Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 145 (1999), 3547-3556
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andersson, R. A.
Right arrow Articles by Pirhonen, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andersson, R. A.
Right arrow Articles by Pirhonen, M.
Agricola
Right arrow Articles by Andersson, R. A.
Right arrow Articles by Pirhonen, M.
Microbiology (1999), 145, 3547-3556.
© 1999 Society for General Microbiology


Plant-Microbe Interactions

Role of RpoS in virulence and stress tolerance of the plant pathogen Erwinia carotovora subsp. carotovora

Robert A. Andersson1, Viia Kõiv2, Cecilia Norman-Setterblad1 and Minna Pirhonen1

Department of Plant Biology, Swedish University of Agricultural Sciences (SLU), PO Box 7080,SE-75007 Uppsala, Sweden 1
Institute of Molecular and Cell Biology, University of Tartu, 23 Riia Street, EE 2400 Tartu, Republic of Estonia2

Author for correspondence: Minna Pirhonen. Tel: +46 18 673316. Fax: +46 18 673279. e-mail: Minna.Pirhonen{at}vbiol.slu.se


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The plant-pathogenic bacterium Erwinia carotovora subsp. carotovora causes plant disease mainly through a number of extracellular plant-cell-wall-degrading enzymes. In this study, the ability of an rpoS mutant of the Er. carotovora subsp. carotovora strain SCC3193 to infect plants and withstand environmental stress was characterized. This mutant was found to be sensitive to osmotic and oxidative stresses in vitro and to be deficient in glycogen accumulation. The production of extracellular enzymes in vitro was similar in the mutant and in the wild-type strains. However, the rpoS mutant caused more severe symptoms than the wild-type strain on tobacco plants and also produced more extracellular enzymes in planta, but did not grow to higher cell density in planta compared to the wild- type strain. When tested on plants with reduced catalase activities, which show higher levels of reactive oxygen species, the rpoS mutant was found to cause lower symptom levels and to have impaired growth. In addition, the mutant was unable to compete with the wild- type strain in planta and in vitro. These results suggest that a functional rpoS gene is needed mainly for survival in a competitive environment and during stress conditions, and not for effective infection of plants.

Keywords: extracellular enzymes, pathogenicity, sigma factor, catalase, competition

Abbreviations: Amp, ampicillin; Cel, cellulase; Cm, chloramphenicol ; EAI, Erwinia autoinducer; Km, kanamycin ; Peh, polygalacturonase; Pel, pectate lyase; PGA, polygalacturonic acid; Pnl, pectin lyase; Prt, protease; SA, salicylic acid

The GenBank accession number for the sequences determined in this work is AJ238884.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The phytopathogenic bacterium Erwinia carotovora subsp. carotovora causes soft rot on many economically important plants. The pathogen produces a number of plant-cell-wall-degrading enzymes, cellulases (Cel), pectate lyases (Pel), pectin lyase (Pnl), polygalacturonase (Peh) and proteases (Prt). The production and secretion of these enzymes is tightly regulated by several regulatory genes that have been identified and characterized in a number of studies (Andersson et al., 1999Down ; Chatterjee et al., 1995Down ; Cui et al., 1995Down , 1996 Down ; Eriksson et al., 1998Down ; Frederick et al., 1997Down ; Harris et al., 1998Down ; Jones et al., 1993Down ; Liu et al., 1993 Down , 1998Down , 1999Down ; Mukherjee et al. , 1996Down ; Murata et al., 1991Down , 1994 Down ; Pirhonen et al., 1991Down , 1993 Down ; Thomson et al., 1997Down , 1999 Down ). These genes encode various types of regulators (both positive and negative) that act on transcription, transcript stability and secretion of virulence factors.

During recent years, the function of the alternative sigma factor RpoS ({sigma}38) has been extensively studied in Escherichia coli and other Gram-negative bacteria. RpoS is a regulator of stationary-phase-induced genes and is required for survival during stress and starvation (for reviews, see Hengge-Aronis, 1996Down ; Loewen & Hengge-Aronis, 1994Down ; Loewen et al., 1998Down ). Recently, the rpoS gene from Er. carotovora subsp. carotovora strain 71 was cloned and an rpoS mutant strain was constructed and characterized (Calcutt et al., 1998Down ; Mukherjee et al., 1998Down ). It was shown that RpoS is needed to withstand various environmental stresses in vitro, and that the rpoS mutant had increased maceration capability and produced increased amounts of extracellular enzymes in vitro. This effect was found to be mediated by lower expression of the negative regulator rsmA in the rpoS mutant (Mukherjee et al., 1998Down ). We have previously found that a mutant that overproduces RpoS due to a mutation in a gene designated expM has reduced virulence and is affected in extracellular enzyme production and secretion (Andersson et al., 1999 Down ). The overproduction of RpoS was found to partly cause the phenotype of the expM mutant. The ExpM protein is a response regulator homologous to RssB/SprE in Es. coli and MviA in Salmonella typhimurium. These proteins belong to a new group of response regulators that are involved in the control of the stability of RpoS (Andersson et al., 1999Down ; Bearson et al. , 1996Down ; Muffler et al., 1996Down ; Pratt & Silhavy, 1996Down ). In this study we set out to characterize the phenotype of an rpoS mutant of Er. carotovora subsp. carotovora strain SCC3193, especially with regard to its virulence on tobacco plants. The mutant caused more severe symptoms than the wild-type strain on tobacco, presumably due to higher in planta production of extracellular enzymes, although it did not grow to higher cell densities on these plants. However, we show that the mutant was not able to infect tobacco with reduced catalase levels as efficiently as the wild-type strain, and that the growth of the mutant was impaired on these plants. Furthermore, we found that the rpoS mutant was outcompeted by the wild-type strain in planta and in vitro. As expected, we found that the rpoS mutant was more sensitive than the wild-type strain to osmotic and oxidative stress in vitro.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Strains, plasmids, basic techniques and chemicals.
The bacterial strains, plasmids and phages used in this study are listed in Table 1Down. Er. carotovora subsp. carotovora and Es. coli were grown in L medium at 28 °C and 37 °C, respectively. Plasmids were isolated with Qiagen plasmid purification kits according to the instructions given by the manufacturer. Transfer of plasmids to Er. carotovora subsp. carotovora was done by electroporation using a Bio-Rad gene pulser and transfer to Es. coli by electroporation or standard transformation techniques. Samples for Northern and Western blot analysis were collected from cells grown in L medium supplemented with 0·4% polygalacturonic acid (PGA; P-1879, Sigma). Assays for enzymes in in vitro cultures were performed on cells grown both with and without PGA. Ampicillin (Amp; 150 µg ml -1) or kanamycin (Km; 25 µg ml-1) were added when appropriate. Km was not used during the collection of samples for Northern blots and enzyme assays in order to avoid negative antibiotic effects. Transduction in Er. carotovora subsp. carotovora was performed as described by Pirhonen et al. (1991)Down using T4GT7. Transduction in Es. coli was performed with P1 using standard procedures (Miller, 1972Down ). ß-Galactosidase assays were performed essentially as described by Miller (1972Down ) and plasmid pMMKatF2 was used as a positive control in these experiments. The PCR reactions were performed with the proof-reading polymerase Pfu (Stratagene). Absorbance and optical density were measured with a DU-70 spectrophotometer from Beckman.


View this table:
[in this window]
[in a new window]
 
Table 1. Strains, plasmids and phages used in this study

 
Construction of the Er. carotovora subsp. carotovora rpoS mutant strain.
The alignment of nucleotide sequences from Es. coli and S. typhimurium rpoS genes enabled us to design an oligonucleotide primer pair, RAPSIG (5'- AATTCGTTACAAGGGGAAATCCGTA) and VIKSIGMA (5'- TTCATATCGTCATCTTGCGTGGTATCTT), which was used for PCR analysis of genomic Er. carotovora subsp. carotovora DNA. The PCR- generated product of predicted size, 870 bp, was subsequently cloned into pBluescript II to make pBSIG and checked by sequencing. Next, the Kmr interposon from pHP45{Omega}-Km (Fellay et al., 1987Down ) was inserted into the DraII site of the internal region of rpoS in the plasmid pBSIG. To generate a homologous exchange mutant of the Er. carotovora subsp. carotovora rpoS gene, the suicide vector pUT mini-Tn 5 Cm was used. pUT mini-Tn5 Cm carries the {lambda}pir- dependent R6K ori, which does not replicate in bacteria that lack {lambda}pir, such as Er. carotovora subsp. carotovora (de Lorenzo & Timmis, 1994Down ). The mobile unit of pUT mini-Tn5 Cm was cut out with EcoRI and Xba I and replaced with the fragment carrying the rpoS gene interrupted by the Kmr gene from pBSIG digested with Eco RI/XbaI. This construction, pPUSIG, was mobilized by conjugation from Es. coli S17-1 {lambda}pir into Er. carotovora subsp. carotovora SCC3193 as described by de Lorenzo & Timmis (1994)Down . Transconjugants were selected for the Kmr gene used for gene inactivation on minimal medium (M9) with glycerol (0·4%) and then tested for the loss of the vector marker (Amp). The potential marker-exchange mutants were verified by PCR using primers RAPSIG and VIKSIGMA. We transduced the mutated allele back to the wild-type strain SCC3193; all tranductants were found to have the same phenotype on indicator plates for extracellular enzymes. We chose one of the transductants for further studies. The transductant was named SCC8002 and a Southern blot showed that it had a single Kmr insertion in rpoS. A Western blot using an Es. coli RpoS antiserum (Jishage & Ishihama, 1995Down ) showed that SCC8002 did not produce any RpoS protein. The mutated rpoS allele from SCC8002 was then cloned by cutting chromosomal DNA from SCC8002 with SacI/ SacII and ligating these fragments to pBluescript II. The ligation was transformed into Es. coli and the mutated allele was isolated by direct selection for the Kmr gene of the interposon. The DNA flanking the interposon was sequenced and the sequence obtained was used to generate oligonucleotides that were used to amplify the rpoS gene from the wild-type strain SCC3193. The resulting PCR fragment of about 1·5 kb was cloned into the SmaI site of the low-copy-number vector pACYC177 to generate pRA910.

Nucleotide sequencing.
Nucleotide sequence of both strands of the Er. carotovora subsp. carotovora rpoS gene was determined by the dideoxy chain-termination method (Sanger et al., 1977Down ) using customized synthetic primers (15- to 22-mers; GENSET OLIGOS) and Sequenase system (version II) from US Biochemicals with [{alpha}35 -S]dATP (Amersham Life Sciences). A BLAST search was used to compare the deduced amino acid sequence from the Er. carotovora subsp. carotovora rpoS gene and RpoS proteins from other bacteria.

Glycogen production, catalase assays and Erwinia autoinducer (EAI) measurement.
Accumulation of glycogen was tested by growing cells overnight on agar plates containing 1% glucose and then staining with iodine vapour (Latil-Damotte & Lares, 1977Down ). Catalase activity was assayed by measuring hydrogen peroxide decomposition in a spectrophotometer at 240 nm (Beers & Sizer, 1952Down ). The amount of EAI was determined by a bioassay; Er. carotovora subsp. carotovora strain SCC3065 (Pirhonen et al., 1991Down , 1993Down ), unable to produce EAI and harbouring the pHV200I- plasmid, was mixed with various dilutions of supernatant from SCC3193 and SCC8002. Light production, and hence the concentration of EAI, was then measured in a luminometer.

Enzyme assays and virulence tests.
The activities of Peh, Pel, Prt and Cel in vitro were assayed as described previously (Pirhonen et al., 1991 Down ). The levels of Peh, Pel and Prt in planta were measured as follows. Twenty-four plants (Nicotiana tabacum cv. Xanthi) were infected for each strain (about 2x106 c.f.u. per plant). After 48 h incubation plants were pooled in groups of six and the fresh weight was determined. Plants were then homogenized in 1 ml water. Plant material and bacteria were removed by centrifugation and the extracellular enzyme activities were determined. The results are expressed as activity per gram fresh weight (units for Peh, 0·1 µmol glucose equivalent min -1; for Prt, increase in A436 h -1 (ml sample)-1; and for Pel, A 548). As a control, the enzyme activities in uninfected plants were determined. Symptom development and bacterial growth in planta were determined in wild-type plants (N. tabacum cv. Xanthi) and antisense catalase (Ascat1 no. 17) plants (Takahashi et al., 1997Down ). The plants were grown for 4 weeks at 22 °C in a growth chamber [16 h light regime, 150 µE s-1 m-2 (16·7 mlx)]. Plants were then infected and bacteria extracted essentially as described by Vidal et al. (1998) Down with the exception that 2–3x106 c.f.u. per plant (equal numbers for SCC3193 and SCC8002) were used to infect plants. After infection, plants were incubated for 48 h under the same conditions as above, but at 100% humidity to allow efficient infection. The results were analysed statistically by means of the Student’s t-test for which P-values are reported. Symptom levels were determined according to the following scale: 0=no symptoms, 1=clear infection of one leaf, 2=one leaf macerated, 3=infection spread to more than one leaf, 4=several leaves macerated, 5=only a few leaves uninfected. The mean symptom level was then calculated by adding the symptom levels of the infected plants and dividing by the number of plants used in each experiment. Salicylic acid (SA) treatment was done by adding SA to a final concentration of 1 mM to the plant growth medium 24 h before infection. When competition between SCC3193 and SCC8002 was studied in planta, 15 plants (N. tabacum cv. Xanthi) were infected with a mixture of equal numbers of both strains (a total of 2·1x106 c.f.u. per plant). After incubation for 48 h, bacteria were extracted and serial dilutions were plated on L medium with and without Km. The total c.f.u. and the c.f.u. on Km plates (SCC8002) were calculated as c.f.u. per infected plant. As a control, 30 plants were infected by SCC3193 and SCC8002 alone (2·8x106 and 2·0x106 c.f.u. per plant, respectively). Virulence tests on potato stems were performed on greenhouse-grown potato (Solanum tuberosum cv. Bintje), using a toothpick to infect the plants directly into the stem as described by McMillan et al. (1993)Down .

RNA isolation, Northern and Western blot analysis.
RNA for Northern blot analysis was isolated by the Qiagen RNA isolation kit. Samples were collected during 24 h of growth and Northern blots were performed as described previously (Andersson et al., 1999Down ). Western blots with Es. coli RpoS antisera (Jishage & Ishihama, 1995Down ) were performed according to Andersson et al. (1999Down ).

Stress experiments and competition in vitro.
Stress experiments during stationary phase were performed as follows (repeated at least twice). The cells were inoculated into 5 ml L medium and grown for 16 h to stationary phase. To test osmotic stress resistance, the cells were pelleted and resuspended in fresh L medium (5 ml) with or without the addition of 1 M NaCl. The cells were then grown for 24 h at 28 °C. To test oxidative stress resistance, 10 mM H2O2 was added directly to an overnight culture grown for 16 h and the cells were incubated for 4 h at 28 °C. The cells were plated and counted before and after the stress treatments. Complementation of the salt stress sensitivity of Es. coli strain RH90 was done essentially as above. The Es. coli strain MC4100 and the plasmid pMMKatF2 were used as controls in these experiments. Competition experiments between SCC3193 and SCC8002 in vitro were done as follows. The strains were grown separately for 16 h. They were then mixed in equal numbers and plated on L medium with and without Km to determine the c.f.u. in the inoculum. The mixture was diluted ten times in 10 mM MgSO4 and 10 µl of this dilution (around 3x106 total c.f.u.) was used to inoculate 5 ml L medium. The culture tubes were then grown for 48 h and again plated on L medium with and without Km. As controls, the strains were inoculated separately using the same procedure. This experiment was done four times with similar results. For stress tests during exponential phase, an overnight culture was subcultured into 5 ml fresh L medium and grown to an OD600 of 1·0. At this point, the cells were pelleted and resuspended in 10 mM MgSO4 with or without the addition of 2·5 mM H2O2. The cells were then incubated for 10 min at room temperature and serial dilutions were plated. This experiment was done twice with essentially the same results.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Cloning of the rpoS allele of strain SCC3193 and construction of an rpoS mutant
The rpoS gene encodes a subunit of the RNA polymerase which is involved in the control of a number of genes required for stress tolerance and survival during starvation (for reviews, see Hengge- Aronis, 1993Down , 1996Down ; Loewen & Hengge-Aronis, 1994Down ; Loewen et al., 1998Down ). To characterize the rpoS allele in the Er. carotovora subsp. carotovora strain SCC3193 and construct an rpoS mutant strain we first cloned a part of the rpoS gene by PCR. We constructed an rpoS mutant by marker exchange mutagenesis and then transduced the mutated allele to a clean background (SCC3193). One of the transductants, SCC8002, was chosen for further studies. A Southern blot analysis showed that SCC8002 had a single {Omega}-Km insertion in rpoS. We also performed a Western blot with antisera to the Es. coli RpoS protein and found that SCC8002 did not produce any RpoS protein (data not shown). The mutated rpoS allele from SCC8002 was then cloned and the DNA flanking the interposon was sequenced. Oligonucleotides were generated to amplify rpoS from the wild-type strain SCC3193 by PCR. The resulting fragment which contains 287 bp upstream of the potential start codon was cloned into the SmaI site of the low-copy-number vector pACYC177 to generate pRA910. The rpoS gene was sequenced and found to encode a polypeptide of 330 aa with 98·5% amino acid identity to the previously reported RpoS protein (Calcutt et al., 1998Down ) from Er. carotovora subsp. carotovora strain 71 (data not shown). To investigate whether the Er. carotovora subsp. carotovora rpoS gene was expressed from pRA910 and whether the RpoS protein encoded by the plasmid was functional in Es. coli , we performed complementation experiments. For this purpose we constructed the Es. coli strain RA100 by P1 transduction of the rpoS359::Tn10 allele from RH90 to FF1112, which carries a chromosomal otsB–lacZ fusion. The otsB gene in Es. coli encodes trehalose-6-phosphate phosphatase, which is known to be regulated by RpoS (Kaasen et al., 1992 Down ). We transformed FF1112 and RA100 with pRA910 and control plasmids and assayed the ß-galactosidase activity during growth in L medium. The results showed that the ß-galactosidase activity in RA100 carrying the empty vector pACYC177 was almost undetectable, whilst the introduction of pRA910 into RA100 activated the otsB–lacZ fusion (data not shown). We also tested the ability of pRA910 to complement the salt-stress-sensitive and the catalase-and glycogen-deficient phenotypes of the Es. coli rpoS mutant RH90. We found that pRA910 complemented all these phenotypes (data not shown). The rpoS gene encoded by pRA910 is driven by its own promoter but does not contain the major promoter region which was found between nt -561 and -525 upstream of the rpoS gene in strain 71 (Mukherjee et al., 1998Down ). However, it was found in this study that a weak promoter exists between nt -166 and +19. Since the DNA sequence in this region is almost perfectly conserved between the two strains, it is likely that this minor promoter region drives the expression of rpoS in pRA910. Similar to the results from strain 71 (Mukherjee et al., 1998 Down ), we did not detect any rpoS transcript smaller than about 1600 bp by Northern blot using RNA from the wild-type strain (Andersson et al., 1999Down ; data not shown) indicating that the region between nt -561 and -525 is also the major rpoS promoter in SCC3193.

Characterization of the stress tolerance of the Er. carotovora subsp. carotovora rpoS mutant in vitro
The sigma factor RpoS has been shown to be involved in the production of secondary metabolites, virulence and/or stress survival in many bacterial species, including plant and animal pathogens (Anderson et al., 1998Down ; Fang et al., 1992 Down ; Flavier et al., 1998Down ; Loewen et al., 1998Down ; Sarniguet et al., 1995Down ; Swords et al., 1997Down ; Wilmes-Riesenberg et al., 1997 Down ). We therefore decided to investigate whether RpoS has similar functions in the Er. carotovora subsp. carotovora strain SCC3193. To determine whether RpoS is needed for stress tolerance in SCC3193 during stationary phase, we analysed the phenotype of SCC8002 under osmotic and oxidative stress in L medium (Table 2Down). We found that SCC8002 was sensitive to these kinds of stresses as the survival of the rpoS mutant was significantly lower than for the wild-type strain. Es. coli rpoS mutants are deficient in the production of glycogen (Lange & Hengge-Aronis, 1991Down ). We therefore performed a glycogen plate assay and found that SCC8002 was affected in the production of glycogen (data not shown). We also performed a complementation test with pRA910 and found that the plasmid complemented the stress sensitivity of the mutant as well as the deficiency in glycogen accumulation (data not shown). The complementation of these phenotypes was not complete, but nevertheless evident, perhaps due to the low expression from the minor rpoS promoter. We also tested stress sensitivity during exponential growth (OD600 1·0; 3·3–4·5x108 c.f.u. ml-1 ). No significant difference in tolerance towards 2·5 mM H2O2 between SCC3193 and SCC8002 was shown as 14% of the cells survived for both strains. However, we found that the expM mutant strain SCC3032, which overproduces RpoS during exponential growth (Andersson et al., 1999Down ), had enhanced tolerance as 29% of the cells survived. The fact that the rpoS mutant did not show higher sensitivity than the wild-type might be explained by the low levels of RpoS found in the wild-type during exponential growth (Andersson et al., 1999Down ).


View this table:
[in this window]
[in a new window]
 
Table 2. Stress tolerance of rpoS mutant strain SCC8002 and wild-type strain SCC3193 during stationary phase in vitro

 
Production of extracellular enzymes by the rpoS mutant
The ability of the rpoS mutant strain SCC8002 to produce extracellular cell-wall-degrading enzymes in vitro was characterized by growing the cells in L medium containing 0·4% PGA and determining the Peh and Pel activity in the culture supernatant. As shown in Fig. 1(a)Down , we found these enzyme activities to be similar in SCC3193 and SCC8002. We also analysed the accumulation of transcripts from the pehA and pelC genes by Northern blot analysis; as shown in Fig. 1(b)Down, these transcripts accumulated to similar levels in both strains. In addition, we found that the amounts of Cel and Prt in the supernatant from SCC8002 were similar to SCC3193 (data not shown). We also assayed the basal level of Peh and Pel in L medium without PGA and found similar activities from both strains (data not shown). These results were somewhat surprising since Mukherjee et al. (1998Down ) found increased extracellular enzyme activities in the supernatant of an rpoS mutant of strain 71. They showed that RpoS acts positively on the expression of rsmA , which encodes a negative regulator of extracellular enzyme production. RsmA has been shown to be an RNA-binding protein that most likely binds various transcripts encoding virulence determinants and expedites their degradation (Liu et al., 1998Down ). We performed a Northern blot and found that, during stationary phase, the accumulation of rsmA transcript was lower in our rpoS mutant, whilst the levels were more similar to the wild-type during exponential phase. This is to be expected since rsmA seems to be controlled by both {sigma}70 and RpoS (Mukherjee et al., 1998Down ). Since the amount of RpoS protein is low during exponential growth (Andersson et al., 1999Down ), an rpoS mutation is not likely to affect rsmA levels until the cells reach stationary phase and RpoS starts to accumulate. This is supported by the finding that rsmA transcript accumulates to a higher level during exponential growth in an expM mutant strain which overproduces RpoS (Andersson et al., 1999Down ). Taken together, our data strongly suggest that RpoS also acts as a positive regulator of rsmA in SCC3193.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1. Enzyme activities and mRNA accumulation in the rpoS mutant strain SCC8002 and wild-type strain SCC3193. (a) Cell growth and activities of Peh and Pel in culture supernatants. Cells were grown in L medium containing 0·4% PGA. {blacksquare}, SCC3193; {blacktriangleup}, SCC8002. (b) Northern blot showing the accumulation of pehA and pelC transcripts. Five micrograms of RNA was loaded in each lane. The results are from a representative experiment.

 
We also analysed the amount of the diffusible signal molecule EAI but could not find any significant difference in its production in SCC8002 compared to SCC3193 (data not shown).

Virulence of the rpoS mutant
To characterize the virulence of SCC8002 on plants, we performed an assay on in-vitro-grown tobacco. The rpoS mutant was found to cause more severe symptoms than the wild-type strain (see Fig. 2Down). This is in agreement with Mukherjee et al. (1998)Down who showed that an rpoS mutant strain caused increased maceration of celery petioles. We also performed a virulence test on potato stems as described by McMillan et al. (1993 )Down . The virulence of SCC8002 was found to be similar to SCC3193 (data not shown). The reason why the rpoS mutant appears to be more virulent on tobacco but not on potato is not known, but it may be due to the infection starting in different parts of the host plants (stem inoculation in potato, leaf inoculation in tobacco). However, our general experience is that the tobacco assay is more sensitive and recognizes smaller differences in virulence (R. A. Andersson & M. Pirhonen, unpublished).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Symptom development and bacterial growth in wild- type and transgenic Ascat tobacco plants. The rpoS mutant SCC8002 causes lower symptom levels on tobacco plants carrying an antisense construction to catalase (Ascat) when compared to control plants (Xanthi), whilst the wild-type strain SCC3193 is not affected. (a) Symptom development. Symptom levels were determined on a scale of 0–5 as described in Methods and mean values are shown above the bar diagrams. (b) Numbers of bacteria extracted from these plants. Results are means±SD of 18 infected plants incubated for 48 h.

 
The increased virulence of SCC8002 on tobacco seedlings prompted us to investigate the growth of the rpoS mutant on tobacco in more detail. We therefore performed a number of experiments on in- vitro-grown tobacco plants in order to investigate if the enhanced symptoms caused by the rpoS mutant strain SCC8002 allowed it to grow better on tobacco when compared to the wild-type strain. Since the rpoS mutant was found to be more sensitive to oxidative stress in vitro we also tested the growth and the symptom development on transgenic tobacco (Ascat plants) with severely reduced catalase activity (about 90%) due to an antisense construction (Takahashi et al., 1997Down ). It has been postulated by Takahashi et al. (1997)Down that this reduction in catalase activity results in higher levels of reactive oxygen species in these plants. The results (Fig. 2Up), showed that SCC8002 caused more severe symptoms than the wild-type strain on control plants although the amount of bacteria extracted from the plants infected by the mutant was slightly, but not significantly, lower after 48 h incubation as compared to control plants infected by SCC3193. Interestingly, we found that the rpoS mutant caused significantly lower levels of symptoms on transgenic Ascat plants compared to control plants. Similarly, significantly lower numbers of bacteria could be extracted from the Ascat plants infected by the mutant strain as compared to control plants (P-value=0·064). This is in contrast to the growth of the wild-type strain, which was not affected on Ascat plants as compared to control plants. These results suggest that the rpoS mutant strain is more sensitive to the higher levels of reactive oxygen species produced in Ascat plants. However, since 3x106 cells were used to inoculate the plants, multiplication clearly occurred in both hosts, showing that the Ascat plants only partially restricted the growth of the rpoS mutant. Interestingly, Hassouni et al. (1999)Down recently reported that an Erwinia chrysanthemi msrA (methionine sulfoxide reductase) mutant exhibited reduced virulence. The msrA gene, which is not RpoS-regulated in Es. coli (Moskovitz et al., 1995Down ), encodes a protein which repairs oxidized proteins. The Er. chrysanthemi msrA mutant was found to have increased sensitivity to oxidative stress (Hassouni et al., 1999Down ). This study indicates, as in our work, that resistance to oxidative stress may be important for the virulence of soft-rot erwinias.

It has previously been shown that Ascat plants, as used in this study, are more resistant to tobacco mosaic virus (TMV) infection and that this effect is mediated through SA (Du & Klessig, 1997 Down ; Takahashi et al., 1997Down ). In tobacco, SA has been shown to induce resistance towards Er. carotovora subsp. carotovora (Palva et al., 1994Down ; Vidal et al., 1998Down ). To find out if SCC8002 was more sensitive to plant defence responses induced by SA and to rule out the possibility that the results obtained with the transgenic Ascat plants were due to higher levels of SA, we infected SA-treated tobacco plants with SCC3193 and SCC8002. On the control plants we found similar results as shown in Fig. 2Up, whilst the SA-treated plants showed increased resistance at the level of both symptom development and bacterial growth in planta. We were not able to detect any significant difference in the growth of SCC3193 and SCC8002 on the SA- treated plants (data not shown). Taken together, our results suggest that SCC8002 is more sensitive to reactive oxygen species not only in vitro but also in planta. The results also suggest that the rpoS mutant is not affected in its ability to infect wild-type tobacco. On the contrary, it causes more severe symptoms than SCC3193 on wild-type tobacco plants. This suggests that the rpoS mutant produces more extracellular enzymes in planta. To investigate this, we performed enzyme assays by using macerated plant tissue to determine the in planta levels of Peh, Pel and Prt (Table 3Down). We found that the level of Peh and Prt was significantly higher (twofold for Peh and sevenfold for Prt) in tobacco plants infected with the rpoS mutant as compared to plants infected with the wild-type strain, whilst the production of Pel did not differ between the two strains. It is therefore likely that the increased symptoms caused by the rpoS mutant strain are due to increased extracellular enzyme production in planta and not to higher cell density. This is in contrast with the in vitro results, as we could not find any difference in the levels of extracellular enzymes in vitro when the cells were grown in L medium with or without PGA. Whilst our work indicates that RpoS is a positive regulator of rsmA in SCC3193, it appears that the level of rsmA is more important in planta than during growth in L medium. This is supported by our previous results showing that the expM mutant strain SCC3032, which overproduces RpoS and thereby shows enhanced rsmA expression, has significantly lower virulence on tobacco than the wild-type strain (Andersson et al., 1999Down ). Introduction of an rpoS mutation in the expM mutant background caused an rsmA expression similar to that seen in an rpoS mutant and the expM rpoS double mutant was found to have almost fully restored virulence (Andersson et al., 1999Down ). In addition, the expM mutant is also affected in production and secretion of the extracellular enzymes in vitro (L medium plus PGA), but this phenotype seems not to be rsmA-dependent as the expM rpoS double mutant is similar to the expM mutant in this respect (Andersson et al., 1999Down ).


View this table:
[in this window]
[in a new window]
 
Table 3. Extracellular enzyme activities in plants infected with rpoS mutant strain SCC8002 and wild-type strain SCC3193

 
The rpoS mutant is unable to compete with the wild- type strain in vitro and in planta
It has previously been reported that an Es. coli strain with a null mutation in rpoS is unable to compete with an rpoS+ strain when grown in vitro (Zambrano et al., 1993Down ). Similarly, we found that the Er. carotovora subsp. carotovora rpoS mutant SCC8002 was unable to compete with SCC3193 when grown for 48 h in L medium. In these experiments, about 3x106 c.f.u. of the mutant and the wild-type strains were inoculated either together or separately. After incubation, only 0·3–1·0% of the total number of bacteria (about 1·5x109 c.f.u. ml-1) were SCC8002. When the strains were grown separately under the same conditions the rpoS mutant and the wild-type strain grew to about 8·0x10 8 c.f.u. ml-1 and 1·5x109 c.f.u. ml-1, respectively. This indicates that the growth of the wild-type is not affected by the presence of the rpoS mutant, whilst the mutant is severely affected in growth in the presence of the wild-type strain. The competition experiments in vitro prompted us to test if the rpoS mutant is able to compete with the wild-type strain in planta. We infected tobacco plants with a mixture of equal numbers of bacteria of both strains (total c.f.u. 2·1x10 6 per plant) and incubated the plants for 48 h. We then extracted the bacteria and plated serial dilutions on L medium with and without Km. In plants infected by the mixture, approximately 25% of the cells (total c.f.u. 2·4x108 per plant) were SCC8002, whilst both strains grew similarly in control plants infected with SCC3193 and SCC8002 separately (means of 2·6x108 and 2·9x108 c.f.u. per plant, respectively). This indicates that the rpoS mutant is not able to compete with the wild-type strain SCC3193 in planta . When we examined the symptom levels, we found that the plants infected by the mixture showed symptoms very similar to the plants infected by the wild-type strain alone (mean symptom levels of 1·9 for the mixture and 2·1 for SCC3193), whilst plants infected by the rpoS mutant alone showed more severe symptoms (mean symptom level 3·3). This indicates that the rpoS mutant does not contribute to the development of the symptoms when a mixture of the two strains is used to infect tobacco. Taken together, our results indicate that a functional rpoS gene is needed mainly for survival in a competitive environment and in the long term. This is supported by the fact that Mukherjee et al. (1998 )Down found that an Er. carotovora subsp. carotovora rpoS mutant of strain 71 is sensitive to carbon starvation.


    ACKNOWLEDGEMENTS
 
We thank Maj-Britt Karlsson, Gunvor Sandman, Mona Munther and Annelie Rimmer for excellent technical assistance. We thank Drs Hans Ronne, Sabina Vidal and Andres Mäe for critically reading the manuscript. We gratefully acknowledge Drs He Du and Daniel F. Klessig for the antisense catalase plants, Dr Arne Strøm for strain FF1112, Dr Regine Hengge-Aronis for strain RH90, Dr Akira Ishihama for the RpoS antiserum, Drs Kendall Gray and E. P. Greenberg for the pHV200I- plasmid and finally Dr Thomas Nyström for the pMMKatF 2 plasmid. This work was financed by the Nilsson-Ehle foundation, the Oscar and Lili Lamms foundation, the Royal Swedish Academy of Sciences (von Beskows foundation), the P. O. Lundells foundation (Uppsala University), the Stina and Richard H ögbergs foundation (SLU) and the Swedish Council for Forestry and Agricultural research.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Anderson, M. , Politt, C. E. , Roberts, I. S. & Eastgate, J. A. (1998). Identification and characterization of the Erwinia amylovora rpoS gene: RpoS is not involved in induction of fireblight disease symptoms. J Bacteriol 180, 6789-6792 .[Abstract/Free Full Text]

Andersson, R. A. , Palva, E. T. & Pirhonen, M. (1999). The response regulator ExpM is essential for the virulence of Erwinia carotovora subsp. carotovora and acts negatively on the sigma factor RpoS ({sigma} S). Mol Plant–Microbe Interact 12, 575-584.[Medline]

Bearson, S. M. , Benjamin, W. H.Jr , Swords, W. E. & Foster, J. W. (1996). Acid shock induction of RpoS is mediated by the mouse virulence gene mviA of Salmonella typhimurium. J Bacteriol 178, 2572-2579 .[Abstract/Free Full Text]

Beers, R. F. & Sizer, I. W. (1952). A spectrophotometric assay for measuring the breakdown of hydrogen peroxide by catalase. J Biol Chem 196, 133-140.

Calcutt, M. J. , Becker-Hapak, M. , Gaut, M. , Hoerter, J. & Eisenstark, A. (1998). The rpoS gene of Erwinia carotovora: gene organization and functional expression in E. coli. FEMS Microbiol Lett 159, 275-281.[Medline]

Chatterjee, A. , Cui, Y. , Liu, Y. , Dumenyo, C. K. & Chatterjee, A. K. (1995). Inactivation of rsmA leads to overproduction of extracellular pectinases, cellulases, and proteases in Erwinia carotovora subsp. carotovora in the abscence of the starvation/cell density sensing signal, N-(3-oxohexanoyl)-L-homoserine lactone. Appl Environ Microbiol 61, 1959-1967 .[Abstract]

Cui, Y. , Chatterjee, A. , Liu, Y. , Dumenyo, C. K. & Chatterjee, A. K. (1995). Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N -(3-oxohexanoyl)-L-homoserine lactone, and pathogenicity in soft- rotting Erwinia spp. J Bacteriol 177, 5108-5115 .[Abstract/Free Full Text]

Cui, Y. , Madi, L. , Mukherjee, A. , Dumenyo, C. K. & Chatterjee, A. K. (1996). The RsmA - mutants of Erwinia carotovora subsp. carotovora strain Ecc71 overexpress hrpNEcc and elicit a hypersensitive reaction-like response in tobacco leaves. Mol Plant–Microbe Interact 9, 565-573.[Medline]

Du, H. & Klessig, D. F. (1997). Role for salicylic acid in the activation of defense responses in catalase-deficient transgenic tobacco. Mol Plant–Microbe Interact 10, 922-925.

Eriksson, A. R. B. , Andersson, R. A. , Pirhonen, M. & Palva, E. T. (1998). Two-component regulators involved in the global control of virulence in Erwinia carotovora subsp. carotovora. Mol Plant–Microbe Interact 11, 743-752.[Medline]

Fang, F. C. , Libby, S. J. , Buchmeier, N. A. , Loewen, P. C. , Switala, J. , Harwood, J. & Guiney, D. C. (1992). The alternative {sigma} factor KatF (RpoS) regulates Salmonella virulence. Proc Natl Acad Sci USA 89, 11978-11982 .[Abstract/Free Full Text]

Fellay, R. , Frey, J. & Krisch, H. (1987). Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene 52, 147-154.[Medline]

Flavier, A. B. , Schell, M. A. & Denny, T. P. (1998). An RpoS ({sigma}S ) homologue regulates acylserine lactone-dependent autoinduction in Ralstonia solanacearum. Mol Microbiol 28, 475-486.[Medline]

Frederick, R. D. , Chiu, J. , Bennetzen, J. L. & Handa, A. K. (1997). Identification of a pathogenicity locus, rpfA, in Erwinia carotovora subsp. carotovora that encodes a two component sensor- regulator protein. Mol Plant–Microbe Interact 10, 407-415.[Medline]

Giaever, H. M. , Styrvold, O. B. , Kaasen, I. & Strøm, A. R. (1988). Biochemical and genetic characterization of osmoregulatory trehalose synthesis in Escherichia coli. J Bacteriol 170, 2841-2849 .[Abstract/Free Full Text]

Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557-580.[Medline]

Harris, S. J. , Shih, Y.-L. , Bentley, S. D. & Salmond, G. P. C. (1998). The hexA gene of Erwinia carotovora encodes a LysR homologue and regulates motility and the expression of multiple virulence determinants. Mol Microbiol 28, 705-717.[Medline]

Hassouni, M. E. , Chambost, J. P. , Expert, D. , van Gijsegem, F. & Barras, F. (1999). The minimal set member msrA , encoding peptide methionine sulfoxide reductase, is a virulence determinant of the plant pathogen Erwinia chrysanthemi. Proc Natl Acad Sci USA 96, 887-892.[Abstract/Free Full Text]

Hengge-Aronis, R. (1993). Survival of hunger and stress: the role of rpoS in early stationary phase gene regulation in Escherichia coli. Cell 72, 165-168.[Medline]

Hengge-Aronis, R. (1996). Back to log phase: {sigma} S as a global regulator in the osmotic control of gene expression in Escherichia coli. Mol Microbiol 21, 887-893.[Medline]

Jishage, M. & Ishihama, A. (1995). Regulation of RNA polymerase sigma subunit synthesis in Escherichia coli: intracellular levels of sigma 70 and sigma 38. J Bacteriol 177, 6832-6835 .[Abstract/Free Full Text]

Jones, S., Yu, B., Bainton, N. J. & 11 other authors (1993). The lux autoinducer regulates the production of exoenzyme virulence determinants in Erwinia carotovora and Pseudomonas aeruginosa. EMBO J 12, 2477–2482.[Medline]

Kaasen, I. , Falkenberg, P. , Styrvold, O. B. & Strøm, A. R. (1992). Molecular cloning and physical mapping of the otsBA genes, which encode the osmoregulatory trehalose pathway of Escherichia coli : evidence that transcription is activated by katF (AppR). J Bacteriol 174, 889-898.[Abstract/Free Full Text]

Lange, R. & Hengge-Aronis, R. (1991). Identification of a central regulator of stationary-phase gene expression in Escherichia coli . Mol Microbiol 5, 49-59.[Medline]

Latil-Damotte, M. & Lares, C. (1977). Relative order of glg mutations affecting glycogen biosynthesis in Escherichia coli K12. Mol Gen Genet 150, 325-328.[Medline]

Liu, Y. , Murata, H. , Chatterjee, A. & Chatterjee, A. K. (1993). Characterization of a novel regulatory gene aepA that controls extracellular enzyme production in the phytopathogenic bacterium Erwinia carotovora subsp. carotovora. Mol Plant–Microbe Interact 6, 299-308.[Medline]

Liu, Y. , Cui, Y. , Mukherjee, A. & Chatterjee, A. K. (1998). Characterization of a novel RNA regulator of Erwinia carotovora ssp. carotovora that controls production of extracellular enzymes and secondary metabolites. Mol Microbiol 29, 219-234.[Medline]

Liu, Y. , Jiang, G. , Cui, Y. , Mukherjee, A. , Ma, W. L. & Chatterjee, A. K. (1999). kdgR Ecc negatively regulates genes for pectinases, cellulase, protease, harpinEcc, and a global RNA regulator in Erwinia carotovora subsp. carotovora. J Bacteriol 181, 2411-2421 .[Abstract/Free Full Text]

Loewen, P. C. & Hengge-Aronis, R. (1994). The role of the sigma factor {sigma}S (KatF) in bacterial global regulation. Annu Rev Microbiol 48, 53-80.[Medline]

Loewen, P. C. , Hu, B. , Strutinsky, J. & Sparling, R. (1998). Regulation in the rpoS regulon of Escherichia coli. Can J Microbiol 44, 707-717.[Medline]

de Lorenzo, V. & Timmis, K. N. (1994). Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5 - and Tn10-derived minitransposons. Methods Enzymol 235, 386-405.[Medline]

McMillan, G. P. , Hedley, D. , Fyffe, L. & Pérombelon, M. C. M. (1993). Potato resistance to soft-rot erwinias is related to cell wall pectin esterification. Physiol Mol Plant Pathol 42, 279-289.

Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Moskovitz, J. , Rahman, M. A. , Strassman, J. , Yancey, S. O. , Kushner, S. R. , Brot, N. & Weissbach, H. (1995). Escherichia coli peptide methionine sulfoxide reductase gene: regulation of expression and role in protecting against oxidative damage. J Bacteriol 177, 502-507.[Abstract/Free Full Text]

Muffler, A. , Fischer, D. , Altuvia, S. , Storz, G. & Hengge-Aronis, R. (1996). The response regulator RssB controls stability of the {sigma}S subunit of RNA polymerase in Escherichia coli. EMBO J 15, 1333-1339 .[Medline]

Mukherjee, A. , Cui, Y. , Liu, Y. , Dumenyo, C. K. & Chatterjee, A. K. (1996). Global regulation in Erwinia species by Erwinia carotovora rsmA, a homologue of Escherichia coli csrA: repression of secondary metabolites, pathogenicity and hypersensitive reaction. Microbiology 142, 427-434.[Abstract/Free Full Text]

Mukherjee, A. , Cui, Y. , Ma, W. , Liu, Y. , Ishihama, A. , Eisenstark, A. & Chatterjee, A. K. (1998). RpoS (sigma-S) controls expression of rsmA, a global regulator of secondary metabolites, harpin, and extracellular proteins in Erwinia carotovora. J Bacteriol 180, 3629-3634 .[Abstract/Free Full Text]

Mulvey, M. R. , Sorby, P. A. , Triggs-Raine, B. L. & Loewen, P. C. (1988). Cloning and physical characterization of katE and katF required for catalase HPII expression in Escherichia coli. Gene 73, 337-345.[Medline]

Murata, H. , McEvoy, J. L. , Chatterjee, A. , Collmer, A. & Chatterjee, A. K. (1991). Molecular cloning of an aepA gene that activates production of extracellular pectolytic, cellulolytic, and proteolytic enzymes in Erwinia carotovora subsp. carotovora. Mol Plant–Microbe Interact 4, 239-246.

Murata, H. , Chatterjee, A. , Liu, Y. & Chatterjee, A. K. (1994). Regulation of the production of extracellular pectinase, cellulase, and protease in the soft rot bacterium Erwinia carotovora subsp. carotovora : evidence that aepH of E. carotovora subsp. carotovora 71 activates gene expression in E. carotovora subsp. carotovora, E. carotovora subsp. atroseptica, and Escherichia coli. Appl Environ Microbiol 60, 3150-3159 .[Abstract/Free Full Text]

Palva, T. K. , Hurtig, M. , Saindrenan, P. & Palva, E. T. (1994). Salicylic acid induced resistance to Erwinia carotovora subsp. carotovora in tobacco. Mol Plant–Microbe Interact 7, 356-363.

Pearson, J. P. , Gray, K. M. , Passador, L. , Tucker, K. D. , Eberhard, A. , Iglewski, B. H. & Greenberg, E. P. (1994). Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc Natl Acad Sci USA 91, 197-201.[Abstract/Free Full Text]

Pirhonen, M. , Heino, P. , Helander, I. , Harju, P. & Palva, E. T. (1988). Bacteriophage T4 resistant mutants of the plant pathogen Erwinia carotovora. Microb Pathog 4, 359-367.[Medline]

Pirhonen, M. , Saarilahti, H. , Karlsson, M.-B. & Palva, E. T. (1991). Identification of pathogenicity determinants of Erwinia carotovora subsp. carotovora by transposon mutagenesis. Mol Plant–Microbe Interact 4, 276-283.

Pirhonen, M. , Flego, D. , Heikinheimo, R. & Palva, E. T. (1993). A small diffusible signal molecule is responsible for the global control of virulence and exoenzyme production in the plant pathogen Erwinia carotovora. EMBO J 12, 2467-2476 .[Medline]

Pratt, L. A. & Silhavy, T. J. (1996). The response regulator SprE controls the stability of RpoS. Proc Natl Acad Sci USA 93, 2488-2492 .[Abstract/Free Full Text]

Sanger, F. , Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467 .[Abstract/Free Full Text]

Sarniguet, A. , Kraus, J. , Henkels, M. D. , Muehlchen, A. M. & Loper, J. E. (1995). The sigma factor {sigma}s affects antibiotic production and biological control activity of Pseudomonas fluorescens Pf-5. Proc Natl Acad Sci USA 92, 12255-12259 .[Abstract/Free Full Text]

Swords, W. E. , Cannon, B. M. & Benjamin, W. H.Jr (1997). Avirulence of LT2 strains of Salmonella typhimurium results from a defective rpoS gene. Infect Immun 65, 2451-2453 .[Abstract]

Takahashi, H. , Chen, Z. , Du, H. , Liu, Y. & Klessig, D. F. (1997). Development of necrosis and activation of disease resistance in transgenic tobacco plants with severely reduced catalase levels. Plant J 11, 993-1005.[Medline]

Thomson, N. R. , Cox, A. , Bycroft, B. W. , Stewart, G. S. A. B. , Williams, P. & Salmond, G. P. C. (1997). The Rap and Hor proteins of Erwinia, Serratia and Yersinia: a novel subgroup in a growing superfamily of proteins regulating diverse physiological processes in bacterial pathogens. Mol Microbiol 26, 531-544.[Medline]

Thomson, N. R. , Nasser, W. , McGowan, S. , Sebaihia, M. & Salmond, G. P. C. (1999). Erwinia carotovora has two KdgR-like proteins belonging to the IclR family of transcriptional regulators: identification and characterization of the RexZ activator and the KdgR repressor of pathogenesis. Microbiology 145, 1531-1545 .[Abstract/Free Full Text]

Vidal, S. , Eriksson, A. R. B. , Montesano, M. , Denecke, J. & Palva, E. T. (1998). Cell wall-degrading enzymes from Erwinia carotovora cooperate in the salicylic acid-independent induction of a plant defense response. Mol Plant–Microbe Interact 11, 23-32.

Wilmes-Riesenberg, M. R. , Foster, J. W. & Curtiss, R.III (1997). An altered rpoS allele contributes to the avirulence of Salmonella typhimurium LT2. Infect Immun 65, 203-210.[Abstract]

Wilson, G. G. , Young, K. K. Y. , Edlin, G. J. & Konigsberg, W. (1979). High-frequency generalised transduction by bacteriophage T4. Nature 280, 80-82.[Medline]

Zambrano, M. M. , Siegele, D. A. , Almiron, M. , Tormo, A. & Kolter, R. (1993). Microbial competition: Escherichia coli mutants that take over stationary phase cultures. Science 259, 1757-1760 .[Abstract/Free Full Text]

Received 7 June 1999; revised 3 September 1999; accepted 10 September 1999.


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
J. Wang, N. Gardiol, T. Burr, G. P. C. Salmond, and M. Welch
RelA-Dependent (p)ppGpp Production Controls Exoenzyme Synthesis in Erwinia carotovora subsp. atroseptica
J. Bacteriol., November 1, 2007; 189(21): 7643 - 7652.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
G. Devescovi, J. Bigirimana, G. Degrassi, L. Cabrio, J. J. LiPuma, J. Kim, I. Hwang, and V. Venturi
Involvement of a Quorum-Sensing-Regulated Lipase Secreted by a Clinical Isolate of Burkholderia glumae in Severe Disease Symptoms in Rice
Appl. Envir. Microbiol., August 1, 2007; 73(15): 4950 - 4958.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
A. M.L Barnard, S. D Bowden, T. Burr, S. J Coulthurst, R. E Monson, and G. P.C Salmond
Quorum sensing, virulence and secondary metabolite production in plant soft-rotting bacteria
Phil Trans R Soc B, July 29, 2007; 362(1483): 1165 - 1183.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. D. Barak, L. Gorski, P. Naraghi-Arani, and A. O. Charkowski
Salmonella enterica Virulence Genes Are Required for Bacterial Attachment to Plant Tissue
Appl. Envir. Microbiol., October 1, 2005; 71(10): 5685 - 5691.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andersson, R. A.
Right arrow Articles by Pirhonen, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andersson, R. A.
Right arrow Articles by Pirhonen, M.
Agricola
Right arrow Articles by Andersson, R. A.
Right arrow Articles by Pirhonen, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 1999 Society for General Microbiology.