Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 146 (2000), 509-516
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saunders, N. F. W.
Right arrow Articles by Baker, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saunders, N. F. W.
Right arrow Articles by Baker, S. C.
Agricola
Right arrow Articles by Saunders, N. F. W.
Right arrow Articles by Baker, S. C.
Microbiology (2000), 146, 509-516.
© 2000 Society for General Microbiology


Genetics and Molecular Biology

Transcriptional analysis of the nirS gene, encoding cytochrome cd1 nitrite reductase, of Paracoccus pantotrophus LMD 92.63

Neil F. W. Saundersa,1, Stuart J. Ferguson1,2 and Simon C. Bakerb,1

Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, UK1
Oxford Centre for Molecular Sciences, University of Oxford, South Parks Road, Oxford OX1 3QT, UK2

Author for correspondence: Stuart J. Ferguson (Dept of Biochemistry). Tel: +44 1865 275240. Fax: +44 1865 275259. e-mail: ferguson{at}bioch.ox.ac.uk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The gene for cytochrome cd1 nitrite reductase of Paracoccus pantotrophus, a protein of known crystal structure, is nirS. This gene is shown to be flanked by genes previously recognized in other organisms to encode proteins involved in the control of its transcription (nirI) and the biosynthesis of the d1 cofactor (nirE). Northern blot analysis has established under anaerobic conditions that a monocistronic transcript is produced from nirS, in contrast to observations with other denitrifying bacteria in which arrangement of flanking genes is different and the messages produced are polycistronic. The lack of a transcript under aerobic conditions argues against a role for cytochrome cd1 in the previously proposed aerobic denitrification pathway in Pa. pantotrophus. A putative rho-independent transcription termination sequence immediately following nirS, and preceding nirE, can be identified. The independent transcription of nirS and nirE indicates that it should be possible to produce site-directed mutants of nirS borne on a plasmid in a nirS deletion mutant. The transcript start point for nirS has been determined by two complementary techniques, 5'-RACE (Rapid amplification of cDNA 5' ends) and primer extension. It is 29 bp upstream of the AUG of nirS. An anaerobox, which presumably binds Nnr, is centred a further 41·5 bp upstream of the transcript start. No standard {sigma}70 DNA sequence motifs can be identified, but a conserved sequence (T-T-G/C-C-G/C-G/C) can be found in approximately the same position (-16) upstream of the transcript starts of nirS and nirI, whose products are both involved in the conversion of nitrite to nitric oxide.

Keywords: Paracoccus pantotrophus, nitrite reductase, transcription, denitrification, promoter

Abbreviations: Fnr, fumarate nitrate reduction transcriptional activator; Nnr, nitrate nitrite reduction transcriptional activator; 5'-RACE, rapid amplification of cDNA 5' ends; TSS, transcript start site

The GenBank accession number for the sequence in this paper is U75413.

a Present address: Department of Microbial Physiology, Faculty of Biology, BioCentrum Amsterdam, Vrije Universiteit, De Boelelaan 1087, NL-1081 HV Amsterdam, the Netherlands.

b Present address: Oxford Centre for Environmental Biotechnology, NERC Institute of Virology and Environmental Microbiology, Mansfield Road, Oxford OX1 3SR, and Department of Engineering Science, Parks Road, Oxford OX1 3PJ, UK.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
True denitrifiers convert nitrate to gaseous nitrogen via nitrite, nitrous oxide and nitric oxide, though many other species of bacteria, including archaea, can perform parts of the process (Zumft, 1997Down ; Ferguson, 1994Down ). The efficient production of nitric oxide (NO) by the nitrite reductase is important to cellular survival since build up of nitrite is toxic to the cell. It is also the first committed step of denitrification because although nitrite can be assimilated, NO cannot. The NO species is also cytotoxic, and must be immediately reduced further to the non-toxic nitrous oxide (N2O). Thus the co-ordinated regulation of nitrite and nitric oxide reductases forms the core of the denitrification process (Zumft, 1997Down ; Baker et al., 1998Down ; Ferguson, 1994Down ). The conversion of nitrite to nitric oxide is carried out by one of two types of enzyme: a copper-containing nitrite reductase or a di-haem nitrite reductase which contains a c haem and a d1 haem. The latter haem has only been found in denitrifiers containing this type of nitrite reductase. Di-haem cd1 nitrite reductases have been characterized in Paracoccus pantotrophus LMD 92.63 (Moir et al., 1993Down ; Baker et al., 1997Down ) as well as in other denitrifiers including Pseudomonas aeruginosa (Silvestrini et al., 1989Down ), Pseudomonas stutzeri Zobell (Jüngst et al., 1991Down ), Ps. stutzeri JM300 (Smith & Tiedje, 1992Down ), Paracoccus denitrificans IFO 12442 (Ohshima et al., 1993Down ), Pa. denitrificans PD1222 (de Boer et al., 1994Down ) and Ralstonia eutropha H16 (Rees et al., 1997Down ). The structural gene for nitrite reductase (nirS) has been fully or partially sequenced in all these organisms.

The transcription of nirS has been shown to be activated by Fnr-like proteins. These are Nnr in the case of Pa. denitrificans (van Spanning et al., 1997Down ), Anr in Ps. aeruginosa (Arai et al., 1997Down ; Hasegawa et al., 1998Down ) and the set of regulatory proteins named DnrE, DnrS and DnrD in Ps. stutzeri (Vollack et al., 1999Down ). All these proteins bear a high similarity to the transcriptional activator Fnr of Escherichia coli, but lack the N-terminal cysteines which allow the formation of an oxygen-labile iron–sulphur cluster in Fnr (Khoroshilova et al., 1995Down ). The functions associated with oxygen sensing Fnr in E. coli are performed by another protein in Pa. denitrificans, FnrP, which is distinct from Nnr, and likewise Ps. stutzeri possesses FnrA. It is tempting to assume that the regulation of denitrification in Ps. aeruginosa and Ps. stutzeri is very similar to that in Pa. denitrificans and Pa. pantotrophus. However, not only is the gene organization within the nir loci different (Zumft, 1997Down ; Baker et al., 1998Down ), but the environmental signals which trigger denitrification are different as well. It would appear that in Ps. stutzeri nitrate and the absence of oxygen are sensed, directly or indirectly, by DnrE, DnrS and DnrD (Vollack et al., 1999Down ) and these proteins then activate the nir and nor operons. In Pa. denitrificans and Ps. aeruginosa, the transcription of the Nnr or Dnr proteins is dependent on nitric oxide (van Spanning et al., 1999Down ; Arai et al., 1999Down ), and nirS in these organisms is thus subject to product regulation rather than the more normal substrate regulation.

In Pa. denitrificans, nitric oxide and Nnr also serve to activate promoters upstream of the nor (nitric oxide reductase) operon and nirI (van Spanning et al., 1999Down ), a gene encoding a putative DNA-binding protein of unknown function. The site at which Nnr binds is presumably the inverted repeat, reminiscent of an Fnr box, found upstream of nirS, nirI and norC. These regulatory sequences differ by only a few base pairs from the consensus E. coli motif for Fnr binding, and are also very similar to the anaeroboxes found upstream of Pa. denitrificans FnrP regulated genes. Selection between FnrP and Nnr may not solely be on the basis of the sequence of the DNA-binding site and secondary factors are presumably involved. It has yet to be shown whether Pa. pantotrophus has multiple Nnr-like proteins (as in Ps. stutzeri), but knockouts of Nnr suggest it is the major contributor to the activation of nirS transcription in Pa. denitrificans (van Spanning et al., 1997Down ).

The transcription of nirS in Pa. pantotrophus [note that this organism was formerly designated Thiosphaera pantotropha (Rainey et al., 1999Down )] requires study for two important reasons. First, Pa. pantotrophus has been described as an aerobic denitrifier (Arts et al., 1995Down ; Robertson et al., 1995Down ) yet Moir et al. (1995)Down failed to detect cytochrome cd1 in aerobically grown cells. Second, this organism has served as the source of protein for the first crystal structure of cd1 nitrite reductase (Fülöp et al., 1995Down ; Baker et al., 1997Down ). An understanding of how the structural gene is transcribed with the genes responsible for the manufacture of the d1 haem prosthetic group is essential if gene knockout strains are to be constructed, in which mutant nirS genes can be efficiently manufactured by the cell in a holo form. Results obtained with Pa. pantotrophus can be extrapolated to Pa. denitrificans as the two organisms are closely related to one another (Rainey et al., 1999Down ) although are distinct species. To begin to understand the activation of transcription of nirS we have sequenced part of the nir locus from Pa. pantotrophus LMD 92.63, determined the transcription start site of the gene and estimated the length of transcripts from the nirS promoter.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Materials.
Restriction endonucleases and T4 ligase were supplied by New England Biolabs. Sequenase was supplied by Amersham International. AMV reverse transcriptase was obtained from a variety of sources including Promega. Oligonucleotides were synthesized by V. Cooper of the Dyson Perrins Chemistry Laboratory, University of Oxford.

Bacterial strains, media and vectors.
RNA and DNA were isolated from Paracoccus pantotrophus LMD 92.63. Escherichia coli JM83 or DH5{alpha} was used for routine cloning. Pa. pantotrophus was grown on either the minimal medium described by Robertson & Kuenen (1983)Down or Luria–Bertani (LB) medium. LB was also used for the growth of E. coli. Plasmid pTNIR3 was kindly supplied by T. de Boer, BioCentrum Amsterdam, Vrije Universiteit, the Netherlands (T. de Boer, R. J. M. van Spanning & A. H. Stouthamer, unpublished results).

Extraction of total RNA from Pa. pantotrophus.
Total RNA was isolated from cells of Pa. pantotrophus LMD 92.63 using a method based on that of Cuypers & Zumft (1993)Down . Cultures (50 ml) were grown to mid-exponential phase, harvested by centrifugation and lysed in 4 ml lysis buffer (1% SDS, 1 mM EDTA). The lysate was extracted with 4 ml phenol/chloroform, saturated with 2 M sodium acetate (pH 4·0) and centrifuged at 10000 g for 10 min at 4 °C. The aqueous phase was then re-extracted with 4 ml chloroform and recovered by centrifugation. Propan-2-ol (0·8 vol.) was added and the mixture was incubated on ice for 30 min, then centrifuged at 15000 g for 15 min at 4 °C. The precipitated nucleic acids were redissolved in 200 µl 1xconcentration DNase buffer (40 mM Tris/HCl, pH 8·0; 10 mM NaCl; 6 mM CaCl2) containing 100 units RNase-free DNase and incubated at 37 °C for 30 min. After DNase treatment, the mixture was extracted once more with an equal volume of phenol/chloroform and the RNA was ethanol-precipitated by incubating at -70 °C, followed by centrifugation at 15000 g for 15 min, 4 °C. The pellet was washed with 100 µl ice-cold 70% (v/v) ethanol, air-dried and redissolved in 100 µl RNase-free water. RNA quality was analysed by the absorbance ratio A260:A280 and by formaldehyde-agarose gel electrophoresis.

Northern blotting.
Northern blotting was used to detect specific mRNA transcripts from denitrification genes in Pa. pantotrophus. The method used closely followed that of Engler-Blum et al. (1993)Down . The membrane was pre-hybridized for 1 h at 68 °C in a high SDS phosphate buffer (250 mM sodium phosphate, pH 7·2; 1 mM EDTA; 20%, w/v, SDS). A digoxigenin-labelled dsDNA probe was hybridized to the RNA in 10 ml of the same buffer at 68 °C overnight. The membrane was washed three times for 20 min each at 65 °C in 50 ml H-wash buffer (20 mM sodium phosphate, pH 7·2; 1%, w/v, SDS; 1 mM EDTA), then once for 5 min in W-wash buffer (100 mM maleic acid, pH 8·0; 3 M NaCl; 0·3%, v/v, Tween 20) and blocked for 1 h in blocking buffer (W-wash buffer plus 0·5%, w/v, blocking reagent; Roche). Digoxigenin antibody conjugate was diluted 1:10000 in blocking buffer and the membrane was incubated with 20 ml of this buffer for 30 min. The membrane was then washed four times for 10 min each with W-wash buffer and equilibrated for 5 min in substrate buffer (100 mM Tris/HCl, pH 9·5; 100 mM NaCl; 50 mM MgCl2). Hybridized probe was detected by chemiluminescence, using the alkaline phosphatase substrate CSPD (Roche) diluted 1:100 in 1 ml substrate buffer and pipetted onto the membrane. Following a 5 min incubation in the dark, excess solution was removed and the membrane was incubated in a sealed hybridization bag at 37 °C for 15 min. The membrane was then exposed to X-ray film (Kodak), initially for 1 h, or until exposed bands appeared on the film.

DNA probes used in this study were made from internal PCR products of nirS or nirE. The 141 bp nirS probe was amplified from genomic Pa. pantotrophus DNA using primers NIRSF (CTGGCCCTTGTCCTTGGGC) and 228R (TACGTCCTGCTGTGCAAGGT), which were subsequently labelled with dUTP-digoxigenin-alkaline phosphate conjugate (Roche). A 419 bp probe for nirE was made in the same manner using the primers 2431F (AGACGGTGACGAACGGGG) and 2849R (GGGCACATAGTCGCAGGG).

Primer extension analysis.
Primer extension was used to determine the 5' end of mRNA transcripts. The experiment is divided into three stages: oligonucleotide labelling, primer-RNA annealing and cDNA extension. Ten picomoles of oligonucleotide was end-labelled in a 20 µl reaction exactly as described in Sambrook et al. (1989)Down . The labelled oligonucleotide was redissolved in 100 µl TE buffer and could be stored at -20 °C for up to 1 week. One microlitre (approx. 105 c.p.m.) of labelled primer was annealed to 40 µg heat-denatured RNA in 20 µl annealing buffer (2 mM Tris/HCl, pH 7·9; 250 mM KCl; 0·2 mM EDTA) at 50 °C for 90 min. The annealed primer RNA was then ethanol-precipitated, redissolved in 20 µl reverse transcription mix (50 mM Tris/HCl, pH 8·3; 75 mM KCl; 3 mM MgCl2; 10 mM DTT; 1·3 mM each dNTP; 20 units RNasin inhibitor; 50 µg actinomycin D ml-1; 33 units AMV reverse transcriptase) and incubated at 37 °C for 2 h. cDNA synthesis was stopped with 25 mM EDTA. The mixture was treated with RNase at 37 °C for 20 min, extracted with phenol/chloroform, ethanol-precipitated and redissolved in 4 µl TE buffer. Six microlitres of sequencing stop solution was added and the labelled cDNA was run on a 6% acrylamide sequencing gel alongside a reference sequencing ladder generated using the same primer.

5'-RACE (Rapid amplification of cDNA 5' ends).
5'-RACE was used as an alternative method to determine the 5' end of mRNA transcripts. The procedure used closely followed that of Frohman (1993)Down . Ten micrograms of total RNA was reverse-transcribed using the nirS sequence specific primer 284R (5'-GACATCCTGCTGCGCAAGGT-3'). The mixture was then diluted with TE buffer, excess primer and nucleotides were removed by centrifugation through a Centricon-100 filter and the cDNA was recovered on a Millipore spin filter in 10 µl TE buffer. Addition of the poly-dATP tail and the two subsequent nested PCR amplifications were performed exactly as described by Frohman (1993)Down , using the forward primers QTF, Q0F and Q1F (detailed in Frohman, 1993Down ) and the sequence-specific reverse primers 242R (5'-ATAGTCGGTGCGCGTCTT-3') and 228R (5'-TCTTGTGGTCCTCCAGCG-3'). PCR products were analysed by electrophoresis on 1·2% agarose gels, cloned into the pGEM-T vector and sequenced using M13 universal primers.

Sequencing.
Sequencing was performed manually. The standard Sequenase protocol (Amersham International) was modified by the addition of DMSO to the reaction to aid the resolution of stops caused by the high G+C mol% content of the DNA.

Alignment of sequences and DNA analysis.
Sequence data were analysed using GCG9 (Genetics Computer Group, USA) and the GenBank and EMBL databases held at Oxford University Molecular Biology Data Centre, Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Characterization of the nirS locus
We have previously reported the DNA sequence and the derivation of the amino acid sequence of the coding region of nirS from Pa. pantotrophus (Baker et al., 1997Down ). Sequencing of the Pa. pantotrophus nir locus was carried out on plasmid pTNIR3 isolated from Pa. pantotrophus LMD 92.63. The arrangement of ORFs (Fig. 1Down) derived from sequencing of one or both strands was the same as that found in Pa. denitrificans PD1222 (de Boer et al., 1994Down ) but differences were noted in the restriction map (Fig. 1Down). The gene encoding the structural protein (nirS) was followed by nirE (encoding S-adenosyl-L-methionine uroporphyrinogen III methyltransferase) and preceded by nirI, which is divergently transcribed and proposed to encode a transcriptional regulator of nitrite reductase expression in Pa. denitrificans (van Spanning et al., 1997Down ). Sequencing was carried out on both strands in the regions indicated in Fig. 1Down so as to check the protein sequence deduced during the determination of the crystal structure of cytochrome cd1 nitrite reductase (Fülöp et al., 1995Down ; Baker et al., 1997Down ) and to identify regulatory sequences upstream of nirS. Overall, the sequence reported here (accession no. U75413) has 93·5% identity to the equivalent region of PD1222; further sequence information showed that nirE is followed by nirC, while norC and norB, encoding nitric oxide reductase, are considerably upstream of nirS (Fig. 1Down).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Restriction map of the nir loci of Pa. pantotrophus LMD 92.63 and Pa. denitrificans PD1222 (de Boer et al., 1994Down ), showing the region sequenced (U75413). Labels marked with an asterisk refer to database accession numbers. Experimentally determined restriction sites are: B, BamHI; E, EcoRI; H, HindIII; N, NotI; P, PstI; S, SmaI; Sp, SphI. Shaded genes indicate those completely sequenced on both strands. Parts of nirC, norC and norB for Pa. pantotrophus were also sequenced on both strands.

 
Nucleotide sequence of DNA flanking nirS
The DNA upstream of nirS contained only one stretch of sequence with a previously observed motif, an anaerobox in the same relative position to the initiation codon as was noted by de Boer et al. (1994)Down . The DNA between this anaerobox and the start of the nirS gene was devoid of any clear -10 or -35 sequences that might indicate the {sigma}70-dependency of nirS transcription, although we have previously argued that the genus Paracoccus has a constitutive promoter consensus much like that of all the other eubacteria (Baker et al., 1998Down ).

The nirS stop codon is not immediately followed by the initiation codon of the adjacent gene nirE. Instead, there is a 73 bp intergenic region, which contains an inverted repeat which would form a strong stem–loop, followed by a region rich in adenosine and thymine (Fig. 2Down). These features indicate a rho-independent terminator, but in other denitrifiers nirS is co-transcribed with the genes required for d1 biosynthesis (Härtig & Zumft, 1999Down ; Kawasaki et al., 1997Down ). To determine if nirS of Pa. pantotrophus is transcribed separately or as an operon including at least nirE, Northern blots were used to determine the size of transcript(s) arising from the nirS promoter.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Nucleotide sequences of parts of the nirS locus. Two nucleotide sequences are shown: the top sequence is from Pa. pantotrophus (accession no. U75413); the lower from Pa. denitrificans (accession no. U05002). Non-coding regions of U75413 have not been previously discussed but the nirS coding region appears in full elsewhere (Baker et al., 1997Down ), and thus only a few codons from either end of the gene are shown. Nucleotides underlined in the intergenic regions indicate differences between Pa. pantotrophus and Pa. denitrificans. Transcript start sites are indicated as circled nucleotides. Boxed nucleotides indicate motifs discussed in the text. The transcript start sites of nirS (this work) and nirI (Saunders et al., 1999Down ) have been experimentally determined.

 
Northern blot studies
mRNA from nitrate-grown Pa. pantotrophus blotted and hybridized to an internal nirS DNA probe showed that nirS occurs on a monocistronic transcript about 1825 bp in length (Fig. 3Down). This size was estimated by comparison with an RNA molecular mass marker (Fig. 3Down). The quality of the RNA preparation was assessed by comparison with 16S and 23S rRNA of E. coli, rather than that of Pa. pantotrophus. The E. coli rRNA was used because the 23S rRNA of Pa. pantotrophus appeared to spontaneously and reproducibly degrade into discrete RNA fragments, one of which was the same size as the 16S rRNA molecule (data not shown). E. coli preparations prepared in tandem did not behave in this manner. The apparent degradation may be indicative of an ‘intervening sequence’ (Gregory et al., 1996Down ). The decay of the 23S rRNA made the estimation of total RNA quality in the preparation (normally gauged by the relative amounts of 23S and 16S rRNA) difficult to assess.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 3. Northern blot of total RNA from Pa. pantotrophus using a nirS-derived probe. RNA from aerobically (lane 1) or anaerobically (lane 2) grown Pa. pantotrophus was detected by chemiluminescence. The relative positions of the E. coli 23S (2904 bases) and 16S (1542 bases) rRNA species are shown on the left of the blot, and the sizes of the RNA molecular mass markers (New England Biolabs) are shown on the right.

 
The 1825 bp RNA band hybridizing to nirS did not appear under aerobic conditions, once again casting doubt over the ability of Pa. pantotrophus to denitrify aerobically using cd1 nitrite reductase. Aerobic reduction of nitrate has been well documented, for example, in Pa. denitrificans (Sears et al., 1997Down ), but true aerobic denitrification with the generation of nitrogen as the end product remains in general controversial. Experiments that support the existence of aerobic denitrification in whole cells of Pa. pantotrophus (Arts et al., 1995Down ; Robertson et al., 1995Down ) have not yet been supported by molecular approaches to the problem. The present Northern blot studies indicate that little if any nirS mRNA is produced, showing that the observation by Moir et al. (1995)Down that cd1 nitrite reductase could not be detected by Western blotting in aerobically grown Pa. pantotrophus cells results from lack of transcription from the nirS gene. Nitrite reductase plays a crucial part in denitrification (Zumft, 1997Down ) and deletion mutants of nirS in Pa. denitrificans and Pa. pantotrophus are unable to denitrify (de Boer et al., 1994Down ; N. F. W. Saunders, S. C. Baker & S. J. Ferguson, unpublished results); thus the molecular basis for any aerobic nitrite reduction is currently obscure. Although some authors maintain that extended laboratory cultivation of Pa. pantotrophus leads to the loss of the aerobic denitrification (reviewed by Stouthamer et al., 1997Down ), a complete reversal in the properties of a multi-component regulatory system (comprising at least an NO sensor, Nnr and NirI) is improbable.

The monocistronic nature of the nirS transcript agreed with the presence of a putative downstream transcript termination structure (Fig. 2Up), and no larger band could be seen even if the Northern blot was overexposed. The length of the nirS transcript suggests that transcription terminates around 55 bp upstream of the nirE translation initiation codon, within 10 bp of the stem–loop structure found in the nirS–nirE intergenic region. This supports the proposal that this structure does indeed function as a rho-independent terminator. When the same RNA preparation was blotted to a nirE probe (which hybridized successfully to a plasmid-borne nirE gene) no hybridization was seen to any RNA molecule, confirming that the previously observed transcript did not contain nirE mRNA. This observation suggests that the nirE transcript was in an abundance too low to be visualized by the methods used.

The presence of Pa. pantotrophus nirS as a monocistronic mRNA is in contrast to the nirSMCFDLGHJEN nitrite reductase operon of Ps. aeruginosa, in which a single transcript provides both the structural nitrite reductase gene and the genes for d1 haem biosynthesis (Kawasaki et al., 1997Down ). Northern blot analysis of the nirSTM operon of Ps. stutzeri (ZoBell) showed that two transcripts originated from the nirS promoter, one containing nirS alone, the other nirS, T and M (Härtig & Zumft, 1999Down ). In neither pseudomonad is the nirS gene followed by a terminator such as that identified in Pa. pantotrophus (Fig. 2Up).

Initiation of transcription of nirS
The transcription start site (TSS) of nirS was initially determined by primer extension analysis (Fig. 4Down), and this suggested a guanidine 29 bp upstream of the translation initiation codon. Since high GC content mRNA (Pa. pantotrophus has a genome of approximately 66 mol% G+C; Rainey et al., 1999Down ) has proved to be susceptible to artefactual termination of the primer extension reaction (S. C. Baker & S. J. Ferguson, unpublished results), the TSS was further analysed using 5'-RACE. This again showed that, under denitrifying conditions, the nirS transcript commenced from a guanidine 29 bp upstream of the translation initiation codon (Fig. 5Down).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 4. Primer extension product (lane marked cDNA) synthesized from nirS mRNA, compared with a sequencing ladder generated from the nirS gene using the same primer. Part of the sequence upstream of nirS is shown on the left of the sequencing ladder and the G residue indicating the transcription start site is labelled with an asterisk.

 


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 5. Sequence of the cloned PCR product synthesized from nirS mRNA by 5'-RACE. The PCR product generated using the primers Q1F and 228R (see text for details) was cloned into the vector pGEM-T and sequenced using the M13F universal primer. The Q1F primer can be read from the sequence and is followed by 11 T residues, representing the poly-A tail that was added to the cDNA following its synthesis from the nirS mRNA. The residue immediately following the poly-T sequence is a G residue (marked with an asterisk). This residue indicates the 5' end of the mRNA and is the same residue as that identified by primer extension.

 
The promoter region of nirS indicated by these transcription studies had few identifiable sequence motifs. Despite the presence of a clear anaerobox (TTAACaatgGTCAA) similar to the binding site of E. coli Fnr (TTGAT-N4-ATCAA; Gunsalus & Park, 1994Down ) centred at -41·5 from the TSS, no clear -10 motif could be seen, which might have indicated the footprint of {sigma}70 RNA polymerase. NirS could only be expressed in E. coli when a tac promoter, rather than the Pa. pantotrophus nirS promoter, was used to drive expression (S. C. Baker, N. F. W. Saunders & S. J. Ferguson, unpublished results). Thus it appears that Fnr plus the RNA polymerases available in E. coli cannot recognize the nirS promoter. It is likely that Pa. pantotrophus contains transcription factors that recognize the context of the anaerobox as being Nnr- rather than Fnr-dependent. In Fnr-regulated genes of organisms such as E. coli, the -35 motif for this RNA polymerase is replaced by the sequence for the binding of the regulatory protein when an Fnr-type protein acts as an activator (Spiro & Guest, 1990Down ), so one would not necessarily expect to see a {sigma}70 -35 recognition sequence in the nirS promoter.

An Fnr-like box, equivalent to that seen in Pa. denitrificans (Fig. 2Up), has previously been suggested to be the binding site of Nnr (van Spanning et al., 1997Down ). Nnr is in the Fnr/Crp family of proteins and is induced in Pa. denitrificans during denitrification. Insertion of a kanamycin cassette into the gene encoding Nnr leads to a nitrite reductase minus phenotype, characterized by the absence of a NirS polypeptide, but conversely an Fnr mutant is unaffected in nitrite reduction (de Boer et al., 1996Down ). The combination of these results and the presence of an Fnr-like motif in an appropriate position upstream of the TSS of nirS strongly suggests that TTAACaatgGTCAA is the binding site of Nnr.

The position of a single Fnr-like box between the nirS transcription start site (this work) and that of nirI (Saunders et al., 1999Down ) suggests that, unusually, a single motif controls the transcription of nirS and nirI in a bi-directional manner. The nirI promoter has previously been shown to be Nnr-dependent (van Spanning et al., 1999Down ). This may have implications in the co-regulation of these two genes, as sterically the binding of a holo RNA polymerase to enable transcription of nirS would prevent transcription towards nirI.

Pa. pantotrophus promoter regions controlled by Nnr (the regions upstream of nirS and nirI) were aligned with respect to their TSSs to identify common motifs between them. It is striking that the sequence T-T-G/C-C-G/C-G/C occurs in the region -14 to -19 with respect to the transcription start site in both the nirS and nirI promoter regions. This motif differs considerably from the {sigma}70-like -10 motif (TATAAT in E. coli; Hawley & McClure, 1983Down ) or any other known RNA polymerase motifs and cannot be found in the same position upstream of any other transcript start sites of the alpha Proteobacteria (as judged by a GCG FINDPATTERNS examination of prokaryotic sequence databases using T-T-G/C-C-G/C-G/C-N20–100-ATG as a search term and subsequently examining sequence annotations for defined transcript start sites within the search results). The one promoter recovered in this search was that of Pa. denitrificans norC, again positively regulated by Nnr. This suggests that there may be other DNA-binding protein(s) involved in the Nnr-dependent transcription of nirS and nirI, but the motif at -16 cannot be found in the promoter regions of nirK [encoding an Nnr-controlled copper-containing nitrite reductase (Bartnikas et al., 1997Down ; Tosques et al., 1997Down )] of the closely related bacterium Rhodobacter sphaeroides. Such motifs are also absent from Ps. stutzeri nirS and dnrS (the latter gene is the functional equivalent of Pa. denitrificans nnr) promoters, which conform more closely to the {sigma}70-mediated E. coli Fnr consensus promoter sequence with a clear -10 hexamer (Vollack et al., 1999Down ).

Although Pa. pantotrophus and Pa. denitrificans are very closely related, albeit separate, species (Rainey et al., 1999Down ), the nirS promoter regions of the two organisms do differ from one another (Fig. 2Up), and a notable feature is that one motif has retained its structure while altering its sequence. In Pa. pantotrophus, an imperfect inverted repeat (TTGCGCGCAA) appears between the Nnr box and the T-T-G/C-C-G/C-G/C motif discussed above. This inverted repeat also appears in the Pa. denitrificans nirS promoter region, but the flanking TT/AA nucleotides are replaced with G and C so that the sequence appears as CCGCGCGCGG. The position of this sequence may indicate the binding site of another protein, but the purpose of retaining the integrity of the repeat between species remains obscure. Such inverted repeats cannot be found in the upstream region of nirI.

The monocistronic nature of transcription from the promoter upstream of Pa. pantotrophus nirS, and the presence of a rho-independent terminator in the nirS–nirE intergenic region, suggest that genes downstream of nirS are transcribed from a separate promoter. A gap of approximately 70 bp between the termination codon of nirS and the initiation codon of nirE is a plausible location for this promoter. A sequence much like that seen in the nirS and nirI promoters (TTCGCG) can be seen in a plausible position relative to the nirE translation start codon (40 bp upstream), but no binding site for Nnr can be distinguished. Extensive attempts to determine the nirE TSS experimentally by both techniques used for nirS in this paper were unsuccessful, perhaps because of the low abundance of nirE-hybridizing mRNA noted during Northern blotting. Since nirE and the genes downstream encode proteins involved in the production of the specialized d1 haem, fewer transcripts would be required relative to the structural gene for nitrite reductase (nirS). Thus the presence of two promoters to control the structural gene and accessory proteins may provide a means of co-regulating the abundance of nitrite reductase polypeptide with its specialized d1 haem.


    ACKNOWLEDGEMENTS
 
S.C.B. and S.J.F. contributed equally to the direction of the work and writing of this manuscript. The authors wish to thank Dr R. J. M. van Spanning for useful discussions and access to unpublished material. N.F.W.S. is grateful to the Wellcome Trust for the award of a Prize Studentship with S.J.F. S.C.B. was supported through BBSRC grant number B05860 to S.J.F., and thanks Professor C. J. Knowles (Oxford Centre for Environmental Biotechnology), Dr M. Bailey and Dr I. Jones (NERC Institute for Virology and Environmental Microbiology) for help during the writing of this paper.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Arai, H., Kodama, T. & Igarashi, Y. (1997). Cascade regulation of the two CRP/FNR-related transcriptional regulators (ANR and DNR) and the denitrification enzymes in Pseudomonas aeruginosa.Mol Microbiol 25, 1141-1148.[Medline]

Arai, H., Kodama, T. & Igarashi, Y. (1999). Effect of nitrogen oxides on expression of the nir and nor genes for denitrification in Pseudomonas aeruginosa.FEMS Microbiol Lett 170, 19-24.[Medline]

Arts, P. A. M., Robertson, L. A. & Kuenen, J. G. (1995). Nitrification and denitrification by Thiosphaera pantotropha in aerobic chemostat cultures.FEMS Microbiol Ecol 18, 305-315.

Baker, S. C., Saunders, N. F. W., Willis, A. C., Ferguson, S. J., Hajdu, J. & Fülöp, V. (1997). Cytochrome cd1 structure: unusual haem environments in a nitrite reductase and analysis of factors contributing to beta-propeller folds.J Mol Biol 269, 440-455.[Medline]

Baker, S. C., Ferguson, S. J., Ludwig, B., Page, M. L. D., Richter, O. H. M. & van Spanning, R. J. M. (1998). Molecular biology of the genus Paracoccus.Microbiol Mol Biol Rev 62, 1046-1078.[Abstract/Free Full Text]

Bartnikas, T. B., Tosques, I. E., Laratta, W. P., Shi, J. & Shapleigh, J. P. (1997). Characterisation of the nitric oxide reductase-encoding region in Rhodobacter sphaeroides 2.4.3.J Bacteriol 179, 3534-3540.[Abstract/Free Full Text]

de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994). Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans.Antonie Leeuwenhoek 66, 111-127.

de Boer, A. P. N., van der Oost, J., Reijnders, W. N. M., Westerhoff, H. V., Stouthamer, A. H. & van Spanning, R. J. M. (1996). Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.Eur J Biochem 242, 592-600.[Medline]

Cuypers, H. & Zumft, W. G. (1993). Anaerobic control of denitrification in Pseudomonas stutzeri escapes mutagenesis of an fnr-like gene.J Bacteriol 175, 7236-7246.[Abstract/Free Full Text]

Engler-Blum, G., Meier, M., Frank, J. & Müller, G. A. (1993). Reduction of background problems in non-radioactive Northern and Southern blot analyses enables higher sensitivity than 32P-based hybridisations.Anal Biochem 210, 235-244.[Medline]

Ferguson, S. J. (1994). Denitrification and its control.Antonie Leeuwenhoek 66, 89-110.

Frohman, M. A. (1993). Rapid amplification of complementary DNA ends for generation of full-length complementary cDNAs: thermal RACE.Methods Enzymol 218, 340-356.[Medline]

Fülöp, V., Moir, J. W. B., Ferguson, S. J. & Hajdu, J. (1995). The anatomy of a bifunctional enzyme: structural basis for reduction of oxygen to water and synthesis of nitric oxide by cytochrome cd1.Cell 81, 369-377.[Medline]

Gregory, S., O’Connor, M. & Dahlberg, A. (1996). Functional Escherichia coli 23S rRNAs containing processed and unprocessed intervening sequences from Salmonella typhimurium.Nucleic Acids Res 24, 4918-4923.[Abstract/Free Full Text]

Gunsalus, R. P. & Park, S. J. (1994). Aerobic-anaerobic gene regulation in Escherichia coli: control by the ArcAB and Fnr regulons.Res Microbiol 145, 437-450.[Medline]

Härtig, E. & Zumft, W. G. (1999). Kinetics of nirS expression (cytochrome cd1 nitrite reductase) in Pseudomonas stutzeri during the transition from aerobic respiration to denitrification: evidence for a denitrification-specific nitrate- and nitrite-responsive regulatory system.J Bacteriol 181, 161-166.[Abstract/Free Full Text]

Hasegawa, N., Arai, H. & Igarashi, Y. (1998). Activation of a consensus FNR-dependent promoter by DNR of Pseudomonas aeruginosa in response to nitrite.FEMS Microbiol Lett 166, 213-217.[Medline]

Hawley, D. K. & McClure, W. R. (1983). Compilation and analysis of Escherichia coli promoter DNA sequences.Nucleic Acids Res 11, 2237-2255.[Abstract/Free Full Text]

Jüngst, A., Wakabayashi, S., Matsubara, H. & Zumft, W. G. (1991). The nirSTBM region coding for cytochrome cd1-dependent nitrite respiration of Pseudomonas stutzeri consists of a cluster of mono-, di-, and tetraheme proteins.FEBS Lett 279, 205-209.[Medline]

Kawasaki, S., Arai, H., Kodama, T. & Igarashi, Y. (1997). Gene cluster for dissimilatory nitrite reductase (nir) from Pseudomonas aeruginosa: sequencing and identification of a locus for heme d1 biosynthesis.J Bacteriol 179, 235-242.[Abstract/Free Full Text]

Khoroshilova, N., Beinert, H. & Kiley, P. J. (1995). Association of a polynuclear iron-sulfur center with a mutant FNR protein enhances DNA binding.Proc Natl Acad Sci USA 92, 2499-2503.[Abstract/Free Full Text]

Moir, J. W. B., Baratta, D., Richardson, D. J. & Ferguson, S. J. (1993). The purification of a cd1-type nitrite reductase from, and the absence of a copper-type nitrite reductase from, the aerobic denitrifier Thiosphaera pantotropha; the role of pseudoazurin as an electron donor.Eur J Biochem 212, 377-385.[Medline]

Moir, J. W. B., Richardson, D. J. & Ferguson, S. J. (1995). The expression of redox proteins of denitrification in Thiosphaera pantotropha grown with oxygen, nitrate, and nitrous-oxide as electron-acceptors.Arch Microbiol 164, 43-49.

Ohshima, T., Sugiyama, M., Uozumi, N., Iijima, S. & Kobayashi, T. (1993). Cloning and sequencing of a gene encoding nitrite reductase from Paracoccus denitrificans and expression of the gene in Escherichia coli.J Ferment Bioeng 76, 82-88.

Rainey, F. A., Kelly, D. P., Stackebrandt, E., Burghardt, J., Hiraishi, A., Katayama, Y. & Wood, A. P. (1999). A re-evaluation of the taxonomy of Paracoccus denitrificans and a proposal for the creation of Paracoccus pantotrophus comb. nov.Int J Syst Bacteriol 49, 645-651.[Abstract/Free Full Text]

Rees, E., Siddiqui, R. A., Köster, F., Schneider, B. & Friedrich, B. (1997). Structural gene (nirS) for the cytochrome cd1 nitrite reductase of Alcaligenes eutrophus H16.Appl Environ Microbiol 63, 800-802.[Abstract]

Robertson, L. A. & Kuenen, J. G. (1983). Thiosphaera pantotropha gen. nov. sp. nov., a facultatively anaerobic, facultatively autotrophic sulphur bacterium.J Gen Microbiol 129, 2847-2855.

Robertson, L. A., Dalsgaard, T., Revsbech, N. P. & Kuenen, J. G. (1995). Confirmation of aerobic denitrification in batch cultures, using gas-chromatography and N-15 mass-spectrometry.FEMS Microbiol Ecol 18, 113-119.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Saunders, N. F. W., Houben, E. N. G., Koefoed, S., de Weert, S., Reijnders, W. N. M., Westerhoff, H. V., De Boer, A. P. N. & van Spanning, R. J. M. (1999). Transcription regulation of the nir gene cluster encoding nitrite reductase of Paracoccus denitrificans involves NNR and NirI, a novel type of membrane protein.Mol Microbiol 34, 24-36.[Medline]

Sears, H. J., Spiro, S. & Richardson, D. J. (1997). Effect of carbon substrate and aeration on nitrate reduction and expression of the periplasmic and membrane-bound nitrate reductases in carbon-limited continuous cultures of Paracoccus denitrificans Pd1222.Microbiology 143, 3767-3774.

Silvestrini, M. C., Galeotti, C. L., Gervais, M., Schininà, E., Barra, D., Bossa, F. & Brunori, M. (1989). Nitrite reductase from Pseudomonas aeruginosa: sequence of the gene and the protein.FEBS Lett 254, 33-38.[Medline]

Smith, G. B. & Tiedje, J. M. (1992). Isolation and characterization of a nitrite reductase gene and its use as a probe for denitrifying bacteria.Appl Environ Microbiol 58, 376-384.[Abstract/Free Full Text]

van Spanning, R. J. M., de Boer, A. P. N., Reijnders, W. N. M., Westerhoff, H. V., Stouthamer, A. H. & van der Oost, J. (1997). FnrP and Nnr of Paracoccus denitrificans are both members of the Fnr family of transcriptional activators but have distinct roles in respiratory adaptation in response to oxygen limitation.Mol Microbiol 23, 893-907.[Medline]

van Spanning, R. J. M., Houben, E., Reijnders, W. M. N., Spiro, S., Westerhoff, H. V. & Saunders, N. F. W. (1999). Nitric oxide is a signal for NNR-mediated transcription activation in Paracoccus denitrificans.J Bacteriol 181, 4129-4132.[Abstract/Free Full Text]

Spiro, S. & Guest, J. R. (1990). FNR and its role in oxygen-regulated gene-expression in Escherichia coli.FEMS Microbiol Rev 75, 399-428.

Stouthamer, A. H., de Boer, A. P. N., van der Oost, J. & van Spanning, R. J. M. (1997). Emerging principles of inorganic nitrogen metabolism in Paracoccus denitrificans and related bacteria.Antonie Leeuwenhoek 71, 33-41.

Tosques, I. E., Kwiatkowski, A. V., Shi, J. & Shapleigh, J. P. (1997). Characterization and regulation of the gene encoding nitrite reductase in Rhodobacter sphaeroides 2.4.3.J Bacteriol 179, 1090-1095.[Abstract/Free Full Text]

Vollack, K. U., Hartig, E., Korner, H. & Zumft, W. G. (1999). Multiple transcription factors of the FNR family in denitrifying Pseudomonas stutzeri: characterization of four fnr-like genes, regulatory responses and cognate metabolic processes.Mol Microbiol 31, 1681-1694.[Medline]

Zumft, W. G. (1997). Cell biology and molecular basis of denitrification.Microbiol Mol Biol Rev 61, 533-616.[Abstract]

Received 23 July 1999; revised 8 October 1999; accepted 8 November 1999.


This article has been cited by other articles:


Home page
Int. J. Syst. Evol. Microbiol.Home page
D. P. Kelly, J. P. Euzeby, C. F. Goodhew, and A. P. Wood
Redefining Paracoccus denitrificans and Paracoccus pantotrophus and the case for a reassessment of the strains held by international culture collections.
Int J Syst Evol Microbiol, October 1, 2006; 56(Pt 10): 2495 - 2500.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
M. I. Hutchings and S. Spiro
The nitric oxide regulated nor promoter of Paracoccus denitrificans
Microbiology, October 1, 2000; 146(10): 2635 - 2641.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saunders, N. F. W.
Right arrow Articles by Baker, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saunders, N. F. W.
Right arrow Articles by Baker, S. C.
Agricola
Right arrow Articles by Saunders, N. F. W.
Right arrow Articles by Baker, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2000 Society for General Microbiology.