|
|
||||||||
Genetics and Molecular Biology |
Service de Dermatologie (DHURDV), Laboratoire de Mycologie, BT422, Centre Hospitalier Universitaire Vaudois, 1011 Lausanne, Switzerland1
Department of Medical Microbiology, Institute of Hygiene, University of Göttingen, Germany2
Department of Medical and Organic Chemistry, School of Pharmacy, University of Wisconsin, Madison, USA3
Author for correspondence: M. Monod. Tel: +41 21 314 0376. Fax: +41 21 314 0378. e-mail: Michel.Monod{at}chuv.hospvd.ch
| ABSTRACT |
|---|
|
|
|---|
Keywords: SAP1 gene, protein secretion, signal peptides, recombinant proteins, Pichia pastoris
Abbreviations: Sap, secreted aspartic proteinase; H6-Sap1p, His6-tagged Sap1p
| INTRODUCTION |
|---|
|
|
|---|
The propeptide of many secreted proteinases has been found to be essential and specific for assisting correct folding as well as secretion of the mature domain of the enzyme (for a review, see Eder & Fersht, 1995
). Upon completion of folding, the propeptide is cleaved and removed to generate the active enzyme through an autoproteolytic reaction or, as in the Candida Saps, through an exogenous proteolytic reaction in the Golgi apparatus via the membrane-bound proteinase Kex2p (Togni et al., 1996
; Newport & Agabian, 1997
), which specifically cleaves peptides after KR sequences (Julius et al., 1984
). Two different conformations of the mature part of a protein can be obtained with two different prosequences (Shinde et al., 1997
). Indeed, the mature part of subtilisin E was shown to be folded in an altered conformation through a mutated prosequence, resulting in differences of secondary structure, thermostability and substrate specificity.
It has been clearly established by many examples in vitro and/or in vivo that the propeptide can also mediate the folding of the proteinase when added as a separate polypeptide chain (Ohta et al., 1991
; Fabre et al., 1992
; Fukuda et al., 1994
; McIver et al., 1995
; van den Hazel et al., 1994
). In vitro, the propeptide covalently attached to the mature domain of prosubtilisin E has been found to function intermolecularly as folding catalyst, although a parallel intramolecular pathway has not been ruled out (Zhu et al., 1989
; Hu et al., 1996
). However, whether the maturation of secreted proteinases occurs through inter- or intramolecular events has never been investigated in vivo. This question instigated our detailed analysis of the function of the Sap propeptide in the secretion of the mature enzyme. Our study on C. albicans Sap1p was carried out using the methylotrophic yeast Pichia pastoris expression system, which allows the production of substantial amounts of recombinant fungal proteinase (Borg-von Zepelin et al., 1998
). We show here that recombinant Sap1p maturation is guided by the propeptide in a combination of intra- and intermolecular processes, and that only a 12 aa sequence in the propeptide is necessary and sufficient to completely ensure the secretion of active enzyme.
| METHODS |
|---|
|
|
|---|
was used for transformation and propagation of the recombinant plasmids. The E. coliP. pastoris shuttle vector pPICZ
A was provided with the P. pastoris expression system from Invitrogen. The low-copy-number plasmid pKJ113 has been previously described (Borg-von Zepelin et al., 1998
Construction of the expression plasmids.
Expression plasmids were constructed by cloning a SAP PCR product in the multiple cloning site of pKJ113 and pPICZ
A. Custom-made primers were provided by Microsynth (Balgach, Switzerland). PCR buffers and AmpliTaq polymerase were from Perkin Elmer Applied Biosystems. The buffer composition was 10 mM Tris/HCI (pH 8·3), 50 mM KCl with 1·5 mM MgCl2, containing 0·2 mM each dNTP and 2·5 U polymerase per reaction. The PCR was carried out in a GeneAmp PCR system 2400 (Perkin Elmer Applied Biosystems) with a first denaturation step of 5 min at 94 °C followed by 25 cycles of annealing at 55 °C for 30 s, elongation at 72 °C for 30 s and denaturation at 94 °C for 30 s. PCR was completed by a final elongation step at 72 °C for 10 min. DNA from plasmids containing individual SAP genes was used as template. The PCR products were purified using a PCR purification kit (Roche Diagnostics) and were digested by restriction enzymes for which a site (XhoI, BamHI or NotI) was previously designed at the 5' extremity of the primers. The digested PCR products were then cloned into the appropriate sites of the multiple cloning site of the E. coliP. pastoris shuttle vector.
The following pairs of sense and antisense primers were used to construct plasmids pSB10, pSB11, pSB42 and pSB249 (Tables 1
and 2
), respectively, restriction sites underlined: GATGCTCGAGCAGCTAAAAGATCCCCAGGT and CAAAGGATCCTAGGTAAGAGCAGCAATGTT; GACGCTCGAGAAGCCATCCCAGTTACTTTAAAT and CAAAGGATCCTAGGTAAGAGCAGCAATGTT; TTCCTCGAGAAAAGATCTCCAGCTAAAAGATCC and GTAGCGGCCGCTCTATCTTTTAACTTTACCTTCTTG; GCACTCGAGAAAAGATCTCCAGCTAAAAGATCCCCAGG and GCAGGATCCCTAGTGATGGTGATGGTGATGGGTAAGAGCAGCAATGTT. Plasmidic SAP1 DNA (Hube et al., 1991
; Monod et al., 1994
) was used as template. pKJ113 was used to generate pSB10 and pSB11, and pPICZ
A was used to generate pSB42 and pSB249.
|
|
|
P. pastoris transformation.
P. pastoris was transformed by electroporation with 510 µg linearized plasmid DNA digested by SmaI using pKJ113 constructs, and SacI or BstXI using pPICZ
A constructs. The His- Mut+ P. pastoris strain GS115 was transformed with pKJ113 constructs, and transformants were selected on histidine-deficient medium [1 M sorbitol, 1% (w/v) glucose, 1·34% (w/v) yeast nitrogen base (YNB) without amino acids, 4 x10-5% (w/v) biotin, amino acids (0·005%, w/v, each of L-glutamic acid, L-methionine, L-lysine, L-leucine and L-isoleucine), 2% (w/v) agarose]. Subsequently, the tranformants were screened for insertion of the construct at the AOX1 site on minimal methanol plates [1·34% (w/v) YNB without amino acids, 4x10-5% (w/v) biotin, 0·5% (v/v) methanol, 2% (w/v) agarose]. Transformants unable to grow on media containing only methanol as a carbon source were retained for further investigations. They were assumed to contain the construct at the correct yeast genomic location by integration events in the AOX1 locus displacing the AOX1 coding region. The prototrophic P. pastoris strains were transformed with pPICZ
A constructs and transformants were selected on YPDS medium containing 100 µg zeocin ml-1 (Invitrogen).
Production of Sap1p in P. pastoris.
All selected transformants were grown to near saturation (OD600 10) at 30 °C in 10 ml glycerol-based yeast medium [0·1 M potassium phosphate buffer pH 6·0, containing 1% (w/v) yeast extract, 2% (w/v) peptone, 1·34% (w/v) YNB without amino acids, 1% (v/v) glycerol and 4 x10-5% (w/v) biotin]. Cells were harvested by centrifugation and resuspended in 2 ml of the same medium with 0·5% (v/v) methanol instead of glycerol and incubated for 2 d. Thereafter, the supernatants and the cell pellets were separated by centrifugation and retained for protein analysis.
Protein extract analysis.
The proteins in 5 or 10 µl of P. pastoris culture supernatant were loaded without further treatment onto SDS-PAGE gels (Laemmli, 1970
). Cell protein extracts of 0·1 ml culture were prepared following the method of Yaffe & Schatz (1984
). The pelleted cells were resuspended in 200 µl 1·8 M NaOH, 1·2 M ß-mercaptoethanol, and incubated for 5 min on ice. After addition of 200 µl 10% TCA, the mixture was incubated for 5 min, centrifuged, and the pellet was resuspended in 50 µl 2xSDS-PAGE loading buffer and neutralized at pH 7·0 by adding 510 µl 1 M Tris base. The samples were heated to 95 °C for 3 min before loading onto SDS-PAGE gels (12% acrylamide).
Untagged Sap1p was separated from His6-tagged Sap1p (H6-Sap1p) by filtration of the P. pastoris culture supernatant through a nickel chelating resin column (ProBond, Invitrogen) equilibrated with 10 mM phosphate buffer, pH 7·0. After washing the column with the same buffer, adsorbed H6-Sap1p was eluted with 300 mM imidazole buffer, pH 6·0. All fractions with detectable enzymic activity were retained and pooled. Sap1p was purified from filtered P. pastoris culture supernatant as previously described (Borg-von Zepelin et al., 1998
). Protein concentrations were measured by the method of Bradford (1976
).
SDS-PAGE gels were stained with Coomassie brilliant blue R-250 (Bio-Rad). Immunodevelopment of Western blots was performed using an antiserum (
-Sap2) raised in rabbits and cross-reacting with Sap1p (Borg-von Zepelin et al., 1998
), and alkaline-phosphatase-conjugated goat anti-rabbit IgG (Bio-Rad), or using an anti-polyhistidine peroxidase conjugate monoclonal antibody (Sigma).
Proteolytic assays.
The proteolytic activity of Sap isoenzymes was measured with 0·02% (w/v) resorufin-labelled casein as a substrate (Roche Diagnostics) in sodium citrate buffer (50 mM; pH 4·5) in a total volume of 0·25 ml. After incubation at 37 °C for 60 min, the undigested substrate was precipitated by TCA acid (5% final concentration) and separated from the supernatant by centrifugation. The absorbance of the supernatant was measured in the alkaline range at 574 nm after adding 250 µl 1 M Tris/HCl at pH 10. For practical purposes, one unit of Sap1p activity was defined as that producing an absorbance of 0·001 per min.
| RESULTS |
|---|
|
|
|---|
|
A downstream from the
-factor signal peptide sequence generating the plasmid pSB42 (Table 2
Five transformants were retained for restriction fragment analysis. Genomic DNA of the yeasts was digested with SacI, DraI and HindIII, electrophoresed and probed with the larger BamHIBglII fragment of plasmid pPICZ
A containing the Streptoalloteichus hindustanus BLE gene for resistance to zeocin (Gatignol et al., 1988
; Drocourt et al., 1990
) (Fig. 2
). The band pattern of transformants secreting Sap1p, which showed a hybridizing fragment of identical size (3·8 kb) for each of the restriction digests, was consistent with the correct integration of pPICZ
A contructs at the locus of the AOX1 promoter of the SB11 strain (data not shown). In our genetic construction, DNA encoding Sap1p propeptide and DNA encoding Sap1p without its propeptide are in tandem under the control of pAOX1 (Fig. 2
).
|
|
Maturation of Sap1p molecules in an intermolecular process
Following the results of the propeptide deletion analysis, a mutation was introduced in plasmid pSB10 to replace the phenylalanine (F) residue 27 of the SAP1 translation product, which is conserved in different Sap propeptides (Table 2
), by an aspartic acid (D) residue. The newly generated plasmid was called pSB269 (Table 1
). Direct expression of the mutated SAP1 gene in P. pastoris GS115 did not result in the secretion of Sap1p into the culture supernatant. However, a Sap1p product with an electrophoretic mobility higher than that of the mature form of Sap1p was detected in all transformants, from among which strain SB269 was selected (Table 1
, Fig. 1
).
The question whether the maturation of Sap1p occurs in vivo through inter- or intramolecular events was investigated by attempting to rescue the secretion of the enzyme produced in SB11 without propeptide, or in SB269 with a mutated non-functional propeptide, by a co-production of Sap1p with non-mutated propeptide. For such an experiment, a DNA fragment encoding Sap1p with a non-mutated prosequence and with a C-terminal His6-tag was cloned into pPICZ
A. P. pastoris KM71 transformed with the newly generated plasmid pSB249 produced His6-tagged Sap1p (H6-Sap1p; Fig. 5
, lane 1) with a yield comparable to that of Sap1p produced by strain SB10 (Table 1
). The specific activity of purified H6-Sap1p was equal to that of Sap1p (9·5 U µg-1). When SB10 was transformed by pSB249, both Sap1p and H6-Sap1p were found, in a ratio close to 1:1 (90:100), in culture supernatant of all transformants (Fig. 5
, lane 10). The total secreted proteolytic activity of SB10 transformants was twice that of the SB10 strain. Untagged Sap1p could be separated from H6-Sap1p by filtration of the P. pastoris culture supernatant through a nickel chelating resin column (Fig. 5
, lanes 11 and 12). No H6-Sap1p was detected in the culture supernatant after filtration through the column (Fig. 5
, lane 12). Adsorbed H6-Sap1p could be subsequently released with imidazole for quantification.
|
|
| DISCUSSION |
|---|
|
|
|---|
The fate of eukaryotic proproteinases mutated in their prosequence was previously investigated with the Yarrowia lipolytica alkaline proteinase and the Rhizopus niveus aspartic proteinase I (Fabre et al., 1991
; Fukuda et al., 1996
). All deletions affecting the proregion of the Y. lipolitica alkaline proteinase precursor resulted in the intracellular accumulation of unprocessed protein. The rates of synthesis of one mutated and one pro-deleted precursor of the R. niveus aspartic proteinase I were comparable in Saccharomyces cerevisiae, but both precursors were degraded in the endoplasmic reticulum. As a general rule, misfolded or unfolded proteins are selectively retained in the endoplasmic reticulum (Helenius et al., 1992
), where a more or less rapid degradation occurs depending on the protein. The amount of Sap1p product detected intracellularly when Sap1p was produced with a mutated propeptide or without a propeptide was reduced, which suggests protein degradation (Fig. 1
). It is likely that the non-functional folding of Sap1p results in the degradation of its mature domain, which consequently causes the lack of secretion of the Sap1p molecules. When SAP1 was expressed without its propeptide sequence an accumulation of Sap1p product with the same electrophoretic mobility as secreted Sap1p was observed in the cell. In contrast, an accumulation of a Sap1p product with an electophoretic mobility higher than Sap1p was observed when SAP1 was expressed with a sequence encoding a mutated propeptide (Fig. 1
). A similar His6-tagged product was detected in cell extracts of pSB249 transformants of SB11 and SB269 in parallel with the rescue of Sap1p secretion (Fig. 6
, lanes 2 and 3). It appears that Sap1p produced without a propeptide and Sap1p produced with a mutated propeptide are not degraded in the same way.
The proteolytic activity of the SB11 and SB269 transformants secreting two Sap1ps produced with and without a functional propeptide under the control of two identical promoters was similar to that of KM71 transformed with pSB249 (Fig. 5
). The lack of increased proteolytic activity in these transformants producing two different proteins can only be explained by a single-turnover catalytic property of the propeptide, meaning that each propeptide only participates in a single protein-folding reaction (Ohta et al., 1991
; Baker et al., 1992
).
If folding of the Sap1p molecules were obligatorily assisted by their propeptide in cis (first-order reaction, Fig. 7a
), only H6-Sap1p would have been secreted by the SB11 and SB269 transformants. Therefore, as our experiments demonstrate, there must be an intermolecular pathway to mature Sap1p without a priori exclusion of a possible intramolecular one. It was previously shown that prosubtilisin exists as dimers under non-denaturing conditions in vitro (Hu et al., 1996
). A model of enzyme maturation was postulated where the prosequence of one prosubtilisin molecule is the template for the refolding of the mature sequence of the second one (second-order reaction). A strict intermolecular mechanism would predict a ratio of H6-Sap1p to Sap1p of 1:1 in the culture supernatant of SB11 and SB269 transformants assuming that Sap1p and H6-Sap1p are synthesized in a ratio of 1:1 (Fig. 7b
). In fact, the ratio of H6-Sap1p to Sap1p was experimentally determined to be close to 2:1. This result leads to the conclusion that maturation of Sap1p occurs in P. pastoris through both intra- and intermolecular pathways (Fig. 7
). The observation of an intracellular accumulation of a H6-Sap1p product in the SB11 and SB269 transformants (Fig. 6
) is consistent with the prediction that H6-Sap1p molecules do not mature without a propeptide or with a non-functional propeptide in heterodimers (Fig. 7
).
|
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Borg-von Zepelin, M., Beggah, S., Boggian, K., Sanglard, D. & Monod, M. (1998). The expression of the secreted aspartyl proteinases Sap4 to Sap6 from Candida albicans in murine macrophages. Mol Microbiol 28, 543-554.[Medline]
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254.[Medline]
Drocourt, D., Calmels, T. P. G., Reynes, J. P., Baron, M. & Tiraby, G. (1990). Casettes of the Streptoalloteichus hindustanus ble gene for transformation of lower and higher eucaryotes to phleomycine resistance. Nucleic Acids Res 18, 4009.
Eder, J. & Fersht, A. R. (1995). Pro-sequence-assisted protein folding. Mol Microbiol 16, 609-614.[Medline]
Fabre, E., Nicaud, J. M., Lopez, M. C. & Gaillardin, C. (1991). Role of the proregion in the production and secretion of the Yarrowia lipolytica alkaline extracellular protease. J Biol Chem 266, 3782-3790.
Fabre, E., Tharaud, C. & Gaillardin, C. (1992). Intracellular transit of a yeast protease is rescued by trans-complementation with its prodomain. J Biol Chem 267, 15049-15055.
Fallon, K., Bausch, K., Noonan, J., Huguenel, E. & Tamburini, P. (1997). Role of aspartic proteases in disseminated Candida albicans infection in mice. Infect Immun 65, 551-556.[Abstract]
Fukuda, R., Horiuchi, H., Ohta, A. & Takagi, M. (1994). The prosequence of Rhizopus niveus aspartic proteinase-I supports correct folding and secretion of its mature part in Saccharomyces cerevisiae. J Biol Chem 269, 9556-9561.
Fukuda, R., Umebayashi, K., Horiuchi, H., Ohta, A. & Takagi, M. (1996). Degradation of Rhizopus niveus aspartic proteinase-I with mutated prosequences occurs in the endoplasmic reticulum of Saccharomyces cerevisiae. J Biol Chem 271, 14252-14255.
Gatignol, A., Durand, H. & Tiraby, G. (1988). Bleomycin resistance conferred by a drug-binding protein. FEBS Lett 230, 171-175.[Medline]
van den Hazel, H., Kielland-Brandt, M. C. & Winther, J. R. (1994). The propeptide is required for in vivo formation of stable active yeast proteinase A and can function even when not covalently linked to the mature region. J Biol Chem 268, 18002-18007.
Helenius, A., Marquart, T. & Braakman, I. (1992). The endoplasmic reticulum as a protein-folding compartment. Trends Cell Biol 2, 227-231.[Medline]
Hu, X., Haghjoo, K. & Jordan, F. (1996). Further evidence for the structure of the subtilisin propeptide and for its interactions with mature subtilisin. J Biol Chem 271, 3375-3384.
Hube, B., Turver, C. J., Odds, F. C., Eiffert, H., Boulnois, G. J., Kochel, H. & Rüchel, R. (1991). Sequence of the Candida albicans gene encoding the secretory aspartate proteinase. J Med Vet Mycol 29, 129-132.[Medline]
Inouye, M. (1991). Intramolecular chaperone: the role of the pro-peptide in protein folding. Enzyme 45, 314-321.[Medline]
Julius, D., Brake, A., Blair, L., Kunisawa, R. & Thorner, J. (1984). Isolation of the putative structural gene for the lysine-arginine-cleaving endopeptidase required for processing of yeast prepro-
-factor. Cell 37, 1075-1089.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Lerner, C. G., Kobayashi, T. & Inouye, M. (1990). Isolation of subtilisin prosequence mutations that affect formation of active protease by localized random polymerase chain reaction mutagenesis. J Biol Chem 265, 2085-2086.
McIver, K. S., Kessler, E., Olson, J. C. & Ohman, D. E. (1995). The elastase propeptide functions as an intramolecular chaperone required for elastase activity and secretion in Pseudomonas aeruginosa. Mol Microbiol 18, 877-889.[Medline]
Monod, M., Togni, G., Hube, B. & Sanglard, D. (1994). Multiplicity of genes encoding secreted aspartic proteases in Candida species. Mol Microbiol 13, 357-368.[Medline]
Monod, M., Hube, B., Hess, D. & Sanglard, D. (1998). Differential regulation of SAP8 and SAP9, which encode two new members of the secreted aspartic proteinase family in Candida albicans. Microbiology 144, 2731-2737.[Abstract]
Newport, G. & Agabian, N. (1997). KEX2 influences Candida albicans proteinase secretion and hyphal formation. J Biol Chem 272, 28954-28961.
Ohta, Y., Hojo, H., Aimoto, S., Kobayashi, T., Zhu, X., Jordan, F. & Inouye, M. (1991). Pro-peptide as an intermolecular chaperone: renaturation of denaturated subtilisin E with a synthetic pro-peptide. Mol Microbiol 5, 1507-1510.[Medline]
Pfeffer, S. R. & Rothman, J. E. (1987). Biosynthetic protein transport and sorting by the endoplasmic reticulum and Golgi. Annu Rev Biochem 56, 829-852.
Schaller, M., Schäfer, W., Korting, H. C. & Hube, B. (1998). Differential expression of secreted aspartyl proteinases in a model of human oral candidosis and in patient samples from the oral cavity. Mol Microbiol 29, 605-615.[Medline]
Schaller, M., Korting, H. C., Schäfer, W., Bastert, J., WenChieh, C. & Hube, B. (1999). Secreted aspartic proteinase (Sap) activity contributes to tissue damage in a model of human oral candidosis. Mol Microbiol 34, 169-180.[Medline]
Shinde, U. P., Liu, J. J. & Inouye, M. (1997). Protein memory through altered folding mediated by intramolecular chaperones. Nature 389, 520-522.[Medline]
Togni, G., Sanglard, D., Falchetto, R. & Monod, M. (1991). Isolation and nucleotide sequence of the extracellular acid protease gene (ACP) from the yeast Candida tropicalis. FEBS Lett 286, 181-185.[Medline]
Togni, G., Sanglard, D., Quadroni, M., Foundling, S. I. & Monod, M. (1996). Acid proteinase secreted by Candida tropicalis: functional analysis of preproregion cleavages in C. tropicalis and Saccharomyces cerevisiae. Microbiology 142, 493-503.[Abstract]
de Viragh, P. A., Sanglard, D., Togni, G., Falchetto, R. & Monod, M. (1993). Cloning and sequencing of two Candida parapsilosis genes encoding acid proteases. J Gen Microbiol 139, 335-342.[Medline]
Yaffe, M. P. & Schatz, G. (1984). Two nuclear mutations that block mitochondrial protein import in yeast. Proc Natl Acad Sci USA 81, 4819-4823.
Zhu, X., Ohta, Y., Jordan, F. & Inouye, M. (1989). Pro-sequence of subtilisin can guide the refolding of denaturated subtilisin in an intermolecular process. Nature 339, 483-484.[Medline]
Received 13 April 2000;
revised 24 July 2000;
accepted 9 August 2000.
This article has been cited by other articles:
![]() |
U. Reichard, B. Lechenne, A. R. Asif, F. Streit, E. Grouzmann, O. Jousson, and M. Monod Sedolisins, a New Class of Secreted Proteases from Aspergillus fumigatus with Endoprotease or Tripeptidyl-Peptidase Activity at Acidic pHs. Appl. Envir. Microbiol., March 1, 2006; 72(3): 1739 - 1748. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Monod, B. Lechenne, O. Jousson, D. Grand, C. Zaugg, R. Stocklin, and E. Grouzmann Aminopeptidases and dipeptidyl-peptidases secreted by the dermatophyte Trichophyton rubrum Microbiology, January 1, 2005; 151(1): 145 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Naglik, S. J. Challacombe, and B. Hube Candida albicans Secreted Aspartyl Proteinases in Virulence and Pathogenesis Microbiol. Mol. Biol. Rev., September 1, 2003; 67(3): 400 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hube and J. Naglik Candida albicans proteinases: resolving the mystery of a gene family Microbiology, August 1, 2001; 147(8): 1997 - 2005. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |