|
|
||||||||
Pathogenicity and Medical Microbiology |
Université de Paris-Sud, Faculté de Pharmacie, Département de Microbiologie, 5 rue JB Clément, 92296 Châtenay-Malabry cedex, France1
Institute of Infection and Immunity, Queens Medical Centre, University of Nottingham, University Park, Nottingham NG7 2RD, UK2
PHLS Central Public Health Laboratory, 61 Colindale Ave, London NW9 5HT, UK3
Author for correspondence: Marie-Claude Barc. Tel: +33 1 46 83 55 49. Fax: +33 1 46 83 58 83. e-mail: marie-claude.barc{at}cep.u-psud.fr
| ABSTRACT |
|---|
|
|
|---|
Keywords: Clostridium difficile, flagella, flagellin, PCR, cloning
Abbreviations: GST, glutathione S-transferase
The GenBank accession numbers for the sequences reported in this paper are AF065259 (strain 79-685) and AF077341 (strain VPI 10463).
| INTRODUCTION |
|---|
|
|
|---|
One aspect of C. difficile virulence that has been studied by us is its interaction with target cells (Eveillard et al., 1993
; Karjalainen et al., 1994
). Adhesion and colonization of animal tissue by bacteria is an important step in establishing infection. It is probable that without attachment, C. difficile cannot colonize and will be quickly removed by non-specific host defence mechanisms.
We are interested in finding out whether flagella play a role in C. difficile colonization. In this study we undertook the isolation of C. difficile flagella from clinical strains and characterization and expression of the flagellin subunit gene. In addition, Southern analysis and PCR amplification of flagellin genes coupled with RFLP analysis were used in a preliminary attempt to differentiate between clinical isolates.
| METHODS |
|---|
|
|
|---|
|
Flagellin protein of C. difficile: isolation, characterization and N-terminal sequencing.
Flagellin proteins were isolated by the procedure described by Delmée et al. (1990)
. The strains were grown on blood agar plates under anaerobic conditions for 48 h. Bacteria were harvested in 5 ml distilled water; the suspensions were strongly shaken for 1 min and centrifuged at 5000 g for 30 min at 4 °C. The supernatants were centrifuged at 25000 g for 1 h at 4 °C and the pellets were suspended in 100 µl PBS (pH 7·4).
SDS-PAGE was carried out as described by Laemmli (1970)
using an SDS-PAGE gel (7·5%, w/v, acrylamide). Gels were stained with Coomassie blue or used for electric transfer onto nitrocellulose membrane for immunoblotting. The nitrocellulose membrane was incubated for 30 min at room temperature in blocking buffer (0·2% Tween, 3% skim milk in PBS) and then overnight in a rabbit polyclonal antiflagellin serum to serogroup A (strain W1194), kindly provided by M. Delmée (UCL, Brussels, Belgium) (1:2000 dilution). The membranes were washed in 10 mM Tris/HCl, 150 mM NaCl, 0·05% Tween 20 buffer (TNT) and bound antibodies were detected with goat anti-rabbit IgG alkaline phosphatase conjugate (1:2500 dilution; Sigma) with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate as substrates.
For the N-terminal sequencing of the flagellin, proteins were electroblotted onto a Hybond-N membrane (Amersham) with CAPS buffer (Sigma) and stained with amido black. The bands of interest were excised and N-terminal analysis was performed (Polymer synthesis and Analysis unit, Department of Biochemistry, University of Nottingham). The method of Edman (1950)
was used with an Applied Biosystems 473A amino acid sequencer on a PTH-RP-PHLC C18 column. Identification was performed using 610A analysis software (Applied Biosystems).
Electron and immunoelectron microscopy of flagella and strains.
Flagellum preparations or 24 h cultures of C. difficile strains as described above were resuspended in distilled water. They were negatively stained with a phosphotungstic acid solution for 5 min and adsorbed on carbon-stabilized nitrocellulose film copper specimen grids (2 min) by placing each grid on a drop of the bacterium-staining solution. After drying, the grids were observed with an EM 301 Philips transmission electron microscope.
For immunoelectron microscopy, after adsorption of bacteria or flagellum preparation to the grids for 5 min, the grids were floated on PBS with 1% BSA for 30 min, then incubated with antiflagellin antibodies diluted 1:100 for 1 h and washed three times in PBS. They were incubated with a 1:20 dilution of protein A labelled with 15-nm-diameter colloidal gold particles (British Biocen International) for 1 h, washed three times with PBS and subsequently fixed with 3% glutaraldehyde. After three washings the grids were stained with phosphotungstic acid before observation by transmission electron microscopy. A strain of B. subtilis was used as a negative control.
Motility assays.
Motility assays were conducted in BHI broth with 0·175% agar. The medium was placed in tubes which were inoculated from a colony by stabbing the agar with a toothpick. The tubes were incubated at 37 °C for 2 d under anaerobic conditions.
DNA techniques.
Plasmid isolations were performed by the alkaline lysis procedure using a kit from Qiagen. Ligations and restriction endonuclease digestions were done according to Sambrook et al. (1989)
and protocols provided by the vendors. The TSB (Transformation Storage Buffer) method was used for transformation of E. coli (Chung et al., 1989
).
PCR amplification and nucleotide sequencing of the C. difficile flagellin gene.
The N-terminal sequence of the C. difficile 79-685 flagellin and conserved motifs in the C-terminal sequences of flagellins from various bacteria (V. cholerae, Vibrio parahaemolyticus, B. subtilis, Clostridium tyrobutyricum) were used to design degenerate primers synthesized by Life Technologies. The N-terminal primer was ATGMGAGTWAATGTWTCWGCGCTY; the C-terminal primer was TTGWCGAAYTGTTGGTTWGCAGCWAGCAG. Genomic DNA was extracted from C. difficile strains as described by Karjalainen et al. (1994)
or bacteria were harvested from blood agar plates, resuspended in sterile distilled water and boiled for 5 min and used directly in a standard amplification mixture. Amplifications were carried out in 100 µl volumes containing 1 µg genomic DNA, 2 µl MgCl2, 1 U Taq polymerase (Promega), 200 pmol of each deoxynucleotide triphosphate, 1 µM of each primer and 10 µl 10xpolymerase buffer for 34 cycles consisting of denaturation at 95 °C (1 min), annealing at 55 °C (1 min) and extension at 72 °C (2 min) (Perkin Elmer Thermocycler 480). At the end of the amplification, 20 µl samples were subjected to electrophoresis on a standard 1% agarose gel alongside a PCR size marker (100 bp ladder; Pharmacia) to confirm the presence of an amplified product. Amplified products were purified by a gel extraction kit (Wizard Gel Extraction kit; Promega).
The nucleotide sequences of both strands of amplified products of the C. difficile flagellin of strains 79-685 and VPI 10403 were obtained by using the Taq Dye Deoxy Terminator and Dye Primer cycle sequencing protocols developed by Applied Biosystems (Perkin Elmer) using fluorescence-labelled dideoxynucleotides and primers, respectively. The labelled extension products were analysed with an ABI PRISM 310 Genetic Analyzer (Perkin Elmer). More nucleotide sequence upstream and downstream of the first amplified region of the flagellin gene was obtained by amplification by PCR from the
ZapII genomic library (Karjalainen et al., 1994
), converted into a plasmid library by excision en masse, using a gene-specific primer (ACGAACCTTCTGCTGTTTGTAC) and a primer (GGAAACAGCTATGACCATG) that hybridized with the pBluescript polylinker (M13rev). For the upstream region a PCR product of 500 bp was obtained. For the downstream region a PCR product of 1·1 kb was obtained with the gene-specific primer CTTTAGAGAATGTTACAGCAGC and a vector-specific primer GTAAAACGACGGCCAGT (M13 -20). Secondary structure of the flagellin protein was predicted by using the Chou and Fasman algorithm (Chou & Fasman, 1978
). Additional sequencing of the flagellin gene was performed with internal primers.
Southern blotting and RFLP analysis.
DNA of C. difficile strains was prepared as described by Karjalainen et al. (1994)
. DNA was digested with HindIII and electrically transferred to a nylon membrane (Boehringer Mannheim). The 850 bp amplified PCR product was used as a flagellin gene specific probe. The DNA probe was labelled and detected by using the ECL direct nucleic acid labelling and detection system from Amersham. Washing of membranes was performed under low stringency (0·5xSSC at 42 °C). For RFLP amplified DNA was obtained by PCR from colonies grown on blood agar plates as described above. The DNA was digested with four restriction enzymes, HindIII, EcoRV, DraI and SacI, under the conditions recommended by the supplier (New England Biolabs). These digests were then subjected to electrophoresis on a 1% agarose gel alongside a PCR size marker (100 bp ladder; Pharmacia).
Cloning, expression, purification and identification of the fusion protein.
For the cloning of the C. difficile 79-685 flagellin gene into an expression vector, two oligonucleotide primers, CCCCTGGGATCCATGAGAGTTAATACAAATGTAAGTGC and CCGGGAATTCCTATCCTAATAATTGTAAAACTCC, incorporating the BamHI and EcoRI restriction site, respectively, were synthesized and used to amplify by PCR the full-length coding region of the fliC gene of strain 79-685 (Taq polymerase, Promega; 1 U per 100 µl reaction volume). The resulting 895 bp DNA product was digested with BamHI and EcoRI and cloned in-frame into the corresponding sites of pGEX-6P-1 (Pharmacia). The nucleotide sequence of the junction between vector and insert was confirmed by sequencing analysis to be correct. The plasmid was transformed into E. coli BL21.
For the expression and purification of the fusion protein, an overnight culture of E. coli BL21 containing pGEX-6P-1-fliC was diluted 1:100 into 4 l 2xYT medium (Life Technologies) containing ampicillin and the culture was grown to OD600 0·6 at 37 °C. The expression of the fusion protein was induced by adding IPTG at 1 mM for 2 h. Bacteria were collected by centrifugation and resuspended in 200 ml ice-cold PBS. The bacteria were lysed by sonication (intervals of 5 s for 1 h at 80% power; Bioblock Scientific 72442 Vibra Cell). Insoluble material was removed by centrifugation at 8000 g for 10 min, and the fusion protein was purified from the supernatant by a single-step affinity chromatography using glutathioneSepharose-4B and protocols from Pharmacia. A 2 ml bed volume was used for each 200 ml sonicate; the column was washed three times with 20 ml PBS, followed by cleavage of the FliC moiety bound to glutathioneSepharose with 80 units Prescission protease per 1 ml bed volume. Identification of the fusion protein was carried out by SDS-PAGE as described above and by immunoblot (serum dilution 1:2000).
A polyclonal antiflagellin serum was raised against the purified FliC recombinant protein. The gel band located at 39 kDa corresponding to the purified flagellin was cut out and injected into a rabbit. The polyclonal, monospecific antiserum was obtained according to a protocol described previously (Karjalainen et al., 1994
) and used at a 1:2000 dilution in Western blots.
Computer analyses.
Nucleotide and protein sequence alignments were performed with the CLUSTALX program (Thompson et al., 1997
). Homology searches were conducted with FASTA3 (EBI) or BLAST (National Institute for Biotechnology Information, Washington).
Adherence inhibition assays.
Cell culture and adherence inhibition assays were performed as previously described (Karjalainen et al., 1994
). For adherence inhibition with antibodies, bacteria were incubated with preimmune serum (dilution 1:2) or immune serum (dilution 1:2) for 1 h prior to contact of 1 h with cultured Vero cells. Non-adherent bacteria were eliminated by five washings in PBS (10 mM phosphate buffer, 150 mM NaCl) (pH 7·0) and the cells were fixed and stained with MayGrünwaldGiemsa (Sigma). The adhesion index is given as the mean number of adhering bacteria per cell (counted at a magnification of x1000) from at least three different assays.
| RESULTS |
|---|
|
|
|---|
|
Detection of flagella by electron microscopy
Electron microscopy was used to observe the flagella of C. difficile strains, either on intact bacteria or in isolated flagellum preparations (Fig. 2
). Some strains, such as Kohn and W1194, had numerous flagella, whereas other strains carried fewer flagella. It was evident by immunoelectron microscopy that the flagella were labelled by the Delmée flagellin antiserum A. B. subtilis and a C. sordellii strain, used as negative controls, showed no labelled flagella.
|
ZapII. The nucleotide sequence of a 1·6 kb fragment of two strains, 79-685 and VPI 10463, was determined; analysis of the DNA sequence revealed the presence of two ORFs: ORF1 composed of 870 nt corresponding to 290 amino acids, and a partial ORF 90 bases downstream. Based on the comparison of the deduced amino acid sequence with flagellin sequences from both Gram-positive and Gram-negative bacteria, ORF1 was identified as the flagellin gene of C. difficile, which we named fliC. FliC of C. difficile has a calculated molecular mass of 30·9 kDa: thus it differs from the estimated molecular mass of 39 kDa determined by SDS-PAGE (Fig. 1a
-helical conformation with frequent alanine and few proline residues; no signal sequence, the sequence LIAN resembling the consensus sequence N(I/L)AN that serves as an export signal for flagellar subunits (Heinzerling et al., 1997
28 consensus binding site (TAAAGTN12GCCGATAA) is found in the promoter: TAAAGTN13TCCGATAA. The translational termination codon is followed by an imperfect inverted repeat that can form a stemloop structure with a
G (25 °C) of -63·9 kJ; it could constitute a
-independent transcriptional terminator.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Analysis of the promoter structure reveals the presence of a motif resembling the consensus sequence for
28 regulated promoters. However, the distance between the -10 and -35 motifs is 16 nt instead of the usual 15.
28, which is involved in transcription of the flagellar and chemotaxis genes, was originally found in B. subtilis (Gilman & Chamberlin, 1983
). Although transcription of some flagellar genes is initiated by
54, no consensus motif for this factor is present in the C. difficile fliC promoter.
The flagella of six strains of C. difficile were isolated. The molecular mass of C. difficile flagellin, 39 kDa, is in the middle of the range of other characterized flagellin molecules, which have been reported to have molecular masses ranging from 15 to 62 kDa (Arnold et al., 1998
; Joys, 1988
; Sakamoto et al., 1992
; Wilson & Beveridge, 1993
). C. difficile flagellins did not display heterogeneity between the different strains studied nor did they have multiple molecular masses. Immunoblotting and immunogold labelling of strains with a polyclonal antiserum raised against purified flagellin demonstrated that all C. difficile strains reacted with the antiserum, in contrast to strains of C. sordellii and B. subtilis. This result suggests that the flagellin of each strain contains cross-reacting epitopes due to the presence of the flagellin monomers. Although flagellins generally are structurally conserved in the N- and C-termini, the internal region is divergent and accounts for serological distinctiveness. Prediction of antigenic determinants in FliC of C. difficile using the Hopp and Woods algorithm (Hopp & Woods, 1981
) revealed the highest probability for the presence of such motifs in the central, variable region between aa 100 and 130. The central region has been proposed to be the region that is exposed to the outer environment (Sakamoto et al., 1992
). Like other flagellins, the central portion has a surplus of acidic residues over basic residues and, by implication, a net negative charge. It appears that most bacterial cell surface proteins carry a net negative charge (Wilson & Beveridge, 1993
). We suspected that the ORF downstream of the fliC gene could encode a glycosyltransferase that could be involved in the in situ glycosylation of flagella. If FliC of C. difficile were glycosylated, this could explain the difference in molecular mass observed on SDS-PAGE (39 kDa) and that estimated from the nucleotide sequence (31 kDa). In fact, using the DIG Glycan Detection kit we demonstrated that C. difficile strain 79-685 flagella are non-glycosylated. The fact that the cloned gene expressed in E. coli produces a flagellin with almost the same molecular mass as the native protein from C. difficile suggests that the protein undergoes post-translational modification other than glycosylation, since E. coli is not able to glycosylate proteins. Flagellar filaments can contain phosphorylated tyrosines or serines,
-N-methyl-lysine, or they can be sulfated glycoproteins.
The isolation of the fliC gene and isolation of a monospecific antiserum will allow further investigations as to the role of flagella in the pathogenic process. It has been suggested that the virulence of C. difficile strains is not solely attributable to toxin production; other factors such as presence of flagella could contribute to virulence. The role of flagella in microbial pathogenesis factors such as virulence, adherence, invasiveness or colonization has been demonstrated for numerous bacteria (Grant et al., 1993
; Scherer et al., 1993
; Zhang et al., 1993
; Grossman et al., 1995
; Pruckler et al., 1995
; Tamura et al., 1995
; Milton et al., 1996
; Mobley, 1996
; Bosshardt et al., 1997
; Kennedy et al., 1997
; Rosalski et al., 1997
; West et al., 1997
; Feldman et al., 1998
). In our experiments in vitro, no inhibition of adherence was shown with antibodies against the recombinant flagellum subunit. However, lack of adherence does not mean there is no role in colonization or virulence. We are planning to investigate further the role of the flagellin cap in adhesion (Arora et al., 1998
) and that of flagella in colonization and virulence using, for example, animal models.
The gene isolated here could be a potential biomarker to assess intraspecies genetic variation as there appears to be a divergent region in the amino acid sequence of the protein, a feature of surface-located proteins in bacteria (Whittam, 1995
; Winstanley et al., 1996
; Winstanley & Morgan, 1997
). An epidemiological survey using the combined PCR-RFLP method and nucleotide sequencing is in progress on a larger number of C. difficile isolates.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arora, S. K., Ritchings, B. W., Almira, E. C., Lory, S. & Ramphal, R. (1996). Cloning and characterization of Pseudomonas aeruginosa fliF, necessary for flagella assembly and bacterial adherence to mucin.Infect Immun 64, 2130-2136.[Abstract]
Arora, S. K., Ritchings, B. W., Almira, E. C., Lory, S. & Ramphal, R. (1998). The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion.Infect Immun 66, 1000-1007.
Bartlett, J. G., Chang, T. W., Gurwiyh, M., Gorbach, S. L. & Onderdonk, A. M. (1978). Antibiotic associated pseudomembranous colitis due to toxin producing clostridia. N Engl J Med 298, 531-534.[Abstract]
Borriello, S. P., Davies, H. A. & Barclay, F. E. (1988a). Detection of fimbriae amongst strains of Clostridium difficile.FEMS Microbiol Lett 49, 65-67.
Borriello, S. P., Welch, A. R., Barclay, F. E. & Davies, M. A. (1988b). Mucosal association by Clostridium difficile in the hamster gastrointestinal tract.J Med Microbiol 25, 191-196.[Abstract]
Bosshardt, S. C., Benson, R. F. & Field, B. S. (1997). Flagella are a positive predictor for virulence in Legionella.Microb Pathog 23, 107-112.[Medline]
Brett, P. J., Mah, D. C. & Wood, D. E. (1994). Isolation and characterization of Pseudomonas pseudomallei flagellin proteins.Infect Immun 62, 1914-1918.
Chou, P. Y. & Fasman, G. D. (1978). Prediction of the secondary structure of proteins from their amino acid sequence.Adv Enzymol Relat Areas Mol Biol 47, 45-148.[Medline]
Chung, C. T., Niemala, S. L. & Miller, H. R. (1989). One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution.Proc Natl Acad Sci USA 86, 2172-2175.
Davies, H. A. & Borriello, S. P. (1990). Detection of capsule in strains of Clostridium difficile.Microb Pathog 9, 141-146.[Medline]
Delmée, M., Avesani, V., Delferriere, N. & Burtonboy, G. (1990). Characterization of flagella of Clostridium difficile and their role in serogrouping reactions.J Clin Microbiol 28, 2210-2214.
Eaton, K. A., Suerbaum, S., Josenhams, C. & Krakowka, S. (1996). Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes.Infect Immun 64, 2445-2448.[Abstract]
Edman, P. (1950). Preparation of phenylhydantoins from some natural amino acids.Acta Chem Scand 4, 277-282.
Eveillard, M., Fourel, V., Barc, M. C., Kerneis, S., Coconnier, M. H., Karjalainen, T., Bourlioux, P. & Servin, A. (1993). Identification and characterization of adhesive factors of Clostridium difficile involved in adhesion to human colonic enterocyte-like Caco-2 and mucus-secreting HT29 cells in culture.Mol Microbiol 7, 371-381.[Medline]
Fedorov, O. V. & Efimov, A. V. (1990). Flagellin as an object for supramolecular engineering.Protein Eng 3, 411-413.
Feldman, M., Bryan, R., Rajan, S., Scheffler, L., Tang, B. S. L. & Prince, A. (1998). Role of flagella in pathogenesis of Pseudomonas aeruginosa pulmonary infection.Infect Immun 66, 43-51.
Gardel, C. L. & Mekalanos, J. J. (1996). Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression.Infect Immun 64, 2246-2255.[Abstract]
Ge, Y., Li, C., Slaughter, C. A. & Charon, N. W. (1988). Structure and expression of the FlaA periplasmic flagellar protein of Borrelia burgdorferi.J Bacteriol 180, 2418-2425.
George, W. L. (1984). Antimicrobial agent associated colitis and diarrhea: historical background and clinical aspects.Rev Infect Dis 6, 208-213.
Gilman, M. Z. & Chamberlin, M. J. (1983). Development and genetic regulation of the Bacillus subtilis genes transcribed by
28 RNA polymerase.Cell 35, 285-293.[Medline]
Grant, C. C., Konkel, M. E., Cieplak, W. J. & Tompkins, L. S. (1993). Role of flagella in adherence, internalization and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures.Infect Immun 61, 1764-1771.
Grossman, D. A., Witham, N. D., Burr, D., Lesmana, M., Rubin, F. A., Schoolnik, G. K. & Parsonnet, J. (1995). Flagellar serotypes of Salmonella typhi in Indonesia: relationship among motility, invasiveness, and clinical illness.J Infect Dis 171, 212-216.[Medline]
Guerry, P. (1997). Nonlipopolysaccharide surface antigens of Campylobacter species. J Infect Dis 176 (suppl. 2), S122S124.
Heinzerling, H. F., Olivares, M. & Burne, R. A. (1997). Genetic and transcriptional analysis of flgB flagellar operon constituents in the oral spirochete Treponema denticola and their heterologous expression in enteric bacteria.Infect Immun 65, 2041-2051.[Abstract]
Hopp, T. P. & Woods, K. R. (1981). Prediction of protein antigenic determinants from aminoacid sequences.Proc Natl Acad Sci USA 78, 3824-3828.
Joys, T. M. (1988). The flagellar filament protein.Can J Microbiol 34, 452-458.[Medline]
Karjalainen, T., Barc, M. C., Collignon, A., Trollé, S., Boureau, H., Cotte-Laffite, J. & Bourlioux, P. (1994). Cloning of a genetic determinant from Clostridium difficile involved in adherence to tissue culture cells and mucus.Infect Immun 62, 4347-4355.
Kennedy, M. J., Rosey, E. L. & Yancey, R. J. J. (1997). Characterization of flaA- and flaB- mutants of Serpulina hyodysenteriae: both flagellin subunits, FlaA and FlaB, are necessary for full motility and intestinal colonization.FEMS Microbiol Lett 153, 119-128.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature 227, 680-685.[Medline]
Larson, H. E., Honour, P., Price, A. B. & Borriello, S. P. (1978). Clostridium difficile and aetiology of pseudomembranous colitis.Lancet 1, 1063-1066.[Medline]
Liu, S. L., Ezaki, T., Miura, H., Matsui, K. & Yabuuchi, E. (1988). Intact motility as a Salmonella typhi invasion-related factor.Infect Immun 56, 1967-1973.
Lyerly, D. M. H., Krivan, H. C. & Wilkins, T. D. (1988). Clostridium difficile: its disease and toxins. Clin Microbiol Rev 1, 1-12.
McGee, K., Horstedt, P. & Milton, D. L. (1996). Identification and characterization of additional flagellin genes from Vibrio anguillarum.J Bacteriol 178, 1310-1319.
Milton, D. L., Otoole, R., Horstedt, P. & Wolfwatz, P. (1996). Flagellin A is essential for the virulence of Vibrio anguillarum.J Bacteriol 178, 1310-1319.
Mimori-Kiyosue, Y., Vonderviszt, F. & Namba, K. (1997). Locations of terminal segments of flagellin in the filament structure and their roles in polymerization and polymorphism.J Mol Biol 270, 222-237.[Medline]
Mobley, H. L. (1996). Defining Helicobacter pylori as a pathogen: strain heterogeneity and virulence. Am J Med 100(5A), 2S9S.
Mobley, H. L. T., Belas, R., Lockatell, V., Chippendale, G., Trifillis, A. L., Johnson, D. E. & Warren, J. W. (1996). Construction of a flagellum-negative mutant of Proteus mirabilis: effect on internalization by human renal epithelial cells and virulence in a mouse model of ascending urinary tract infection.Infect Immun 64, 5332-5340.[Abstract]
Morooka, T., Umeda, A. & Amado, K. (1985). Motility as an intestinal colonization factor for Campylobacter jejuni.J Gen Microbiol 131, 1973-1980.[Medline]
Perelle, S., Gibert, M., Bourlioux, P., Corthier, G. & Popoff, M. (1997). Production of a complete binary toxin (actin-specific ADP-ribosyltransferase) by Clostridium difficile CD196.Infect Immun 65, 1402-1407.[Abstract]
Poilane, I., Karjalainen, T., Barc, M. C., Bourlioux, P. & Collignon, A. (1998). Protease activity of Clostridium difficile strains.Can J Microbiol 44, 157-161.[Medline]
Pruckler, J. M., Benson, R. F., Moyenuddin, M., Martin, W. T. & Fields, B. S. (1995). Association of flagellum expression and intracellular growth of Legionella pneumophila.Infect Immun 63, 4928-4932.[Abstract]
Richardson, K. (1991). Roles of motility and flagellar structure in pathogenicity of Vibrio cholerae: analysis of motility mutants in three animal models.Infect Immun 59, 2727-2736.
Ritchings, B. W., Almira, E. C., Lory, S. & Ramphal, R. (1995). Cloning and phenotypic characterization of fleS and fleR, new response regulators of Pseudomonas aeruginosa which regulate motility and adhesion to mucin.Infect Immun 63, 4868-4876.[Abstract]
Rosalski, A., Sidorczyk, Z. & Kotelko, K. (1997). Potential virulence factors of Proteus bacilli.Microbiol Mol Biol Rev 6, 65-89.
Sakamoto, Y., Sutherland, K. J., Tamaoka, J., Kobayashi, T., Kudo, T. & Horikoshi, K. (1992). Analysis of the flagellin (hag) gene of alkalophilic Bacillus sp. C-125.J Gen Microbiol 138, 2159-2166.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Scherer, D. C., DeBurron-Connors, C. I. & Minnick, M. F. (1993). Characterization of Bartonella bacilliformis flagella and effect of antiflagellin antibodies on invasion of human erythrocytes.Infect Immun 61, 4962-4971.
Seddon, S. V. & Borriello, S. P. (1992). Proteolytic activity of Clostridium difficile.J Med Microbiol 36, 307-311.[Abstract]
Sneath, P. H. A. (1986). Endospore-forming Gram-positive rods and cocci. In Bergeys Manual of Systematic Bacteriology, pp. 1104-1207. Edited by P. H. A. Sneath, N. S. Mair, M. E. Sharpe & J. G. Holt. Baltimore: Williams & Wilkins.
Szymanski, C. M., King, M., Haardt, M. & Armstrong, G. T. (1995). Campylobacter jejuni motility and invasion of Caco-2 cells.Infect Immun 63, 4295-4300.[Abstract]
Tamura, Y., Kijima-Tanaka, M., Aoki, A., Ogikubo, Y. & Takahashi, T. (1995). Reversible expression of motility and flagella in Clostridium chauvoei and their relationship to virulence.Microbiology 141, 605-610.[Abstract]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.Nucleic Acids Res 24, 4876-4882.
West, N. P., Fitter, J. T., Jakubzik, U., Rohde, M., Guzman, C. A. & Walker, M. J. (1997). Non-motile mini-transposon mutants of Bordetella bronchiseptica exhibit altered abilities to invade and survive in eukaryotic cells.FEMS Microbiol Lett 146, 263-269.[Medline]
Whittam, T. S. (1995). Genetic population structure and pathogenicity in enteric bacteria. In Population Genetics of Bacteria (Society for General Microbiology Symposium 52), pp. 217-245. Edited by S. Baumberg, J. P. W. Young, E. M. H. Wellington & J. R. Saunders. Cambridge: Cambridge University Press.
Wilson, D. R. & Beveridge, T. J. (1993). Bacterial flagellar filaments and their component flagellins.Can J Microbiol 39, 451-472.[Medline]
Winstanley, C. & Morgan, J. A. (1997). The bacterial flagellin gene as a biomarker for detection, population genetics and epidemiological analysis.Microbiology 143, 3071-3084.[Medline]
Winstanley, C., Coulson, M., Wepner, B., Morgan, J. A. & Hart, C. (1996). Flagellin gene and protein variation amongst clinical isolates of Pseudomonas aeruginosa.Microbiology 142, 2145-2151.[Abstract]
Zhang, M. Y., Lovgren, A., Low, M. G. & Landen, R. (1993). Characterization of an avirulent pleiotropic mutant of the insect pathogen Bacillus thuringiensis: reduced expression of flagellin and phospholipases.Infect Immun 61, 4947-4954.
Received 22 September 1999;
revised 20 December 1999;
accepted 7 January 2000.
This article has been cited by other articles:
![]() |
A. Wright, D. Drudy, L. Kyne, K. Brown, and N. F. Fairweather Immunoreactive cell wall proteins of Clostridium difficile identified by human sera J. Med. Microbiol., June 1, 2008; 57(6): 750 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sebaihia, M. W. Peck, N. P. Minton, N. R. Thomson, M. T.G. Holden, W. J. Mitchell, A. T. Carter, S. D. Bentley, D. R. Mason, L. Crossman, et al. Genome sequence of a proteolytic (Group I) Clostridium botulinum strain Hall A and comparative analysis of the clostridial genomes Genome Res., July 1, 2007; 17(7): 1082 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Paul, S. M. Twine, K. J. Tam, J. A. Mullen, J. F. Kelly, J. W. Austin, and S. M. Logan Flagellin Diversity in Clostridium botulinum Groups I and II: a New Strategy for Strain Identification Appl. Envir. Microbiol., May 1, 2007; 73(9): 2963 - 2975. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pechine, C. Janoir, and A. Collignon Variability of Clostridium difficile Surface Proteins and Specific Serum Antibody Response in Patients with Clostridium difficile-Associated Disease J. Clin. Microbiol., October 1, 2005; 43(10): 5018 - 5025. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pechine, A. Gleizes, C. Janoir, R. Gorges-Kergot, M.-C. Barc, M. Delmee, and A. Collignon Immunological properties of surface proteins of Clostridium difficile J. Med. Microbiol., February 1, 2005; 54(2): 193 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hennequin, C. Janoir, M.-C. Barc, A. Collignon, and T. Karjalainen Identification and characterization of a fibronectin-binding protein from Clostridium difficile Microbiology, October 1, 2003; 149(10): 2779 - 2787. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Calabi, F. Calabi, A. D. Phillips, and N. F. Fairweather Binding of Clostridium difficile Surface Layer Proteins to Gastrointestinal Tissues Infect. Immun., October 1, 2002; 70(10): 5770 - 5778. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Calabi and N. Fairweather Patterns of Sequence Conservation in the S-Layer Proteins and Related Sequences in Clostridium difficile J. Bacteriol., July 15, 2002; 184(14): 3886 - 3897. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Karjalainen, N. Saumier, M.-C. Barc, M. Delmee, and A. Collignon Clostridium difficile Genotyping Based on slpA Variable Region in S-Layer Gene Sequence: an Alternative to Serotyping J. Clin. Microbiol., July 1, 2002; 40(7): 2452 - 2458. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tasteyre, M.-C. Barc, A. Collignon, H. Boureau, and T. Karjalainen Role of FliC and FliD Flagellar Proteins of Clostridium difficile in Adherence and Gut Colonization Infect. Immun., December 1, 2001; 69(12): 7937 - 7940. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dabard, C. Bridonneau, C. Phillipe, P. Anglade, D. Molle, M. Nardi, M. Ladire, H. Girardin, F. Marcille, A. Gomez, et al. Ruminococcin A, a New Lantibiotic Produced by a Ruminococcus gnavus Strain Isolated from Human Feces Appl. Envir. Microbiol., September 1, 2001; 67(9): 4111 - 4118. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-J. Waligora, C. Hennequin, P. Mullany, P. Bourlioux, A. Collignon, and T. Karjalainen |