplified fragment was cloned into pUC19 at the EcoRI and SalI sites (sites were introduced with the PCR primers), to yield plasmid pXX1. A 1·5 kb ClaI fragment carrying aphA3 was inserted into pXX1 at the unique AvaI site, yielding plasmid pXX1::aphA3. The 2·1 kb EcoRI–SalI fragment carrying ypqE interrupted by aphA3 from pXX1::aphA3 was inserted into plasmid pHT181 between the EcoRI and SalI sites, giving pHT181::XX1::aphA3.

E. coli was grown in LB medium (Sambrook et al., 1989Down ) whereas B. subtilis was grown in SP medium or C minimal medium (Martin-Verstraete et al., 1990Down ). The minimal media were supplemented with auxotrophic requirements (at 50 mg l-1) and carbon sources as indicated. CSE is C medium supplemented with potassium succinate (6 g l-1) and potassium glutamate (8 g l-1). Doubling times were determined by growing the bacteria in C minimal medium supplemented with 0·2% (w/v) of the carbon source indicated. CSE containing 0·2% (w/v) glucitol was used for precultures. Agar plates were prepared by the addition of 17 g Bacto agar l-1 (Difco) to LB, SP or C medium.

DNA manipulation, transformation and phenotypic characterization.
DNA extraction and manipulation were performed using standard procedures (Sambrook et al., 1989Down ). Restriction enzymes and T4 DNA ligase were used as recommended by the manufacturers.

Standard procedures were used to transform E. coli and transformants were selected on LB plates containing ampicillin (100 µg ml-1) or spectinomycin (100 µg ml-1) (Sambrook et al., 1989Down ). B. subtilis was transformed with chromosomal or plasmid DNA according to the two-step protocol described by Kunst & Rapoport (1995)Down . Transformants were selected on SP plates containing spectinomycin (100 µg ml -1), chloramphenicol (5 µg ml-1 ) or kanamycin (5 µg ml-1).

Computer-aided analyses.
Database searches were performed using the BLAST 2.0 program (Altschul et al., 1990Down ) on the NCBI server (http://www.ncbi.nlm.nih.gov/blast/). The organization of B. subtilis gene clusters was determined using the SubtiList database (Moszer et al., 1995Down ).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Genes encoding general energy coupling proteins of the PTS
Tables 2Down and 3Down list all recognized PTS proteins and PTS- associated proteins encoded within the B. subtilis genome. Interestingly, only one complete EI-like protein and just two HPr-like proteins, i.e. HPr and Crh, are present (see Tables 2Down and 3Down). By contrast, the E. coli chromosome encodes five EI paralogues (EI, EIAni, EINtr and the two EI domains in the multidomain proteins ADI and TTP) and five paralogues of HPr (HPr, FPr, NPr, DPr, TPr) (Blattner et al., 1997Down ; Reizer & Saier, 1997Down ). Domains similar to the phosphohistidine domain of phosphoenolpyruvate synthase (similar to EI) are attached to the C termini of pyruvate kinases of several Gram-positive bacteria, including B. subtilis (Table 3Down), Bacillus stearothermophilus and Lactobacillus delbrueckii (Sakai & Ohta, 1993Down ; Nguyen & Saier, 1995Down ; Branny et al., 1996Down ). The presence of multiple paralogues of EI and HPr in E. coli and the scarcity of these paralogues in B. subtilis suggests that the latter organism evolved alternative mechanisms to satisfy the specific regulatory and/or functional roles of these proteins.


View this table:
[in this window]
[in a new window]
 
Table 2. Genes encoding PTS proteins in B. subtilis

 

View this table:
[in this window]
[in a new window]
 
Table 3. Genes encoding PTS-associated proteins in B. subtilis

 
Genetic organization of gene clusters encoding sugar-specific PTS permeases
The second group of genes listed in Table 2Up encodes proteins that fall into the Glc family. Two of these permeases (PtsG and GamP) exhibit the IICBA domain structure, whereas the remaining two permeases (MalP and NagP) lack a IIA domain and exhibit the IICB domain order. Two genes (yyzE and ypqE) encode two distinct IIA Glc-like proteins. YpqE is a full length paralogue (168 residues) that presumably functions with the IICB permease(s) of this family or the IIBC permease(s) of the Scr family. YyzE, the second IIAGlc -like protein, is a truncated IIA homologue (76 residues) possessing the two active site histidyl residues but lacking about 70 and 30 residues corresponding, respectively, to the N and C termini of the orthologous crr gene product of enteric bacteria (Nelson et al., 1984Down ). It is not known if YyzE is functional in the PTS phosphorylation cascade. nagP, encoding a putative permease for N-acetylglucosamine, forms a monocistronic transcriptional unit and is not linked to other genes involved in the utilization of N-acetylglucosamine (see Fig. 1aDown). malP is the distal gene of a presumptive three-gene operon encoding also a phospho-{alpha}- glucosidase (MalA) that has the capacity to hydrolyse phosphorylated maltose generated by MalP (Fig. 1bDown). gamP required for the utilization of glucosamine (see below) is the second gene of a two-gene operon. The proximal gene of this operon, gamA (ybfT ), encodes a putative glucosamine-6-phosphate-deaminating isomerase. Divergently transcribed relative to the putative gamAP operon is a gene encoding a transcriptional repressor of the GntR family (see Fig. 1cDown). ypqE seems to form a monocistronic unit (Fig. 1dDown) while yyzE is followed by bglA encoding a phospho- ß-glucosidase (Fig. 1eDown) (Zhang & Aronson, 1994Down ).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Genetic arrangement of genes encoding PTS proteins of the Glc family. Functionally equivalent genes are shown by the same types of arrows. The numbers below the names of the proteins indicate their length. TR denotes transcriptional regulator. (a) Genetic map of the nagP region. This gene seems to form a monocistronic transcriptional unit. The other genes tentatively involved in N -acetylglucosamine utilization are located in the 307° region of the B. subtilis chromosome (Kunst et al., 1997 Down ). (b) Genetic map of the mal gene cluster. The first gene, malA, is preceded by a potential cre sequence mediating CcpA-dependent carbon catabolite repression. A potential {rho}-independent terminator is located downstream of malP . (c) Genetic map of the gam gene cluster. A potential {rho}-independent terminator is located downstream of gamP. gamA is preceded by a potential {sigma}A-dependent promoter. YbgA shares sequence similarity with transcriptional repressors of the GntR family. (d) Genetic map of the ypqE region. ypqA which is oriented divergently relative to ypqE encodes a protein of unknown function. Both genes are followed by potential {rho}-independent transcriptional terminators. (e) Genetic map of the bglA region. yydK encodes a potential repressor of the GntR family. The two divergent transcription units are followed by transcriptional terminators.

 
Five PTS permeases are included within the Scr family (Table 2Up, section 3). Four of these (SacP, SacX, TreP and YbbF) have the IIBC domain structure. The fifth member of this family, BglP, has the IIBCA domain order. Altogether, the B. subtilis chromosome possesses nine genes encoding nine pairs of IIB and IIC domains that belong to the glucose and sucrose families. By contrast, only five IIAGlc -like proteins or domains are encoded within the B. subtilis genome. Consequently, some of the IIAGlc-like proteins or domains must function in transfer of the phosphoryl group to more than one IIBGlc- and/or IIBScr-like proteins as was previously suggested with the IIAGlc domain of the glucose-specific EII complex (Sutrina et al., 1990Down ). The operons containing the genes encoding EIIs for sucrose, trehalose and aryl-ß-glucosides have all been described (Fouet et al., 1987Down ; Zukowski et al., 1990 Down ; Schöck & Dahl, 1996 Down ; Le Coq et al., 1995Down ). ybbF, encoding a novel EII of the Scr family, is the fifth gene in a putative eight-gene operon (Fig. 2Down). Based on the fact that one of the genes (ybbD) of this gene cluster encodes a ß-glycosidase homologue, we propose that YbbF is involved in the utilization of unknown ß-glucosides.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Genetic map of the ybbF gene cluster. The convention of presentation is as described in the legend to Fig. 1Up. A putative {rho}-independent terminator is located downstream of ybbC . YbbH shares sequence similarity with transcriptional repressors of the RpiR family. The ybbI gene product is similar to an E. coli protein encoded in a locus that also contains a gene encoding a PTS permease homologous to YbbF.

 
The Lac family (Table 2Up, section 4) includes two EII complexes each encoded by three distinct genes (licBCA and ydhMNO). Thus, YdhMNO and LicBAC are homologous to the IIB, IIA and IIC proteins that constitute the lactose-specific PTS permeases of Gram-positive bacteria (Lengeler et al., 1994Down ). The Lic-PTS is encoded within the licBCAH operon that also includes a phospho- ß-glucosidase encoding gene, licH (Tobisch et al. , 1997Down ). The ydhMNO genes are proximal in a putative eight-gene operon that also encodes a ß-1,4-mannosidase, a ß-glycosidase, a mannose-6-phosphate isomerase and a fructokinase (Fig. 3aDown). Based on these observations we propose that the Ydh-PTS is involved in the transport of oligo-ß- mannosides. This would be analogous to the Lic-PTS which transports oligomeric ß-glucosides. Indeed, the ydhMNO operon was recently shown to be involved in mannan utilization and to be induced by konjac glucomannan (Sadaie & Yata, 1998Down ). A paralogous IIC domain (YwbA), the function of which is yet to be determined, is an additional member of the B. subtilis lactose permease family. ywbA is linked to a gene of unknown function and it is not clustered to any other gene involved in carbohydrate utilization (Fig. 3bDown).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Genetic arrangement of genes encoding PTS proteins of the Lac family. The convention of presentation is as described in the legend to Fig. 1. (a)Up Genetic map of the ydh gene cluster. A potential {rho}-independent terminator is located downstream of ydhT. YdhQ shares sequence similarity with transcriptional repressors of the GntR family. The ydhP gene product is homologous to ß-glucosidases. (b) Genetic map of the ywbA region.

 
The LevDEFG EII complex (Table 2Up, section 5) is a fructose-6- phosphate-forming fructose permease of the Man family. It is the only member of the Man family present in B. subtilis (Martin- Verstraete et al., 1990Down ).

The Fru family (Table 2Up, section 6) includes the following three permeases, each containing three domains (IIA, IIB and IIC) that reside on a single polypeptide chain: (i) MtlA with a CBA domain order homologous to the E. coli mannitol permease; (ii) FruA with an ABC domain sequence homologous to the fructose-1-phosphate-forming fructose-specific PTS permease of mycoplasmas (Reizer et al., 1996Down ); and (iii) ManP (YjdD) with a BCA domain order. All three domains of FruA and the putative mannose permease (ManP) exhibit significant sequence similarity with protein domains of the fructose- specific permease (IIABCFru; fructose-1-phosphate-forming) of mycoplasmas (Reizer et al., 1996Down ). mtlA , encoding EIIMtl, is the first gene in a bicistronic operon which also encodes mannitol-1-phosphate dehydrogenase (Fig. 4aDown). manP is the first gene in a putative tricistronic operon. The second gene encodes a mannose-6- phosphate isomerase, whereas the function of the third gene is unknown (Fig. 4bDown). fruA, encoding the fructose permease, is the distal gene in a tricistronic operon. The first gene of this putative operon, fruR, encodes a repressor of the DeoR family and the second gene, fruB, encodes an orthologue of the E. coli fructose-1-phosphate kinase (Fig. 4cDown).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Genetic arrangement of genes encoding PTS proteins of the Fru family. The convention of presentation is as described in the legend to Fig. 1. (a)Up Genetic map of the mtl gene cluster. mtlD is followed by a potential {rho}-independent terminator. (b) Genetic map of the man gene cluster. Potential {rho}- independent terminators are located downstream of manR and yjdF. ManR is homologous to PRD-containing transcriptional activators. (c) Genetic map of the fru gene cluster. A potential {rho}-independent terminator is located downstream of fruA . FruR shares sequence similarity with transcriptional repressors of the DeoR family.

 
In contrast to E. coli, glucitol and galactitol PTS permeases (Lengeler et al., 1994Down ; Nobelmann & Lengeler, 1995Down ) are not present in B. subtilis. Furthermore, none of the sugar-specific EII complexes of B. subtilis exhibit a mosaic structure like that observed for the Sgc permease of E. coli (Reizer et al., 1996Down ). We also note that PTS permeases of the Scr family have the BC(A) domain order, members of the Glc family exhibit the CB(A) domain order and members of the Fru family have variable domain orders (IICBA, IIBCA and IIABC). Finally, the B. subtilis EII complexes of the Lac and Man families consist of single domain proteins.

PTS-associated proteins
Expression of several catabolic operons in B. subtilis is controlled by PTS-dependent phosphorylation of inducer-generating enzymes or transcriptional regulators (Deutscher et al., 1997 Down ; Stülke et al., 1998Down ).

Glycerol utilization in B. subtilis depends on a functional PTS, although glycerol is transported into cells by a non-PTS permease (Reizer et al., 1984Down ; Beijer & Rutberg, 1992 Down ). Mutations that bypass this dependency were isolated and found to be in glpK, the gene encoding glycerol kinase which generates glycerol 3-phosphate, the internal inducer of the glp regulon in B. subtilis (Wehtje et al., 1995 Down ). Subsequently, direct phosphorylation of glycerol kinase by EI and HPr was demonstrated (Charrier et al., 1997 Down ).

A protein domain, PRD, is found in transcriptional regulators such as RNA-binding antiterminators and DNA-binding activators that serves as a target of PTS-dependent phosphorylation (Tortosa et al., 1997Down ; Reizer & Saier, 1997Down ; Stülke et al., 1998Down ). PRD- containing regulators are found primarily in Gram-positive bacteria. Eight PRD-containing regulators are encoded within the B. subtilis chromosome (see Table 3Up). All eight proteins regulate the expression of genes encoding PTS permeases and associated catabolic enzymes. PRD-containing transcriptional antiterminators and the activator protein LevR have been studied extensively (Deutscher et al., 1997Down ; Martin-Verstraete et al., 1998 Down ; Stülke et al., 1998Down ). Four antiterminators of this type are present in B. subtilis (see Table 3Up). They control the expression of genes required for glucose, sucrose and ß-glucoside utilization (St ülke et al., 1997Down ; Steinmetz et al., 1989Down ; Schnetz et al., 1996 Down ). In addition, PRD-containing transcriptional activators, LevR and LicR, control expression of the levanase and licBCAH operons, respectively (Débarbouill é et al., 1991Down ; Tobisch et al., 1997Down ). The LevR activator contains two PRDs. LicR contains two PRDs and a C-terminal domain homologous to EIIAFru. The phosphorylation site in this domain is conserved and a mutation of this site was shown to result in constitutive LicR activity (Tobisch et al., 1999Down ). The complete nucleotide sequence of the B. subtilis genome revealed the presence of two novel putative transcriptional activators that are similar to LicR. Since yjdC is located just upstream of the operon involved in mannose utilization (see Fig. 4bUp), the designation ManR was proposed (Stülke et al., 1998Down ). YdaA is homologous to the regulators of mannitol catabolism of B. stearothermophilus (Henstra et al., 1999Down ) and Clostridium acetobutylicum (accession no. U53868). The designation MtlR was thus proposed for YdaA (Stülke et al. , 1998Down ).

Phenotypes of B. subtilis strains defective in EII components
The functional role of the GlvC and YbfS permeases was determined. glvC was identified in the framework of the B. subtilis sequencing project and proposed to encode a ß-glucoside- specific EII (Yamamoto et al., 1996Down ). However, the functional characterization of genes encoding a maltose-specific EII and a phospho-{alpha}-glucosidase from Fusobacterium mortiferum revealed that the homologous GlvA of B. subtilis, encoded in the same operon as GlvC, is in fact a phospho-{alpha}-glucosidase rather than a phospho-ß-glucosidase (Bouma et al., 1997 Down ; Thompson et al., 1998Down ). In addition, GlvC exhibits higher sequence similarity to PTS permeases of the glucose/maltose family than to the sucrose/ß-glucoside-specific PTS permeases. To study the functional role of glvC we constructed a glvC mutant of B. subtilis. We additionally constructed strains containing ypqE and ybfS mutations (Kunst et al., 1997Down ; see Table 2Up). To obtain a comprehensive set of mutants we used strain GP113 in which the part of ptsG encoding the IIB and IIA domains of the glucose permease was deleted. The IIA domain of the glucose permease has been shown to phosphorylate IIB domains of the sucrose- and trehalose-specific PTS permeases that lack a IIA domain (Sutrina et al., 1990Down ; Dahl, 1997Down ).

B. subtilis 168 and the mutant strains were grown in C minimal medium with either glucose, maltose, glucosamine or N- acetylglucosamine as a single source of carbon and energy and their doubling times were determined (Table 4Down ). All four sugars were readily utilized by the wild-type strain, although the generation time of cultures grown on N-acetylglucosamine was longer than the generation time of cells grown on either glucose, maltose or glucosamine. The PTS is required for efficient catabolism of all the carbon sources tested as is evident from the slow growth rate (or the lack of growth) of the ptsH mutant strain. As observed previously, the ptsH mutant strain grew slowly on glucose, suggesting the presence of a non-PTS system for glucose transport and phosphorylation (Stülke et al., 1995Down ). The recently identified glucose transporter, GlcP, is presumably responsible for this residual growth (Paulsen et al., 1998Down ). Similarly, slow growth of the ptsH mutant was observed with glucosamine, whereas maltose and N-acetylglucosamine were not utilized by this strain. The IIA and IIB domains of the glucose permease were required for efficient growth on glucose and maltose while the ptsG mutation did not affect growth on glucosamine or N- acetylglucosamine. Four conclusions can be drawn from these results. (i) PTS permeases distinct from PtsG may transport and phosphorylate glucose, albeit with low efficiency. (ii) Phosphotransfer via the IIA Glc domain appears to be necessary for efficient utilization of maltose. (iii) The glvC mutant strain GP110 grew normally on all the carbon sources tested with the exception of maltose. We propose, therefore, that glvC encodes a maltose-specific PTS permease and we redesignate the gene malP. This finding is in agreement with the presence of a phospho-{alpha}-glucosidase-encoding gene within the malP operon (see Fig. 1bUp) and with the strong sequence conservation of MalP with other maltose- and glucose-specific PTS permeases. (iv) The ybfS mutation resulted in impaired growth in the presence of glucosamine, suggesting that the EII encoded by ybfS catalyses the transport and phosphorylation of this sugar. This observation is reinforced by the genetic arrangement. ybfT, which precedes ybfS, exhibits a high degree of sequence similarity to the characterized (deaminating) glucosamine-6- phosphate isomerase of E. coli (Fig. 1cUp). Therefore, we propose to designate the ybfT and ybfS genes as gamA and gamP, respectively. The ypqE mutation did not yield a recognizable phenotype under the conditions tested here and the function of the encoded protein therefore remains unknown.


View this table:
[in this window]
[in a new window]
 
Table 4. Utilization of various carbon sources by mutants affected in PTS constituents

 

    ACKNOWLEDGEMENTS
 
Jonathan Reizer and Steffi Bachem contributed equally to this work. We are grateful to W. Hillen and G. Rapoport, in whose labs part of this work was carried out, for their support and encouragement. This work was supported by the National Institute of Health and the Deutsche Forschungsgemeinschaft.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Altschul, S. F. , Gish, W. , Miller, W. , Myers, E. W. & Lipman, D. J. (1990). Basic local alignment search tool.J Mol Biol 215, 403-410.[Medline]

Bachem, S. & Stülke, J. (1998). Regulation of the Bacillus subtilis GlcT antiterminator protein by components of the phosphotransferase system. J Bacteriol 180, 5319-5326 .[Abstract/Free Full Text]

Beijer, L. & Rutberg, L. (1992). Utilisation of glycerol and glycerol-3-phosphate is differently affected by the phosphotransferase system in Bacillus subtilis.FEMS Microbiol Lett 100, 217-220.

Blattner, F. R., Plunkett, G. I., Bloch, C. A. & 14 other authors (1997). The complete genome sequence of Escherichia coli K12. Science 277, 1453–1474.[Abstract/Free Full Text]

Bouma, C. L. , Reizer, J. , Reizer, A. , Robrish, S. A. & Thompson, J. (1997). 6-Phospho-{alpha}-D-glucosidase from Fusobacterium mortiferum: cloning, expression, and assignment to family 4 of the glycosylhydrolases.J Bacteriol 179, 4129-4137 .[Abstract/Free Full Text]

Branny, P. , De La Torre, F. & Garel, J. R. (1996). The genes for phosphofructokinase and pyruvate kinase of Lactobacillus delbrueckii subsp. bulgaricus constitute an operon.J Bacteriol 178, 4727-4730 .[Abstract/Free Full Text]

Charrier, V. , Buckley, E. , Parsonage, D. , Galinier, A. , Darbon, E. , Jaquinod, M. , Forest, E. , Deutscher, J. & Claiborne, A. (1997). Cloning and sequencing of two enterococcal glpK genes and regulation of the encoded glycerol kinases by phosphoenolpyruvate-dependent, phosphotransferase system- catalyzed phosphorylation of a single histidyl residue. J Biol Chem 272, 14166-14174 .[Abstract/Free Full Text]

Dahl, M. K. (1997). Enzyme IIGlc contributes to trehalose metabolism in Bacillus subtilis. FEMS Microbiol Lett 148, 233-238.

Débarbouillé, M. , Fouet, A. , Arnaud, M. , Klier, A. & Rapoport, G. (1990). The sacT gene regulating the sacPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators.J Bacteriol 172, 3966-3973 .[Abstract/Free Full Text]

Débarbouillé, M. , Martin-Verstraete, I. , Klier, A. & Rapoport, G. (1991). The transcriptional regulator LevR of Bacillus subtilis has domains homologous to both {sigma} 54- and phosphotransferase system-dependent regulators. Proc Natl Acad Sci USA 88, 2212-2216 .[Abstract/Free Full Text]

Deutscher, J. , Fischer, C. , Charrier, V. , Galinier, A. , Lindner, C. , Darbon, E. & Dossonet, V. (1997). Regulation of carbon metabolism in Gram-positive bacteria by protein phosphorylation.Folia Microbiol 42, 171-178.

Fischer, C. , Geourjon, C. , Bourson, C. & Deutscher, J. (1996). Cloning and characterization of the Bacillus subtilis prkA gene encoding a novel serine protein kinase.Gene 168, 55-60.[Medline]

Fouet, A. , Arnaud, M. , Klier, A. & Rapoport, G. (1987). Bacillus subtilis sucrose- specific enzyme II of the phosphotransferase system: expression in Escherichia coli and homology to enzymes II from enteric bacteria. Proc Natl Acad Sci USA 84, 8773-8777 .[Abstract/Free Full Text]

Galinier, A. , Haiech, J. , Kilhoffer, M.-C. , Jaquinod, M. , Stülke, J. , Deutscher, J. & Martin-Verstraete, I. (1997). The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proc Natl Acad Sci USA 94, 8439-8444 .[Abstract/Free Full Text]

Galinier, A. , Kravanja, M. , Engelmann, R. , Hengstenberg, W. , Kilhoffer, M. C. , Deutscher, J. & Haiech, J. (1998). New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression. Proc Natl Acad Sci USA 95, 1823-1828 .[Abstract/Free Full Text]

Gibson, T. G. (1984). Studies on the Epstein–Barr virus genome. PhD thesis, University of Cambridge, Cambridge, UK.

Glaser, P., Kunst, F., Arnaud, M. & 14 other authors (1993). Bacillus subtilis genome project: cloning and sequencing of the 97 kb region from 325° to 333°. Mol Microbiol 10, 371–384.[Medline]

Gonzy-Tréboul, G. , Zagorec, M. , Rain-Guion, M. C. & Steinmetz, M. (1989). Phosphoenolpyruvate:sugar phosphotransferase system of Bacillus subtilis: nucleotide sequence of ptsX, ptsH and the 5'-end of ptsI and evidence for a ptsHI operon. Mol Microbiol 3, 103-112.[Medline]

Gunnewijk, M. G. W. , Postma, P. W. & Poolman, B. (1999). Phosphorylation and functional properties of the IIA domain of the lactose transport protein of Streptococcus thermophilus. J Bacteriol 181, 632-641.[Abstract/Free Full Text]

Henstra, S. A. , Tuinhof, M. , Duurkens, R. H. & Robillard, G. T. (1999). The Bacillus stearothermophilus mannitol regulator, MtlR, of the phosphotransferase system. J Biol Chem 274, 4754-4763 .[Abstract/Free Full Text]

Holmberg, C. , Beijer, L. , Rutberg, B. & Rutberg, L. (1990). Glycerol catabolism in Bacillus subtilis: nucleotide sequence of the genes encoding glycerol kinase (glpK) and glycerol-3-phosphate dehydrogenase ( glpD). J Gen Microbiol 136, 2367-2375 .[Abstract/Free Full Text]

Kravanja, M. , Engelmann, R. , Dossonnet, V. , Blüggel, M. , Meyer, H. E. , Frank, R. , Galinier, A. , Deutscher, J. , Schnell, N. & Hengstenberg, W. (1999). The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase. Mol Microbiol 31, 59-66.[Medline]

Kunst, F. & Rapoport, G. (1995). Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis . J Bacteriol 177, 2403-2407 .[Abstract/Free Full Text]

Kunst, F., Ogasawara, N., Moszer, I. & 148 others (1997). The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249–256.

Lapidus, A. , Galleron, N. , Sorokin, A. & Ehrlich, S. D. (1997). Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnBdnaB region. Microbiology 143, 3431-3441 .[Abstract/Free Full Text]

Le Coq, D. , Lindner, C. , Krüger, S. , Steinmetz, M. & Stülke, J. (1995). New ß-glucoside (bgl) genes in Bacillus subtilis: the bglP gene product has both transport and regulatory functions, similar to those of BglF, its Escherichia coli homolog. J Bacteriol 177, 1527-1535 .[Abstract/Free Full Text]

Lengeler, J. W. , Jahreis, K. & Wehmeier, U. F. (1994). Enzymes II of the phosphoenolpyruvate-dependent phosphotransferase systems: their structure and function in carbohydrate transport. Biochim Biophys Acta 1188, 1-28.[Medline]

Lereclus, D. & Arantès, O. (1992). spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol Microbiol 6, 35-46.[Medline]

Macfayden, L. P. , Dorocicz, I. R. , Reizer, J. , Saier, M. H.Jr & Redfield, R. J. (1996). Regulation of competence development and sugar utilization in Haemophilus influenzae Rd by a phosphoenolpyruvate:fructose phosphotransferase system. Mol Microbiol 21, 941-952.[Medline]

Martin-Verstraete, I. , Débarbouillé, M. , Klier, A. & Rapoport, G. (1990). Levanase operon of Bacillus subtilis includes a fructose-specific phosphotransferase system regulating the expression of the operon. J Mol Biol 214, 657-671.[Medline]

Martin-Verstraete, I. , Charrier, V. , Stülke, J. , Galinier, A. , Erni, B. , Rapoport, G. & Deutscher, J. (1998). Antagonistic effects of dual PTS- catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR. Mol Microbiol 28, 293-303.[Medline]

Moszer, I. , Glaser, P. & Danchin, A. (1995). SubtiList: a relational database for the Bacillus subtilis genome. Microbiology 141, 261-268.[Abstract/Free Full Text]

Nelson, S. O. , Schuitema, A. R. J. , Benne, R. , van der Ploeg, L. H. T. , Plijter, J. S. , Aan, F. & Postma, P. W. (1984). Molecular cloning, sequencing, and expression of the crr gene: the structural gene for IIIGlc of the bacterial PEP:glucose phosphotransferase system. EMBO J 3, 1587-1593.[Medline]

Nguyen, C. C. & Saier, M. H.Jr (1995). Phylogenetic analysis of the putative phosphorylation domain in the pyruvate kinase of Bacillus stearothermophilus. Res Microbiol 146, 713-719.[Medline]

Nobelmann, B. & Lengeler, J. W. (1995). Sequence of the gat operon for galactitol utilization from a wild-type strain EC3132 of Escherichia coli. Biochim Biophys Acta 1262, 69-72.[Medline]

Paulsen, I. T. , Chauvaux, S. , Choi, P. & Saier, M. H.Jr (1998). Characterization of glucose-specific catabolite repression-resistant mutants of Bacillus subtilis: identification of a novel hexose:H+ symporter. J Bacteriol 180, 498-504.[Abstract/Free Full Text]

Postma, P. W. , Lengeler, J. W. & Jacobson, G. R. (1993). Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57, 543-594.[Abstract/Free Full Text]

Powell, B. S. , Court, D. L. , Inada, T. , Nakamura, Y. , Michotey, V. , Cui, X. , Reizer, A. , Saier, M. H.Jr & Reizer, J. (1995). Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J Biol Chem 270, 4822-4839 .[Abstract/Free Full Text]

Pries, A. , Priefert, H. , Krüger, N. & Steinbüchel, A. (1991). Identification and characterization of two Alcaligenes eutrophus gene loci relevant to the poly(ß-hydroxybutyric acid)-leaky phenotype which exhibit homology to ptsH and ptsI of Escherichia coli. J Bacteriol 173, 5843-5853 .[Abstract/Free Full Text]

Reizer, J. & Reizer, A. (1996). A voyage along the bases: novel phosphotransferase genes revealed by in silico analyses of the Escherichia coli genome. Res Microbiol 147, 458-471.[Medline]

Reizer, J. & Saier, M. H.Jr (1997). Modular multidomain phosphoryl transfer proteins of bacteria. Curr Opin Struct Biol 7, 407-415.[Medline]

Reizer, J. , Novotny, M. J. , Stuiver, I. & Saier, M. H.Jr (1984). Regulation of glycerol uptake by the phosphoenolpyruvate-sugar phosphotransferase system in Bacillus subtilis. J Bacteriol 159, 243-250.[Abstract/Free Full Text]

Reizer, J. , Paulsen, I. T. , Reizer, A. , Titgemeyer, F. & Saier, M. H.Jr (1996). Novel phosphotransferase system genes revealed by bacterial genome analysis: the complete complement of pts genes in Mycoplasma genitalium. Microb Comp Genomics 1, 151-164.[Medline]

Reizer, J. , Hoischen, C. , Titgemeyer, F. , Rivolta, C. , Rabus, R. , Stülke, J. , Karamata, D. , Saier, M. H.Jr & Hillen, W. (1998). A novel protein kinase that controls carbon catabolite repression in bacteria. Mol Microbiol 27, 1157-1169 .[Medline]

Sadaie, Y. & Yata, K. (1998). Functional analysis of the phoB/cotA region of the Bacillus subtilis chromosome containing the konjac glucomannan utilization operon. In Abstracts of the International Conference on Bacilli, Japan, abstract P78.

Saier, M. H.Jr & Reizer, J. (1992). Proposed uniform nomenclature for the proteins and protein domains of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. J Bacteriol 174, 1433-1438 .[Free Full Text]

Saier, M. H.Jr & Reizer, J. (1994). The bacterial phosphotransferase system: new frontiers 30 years later. Mol Microbiol 13, 755-764.[Medline]

Sakai, H. & Ohta, T. (1993). Molecular cloning and nucleotide sequence of the gene for pyruvate kinase of Bacillus stearothermophilus and the production of the enzyme in Escherichia coli. Evidence that the genes for phosphofructokinase and pyruvate kinase constitute an operon. Eur J Biochem 211, 851-859.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schnetz, K. , Stülke, J. , Gertz, S. , Krüger, S. , Krieg, M. , Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator protein of the BglG family. J Bacteriol 178, 1971-1979 .[Abstract/Free Full Text]

Schöck, F. & Dahl, M. K. (1996). Analysis of DNA flanking the treA gene of Bacillus subtilis reveals genes encoding a putative specific enzyme IITre and a potential regulator of the trehalose operon. Gene 175, 59-63.[Medline]

Steinmetz, M. , Le Coq, D. & Aymerich, S. (1989). Induction of saccharolytic enzymes by sucrose in Bacillus subtilis: evidence for two partially interchangeable regulatory pathways. J Bacteriol 171, 1519-1523 .[Abstract/Free Full Text]

Stülke, J. & Hillen, W. (1998). Coupling physiology and gene regulation in bacteria: the phosphotransferase sugar uptake system delivers the signals. Naturwissenschaften 85, 583-592.[Medline]

Stülke, J. , Martin-Verstraete, I. , Charrier, V. , Klier, A. , Deutscher, J. & Rapoport, G. (1995). The HPr protein of the phosphotransferase system links induction and catabolite repression of the Bacillus subtilis levanase operon. J Bacteriol 177, 6928-6936 .[Abstract/Free Full Text]

Stülke, J. , Martin-Verstraete, I. , Zagorec, M. , Rose, M. , Klier, A. & Rapoport, G. (1997). Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Mol Microbiol 25, 65-78.[Medline]

Stülke, J. , Arnaud, M. , Rapoport, G. & Martin-Verstraete, I. (1998). PRD – a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol 28, 865-874.[Medline]

Sutrina, S. L. , Reddy, P. , Saier, M. H.Jr & Reizer, J. (1990). The glucose permease of Bacillus subtilis is a single polypeptide chain that functions to energize the sucrose permease. J Biol Chem 265, 18581-18589 .[Abstract/Free Full Text]

Thompson, J. , Pikis, A. , Ruvinov, S. B. , Henrissat, B. , Yamamoto, H. & Sekiguchi, J. (1998). The gene glvA of Bacillus subtilis 168 encodes a metal-requiring, NAD(H)-dependent 6-phospho-{alpha}-glucosidase. J Biol Chem 273, 27347-27356 .[Abstract/Free Full Text]

Titgemeyer, F. , Walkenhorst, J. , Reizer, J. , Stuiver, M. H. , Cui, X. & Saier, M. H.Jr (1995). Identification and characterization of phosphoenolpyruvate:fructose phosphotransferase systems in three Streptomyces species. Microbiology 141, 51-58.[Abstract/Free Full Text]

Tobisch, S. , Glaser, P. , Krüger, S. & Hecker, M. (1997). Identification and characterization of a new ß-glucoside utilization system in Bacillus subtilis . J Bacteriol 179, 496-506.[Abstract/Free Full Text]

Tobisch, S. , Stülke, J. & Hecker, M. (1999). Regulation of the lic operon of Bacillus subtilis and characterization of potential phosphorylation sites of the LicR regulator protein by site-directed mutagenesis. J Bacteriol 181, 4995-5003 .[Abstract/Free Full Text]

Tortosa, P. , Aymerich, S. , Lindner, C. , Saier, M. H.Jr , Reizer, J. & Le Coq, D. (1997). Multiple phosphorylation of SacY, a Bacillus subtilis antiterminator negatively controlled by the phosphotransferase system. J Biol Chem 272, 17230-17237 .[Abstract/Free Full Text]

Trieu-Cuot, P. & Courvalin, P. (1983). Nucleotide sequence of Streptococcus faecalis plasmid gene encoding the 3'5''-aminoglycoside phosphotransferase type III. Gene 23, 331-341.[Medline]

Wehtje, C. , Beijer, L. , Nilsson, R. P. & Rutberg, B. (1995). Mutations in the glycerol kinase gene restore the ability of a ptsGHI mutant of Bacillus subtilis to grow on glycerol. Microbiology 141, 1193-1198 .[Abstract/Free Full Text]

Yamamoto, H. , Uchiyama, S. , Fajar, A. N. , Ogasawara, N. & Sekiguchi, J. (1996). Determination of a 12 kb nucleotide sequence around the 76° region of the Bacillus subtilis chromosome. Microbiology 142, 1417-1421 .[Abstract/Free Full Text]

Zagorec, M. & Postma, P. (1992). Cloning and nucleotide sequence of the ptsG gene of Bacillus subtilis. Mol Gen Genet 234, 325-328.[Medline]

Zhang, J. K. & Aronson, A. (1994). A Bacillus subtilis bglA gene encoding phospho-ß-glucosidase is inducible and closely linked to a NADH dehydrogenase-encoding gene. Gene 140, 85-90.[Medline]

Zhu, P.-P. , Reizer, J. , Reizer, A. & Peterkofsky, A. (1993). Unique monocistronic operon ( ptsH) in Mycoplasma capricolum encoding the phosphocarrier protein, HPr, of the phosphoenolpyruvate:sugar phosphotransferase system. J Biol Chem 268, 26531-26540 .[Abstract/Free Full Text]

Zukowski, M. M. , Miller, L. , Cogswell, P. , Chen, K. , Aymerich, S. & Steinmetz, M. (1990). Nucleotide sequence of the sacS locus of Bacillus subtilis reveals the presence of two regulatory genes. Gene 90, 153-155.[Medline]

Received 13 July 1999; revised 31 August 1999; accepted 3 September 1999.


This article has been cited by other articles:


Home page
DatabaseHome page
L. A. Florez, S. F. Roppel, A. G. Schmeisky, C. R. Lammers, and J. Stulke
A community-curated consensual annotation that is continuously updated: the Bacillus subtilis centred wiki SubtiWiki
Database, September 17, 2009; 2009(0): bap012 - bap012.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. E. Perkins and W. L. Nicholson
Uncovering New Metabolic Capabilities of Bacillus subtilis Using Phenotype Profiling of Rifampin-Resistant rpoB Mutants
J. Bacteriol., February 1, 2008; 190(3): 807 - 814.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
B. Reichenbach, D. A. Breustedt, J. Stulke, B. Rak, and B. Gorke
Genetic Dissection of Specificity Determinants in the Interaction of HPr with Enzymes II of the Bacterial Phosphoenolpyruvate:Sugar Phosphotransferase System in Escherichia coli
J. Bacteriol., July 1, 2007; 189(13): 4603 - 4613.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Goh, P. F. Ong, K. P. Song, T. V. Riley, and B. J. Chang
The complete genome sequence of Clostridium difficile phage {phi}C2 and comparisons to {phi}CD119 and inducible prophages of CD630
Microbiology, March 1, 2007; 153(3): 676 - 685.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. Maze, M. O'Connell-Motherway, G. F. Fitzgerald, J. Deutscher, and D. van Sinderen
Identification and Characterization of a Fructose Phosphotransferase System in Bifidobacterium breve UCC2003
Appl. Envir. Microbiol., January 1, 2007; 73(2): 545 - 553.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
J. Deutscher, C. Francke, and P. W. Postma
How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 939 - 1031.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Schonert, S. Seitz, H. Krafft, E.-A. Feuerbaum, I. Andernach, G. Witz, and M. K. Dahl
Maltose and Maltodextrin Utilization by Bacillus subtilis
J. Bacteriol., June 1, 2006; 188(11): 3911 - 3922.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
R. Iyer, N. S. Baliga, and A. Camilli
Catabolite Control Protein A (CcpA) Contributes to Virulence and Regulation of Sugar Metabolism in Streptococcus pneumoniae
J. Bacteriol., December 15, 2005; 187(24): 8340 - 8349.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
U. Dahl, T. Jaeger, B. T. Nguyen, J. M. Sattler, and C. Mayer
Identification of a Phosphotransferase System of Escherichia coli Required for Growth on N-Acetylmuramic Acid
J. Bacteriol., April 15, 2004; 186(8): 2385 - 2392.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Q. Ren, K. H. Kang, and I. T. Paulsen
TransportDB: a relational database of cellular membrane transport systems
Nucleic Acids Res., January 1, 2004; 32(90001): D284 - 288.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. H. Schmalisch, S. Bachem, and J. Stulke
Control of the Bacillus subtilis Antiterminator Protein GlcT by Phosphorylation: ELUCIDATION OF THE PHOSPHORYLATION CHAIN LEADING TO INACTIVATION OF GlcT
J. Biol. Chem., December 19, 2003; 278(51): 51108 - 51115.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Watanabe, M. Hamano, H. Kakeshita, K. Bunai, S. Tojo, H. Yamaguchi, Y. Fujita, S.-L. Wong, and K. Yamane
Mannitol-1-Phosphate Dehydrogenase (MtlD) Is Required for Mannitol and Glucitol Assimilation in Bacillus subtilis: Possible Cooperation of mtl and gut Operons
J. Bacteriol., August 15, 2003; 185(16): 4816 - 4824.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
A. F. Alice, G. Perez-Martinez, and C. Sanchez-Rivas
Phosphoenolpyruvate phosphotransferase system and N-acetylglucosamine metabolism in Bacillus sphaericus
Microbiology, July 1, 2003; 149(7): 1687 - 1698.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. F. Chan, K. M. O'Dwyer, L. M. Palmer, J. D. Ambrad, K. A. Ingraham, C. So, M. A. Lonetto, S. Biswas, M. Rosenberg, D. J. Holmes, et al.
Characterization of a Novel Fucose-Regulated Promoter (PfcsK) Suitable for Gene Essentiality and Antibacterial Mode-of-Action Studies in Streptococcus pneumoniae
J. Bacteriol., March 15, 2003; 185(6): 2051 - 2058.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
C. Meinken, H.-M. Blencke, H. Ludwig, and J. Stulke
Expression of the glycolytic gapA operon in Bacillus subtilis: differential syntheses of proteins encoded by the operon
Microbiology, March 1, 2003; 149(3): 751 - 761.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
H. Nothaft, S. Parche, A. Kamionka, and F. Titgemeyer
In Vivo Analysis of HPr Reveals a Fructose-Specific Phosphotransferase System That Confers High-Affinity Uptake in Streptomyces coelicolor
J. Bacteriol., February 1, 2003; 185(3): 929 - 937.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
K. G. Hanson, K. Steinhauer, J. Reizer, W. Hillen, and J. Stulke
HPr kinase/phosphatase of Bacillus subtilis: expression of the gene and effects of mutations on enzyme activity, growth and carbon catabolite repression
Microbiology, June 1, 2002; 148(6): 1805 - 1811.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
H. Yamamoto, M. Serizawa, J. Thompson, and J. Sekiguchi
Regulation of the glv Operon in Bacillus subtilis: YfiA (GlvR) Is a Positive Regulator of the Operon That Is Repressed through CcpA and cre
J. Bacteriol., September 1, 2001; 183(17): 5110 - 5121.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. Nolling, G. Breton, M. V. Omelchenko, K. S. Makarova, Q. Zeng, R. Gibson, H. M. Lee, J. Dubois, D. Qiu, J. Hitti, et al.
Genome Sequence and Comparative Analysis of the Solvent-Producing Bacterium Clostridium acetobutylicum
J. Bacteriol., August 15, 2001; 183(16): 4823 - 4838.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
V. Monedero, O. P. Kuipers, E. Jamet, and J. Deutscher
Regulatory Functions of Serine-46-Phosphorylated HPr in Lactococcus lactis
J. Bacteriol., June 1, 2001; 183(11): 3391 - 3398.
[Abstract] [Full Text]


Home page
Infect. Immun.Home page
N. Autret, I. Dubail, P. Trieu-Cuot, P. Berche, and A. Charbit
Identification of New Genes Involved in the Virulence of Listeria monocytogenes by Signature-Tagged Transposon Mutagenesis
Infect. Immun., April 1, 2001; 69(4): 2054 - 2065.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. S. Turner and J. D. Helmann
Mutations in Multidrug Efflux Homologs, Sugar Isomerases, and Antimicrobial Biosynthesis Genes Differentially Elevate Activity of the sigma X and sigma W Factors in Bacillus subtilis
J. Bacteriol., September 15, 2000; 182(18): 5202 - 5210.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reizer, J.
Right arrow Articles by Stülke, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reizer, J.
Right arrow Articles by Stülke, J.
Agricola
Right arrow Articles by Reizer, J.
Right arrow Articles by Stülke, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 1999 Society for General Microbiology.