|
|
||||||||
Bioenergetics and Transport |
Helsinki Bioenergetics Group, Institute of Biotechnology, PO Box 56 (Viikinkaari 5), FIN-00014 University of Helsinki, Finland1
Department of Biochemistry, University of Illinois at Urbana-Champaign, 600 South Mathews Street, Urbana, IL 61801, USA2
Author for correspondence: Marina L. Verkhovskaya. Tel: +358 9 191 58002. Fax: +358 9 191 58003. e-mail: Marina.Verkhovskaya{at}Helsinki.Fi
| ABSTRACT |
|---|
|
|
|---|
Keywords: NHE-like proteins, Escherichia coli, osmosensitivity
Abbreviations: EIPA, N-ethyl-N-isopropylamiloride
| INTRODUCTION |
|---|
|
|
|---|
| METHODS |
|---|
|
|
|---|
|
General DNA techniques.
Genomic DNA and plasmid DNA were prepared using Wizard genomic and plasmid DNA purification systems (Promega). DNA fragments were prepared for cloning using the QIAEX II gel extraction system (Qiagen) and DNA sequencing was performed using an ALF express DNA sequencer (Pharmacia). Taq polymerase (Promega) was used for the PCR reactions.
Interruption of yjcE (GRN11 strain).
The yjcE gene was obtained by PCR using the following primers: GAAGATCTTATGGAAATCTTCTTC (forward) and CCCAAGCTTTTACTGATTTTCCTC (reverse). The 1·6 kb PCR product was cloned into Litmus-28 as a BglIIHindIII fragment and sequenced in its entirety. A cassette containing a gene encoding chloramphenicol acetyltransferase (cat) was inserted in a unique PstI site located approximately in the middle of the yjcE gene. This interrupted yjcE gene was then cloned as a BglIIKpnI fragment (approx. 3 kb) into the pGP704 suicide vector by transformation into SM10
pir competent cells (Miller & Mekalanos, 1988
). Transformed SM10
pir cells were used for conjugation as a donor, and GR70N as a recipient. The ex-conjugants were selected for double-crossover events on the basis of chloramphenicol resistance and ampicillin sensitivity, after which the desired inactivation genotype was verified by PCR and designated GRN11.
Deletion and cloning of the ycgO gene.
We first attempted to inactivate this gene by an approach similar to that used above. When this met with a great deal of difficulty, it appeared that ycgO might be an essential gene. For this reason, we set up a two-plasmid approach involving knockout and rescue plasmids (Link et al., 1997
). The knockout plasmid (pKO3) included the ycgO deletion construct (see below) under control of a temperature-sensitive origin of replication (Psc101-ts). The rescue plasmid (pBAD-ycgO) carried a viable copy of ycgO under control of an arabinose promoter as described by Brown et al. (1995)
.
The rescue plasmid was constructed as follows: the ycgO gene was obtained by PCR using the following primers: ATGCTGGCAGGAGTCGATGGCG (forward) and AGATTCAGCTTCCTCTTCAGC (reverse). The 1·6 kb product was cloned into pBAD-TOPO by transformation into TOP-10 cells. The sequence and orientation of the product in the vector were verified by restriction analysis and DNA sequencing.
The knockout plasmid was constructed as follows. Two 500 bp fragments that flank the ends of ycgO were obtained by PCR and cloned into a TA-TOPO vector. The 5' fragment (L) contained a SmaI site at the 5' end and a PstI site at the 3' end. The 3' fragment (R) contained PstI and SalI sites. These fragments were cloned, first L and then R, into pBluescript SK(-) using the restriction sites described above. A kanamycin-resistance cassette was then introduced into the PstI site to give a construct containing the kanamycin-resistance gene and the ycgO flanking sequences (L-kan-R). A 2·2 kb NotISalI fragment containing this L-kan-R sequence was then cloned into the pKO3 vector.
The actual transformation of GR70N cells with the L-kan-R-pKO3 construct in order to delete the ycgO gene was done both with and without the rescue plasmid (pBAD-ycgO). When the rescue plasmid was used, colonies were selected on LB agar containing kanamycin, chloramphenicol, ampicillin and 0·2% (w/v) arabinose at 42 °C and then grown at 30 °C. The shift in temperature turned off Psc101-ts and thus selected for the integration of the plasmid into the genome (frequency of integration approx. 2x10-5). Return to permissive temperature selected for excisants; in the presence of sucrose and kanamycin, mutant allele in the chromosome was selected using a positive selection (sucrose and kanamycin resistance). The strain produced was designated GRF72. In the case where no rescue plasmid was used, cells were plated on LB agar containing kanamycin and chloramphenicol at 42 °C, and the resulting strain was designated GR55. In both cases, the replacement of the genomic ycgO by the kanamycin-resistance gene was confirmed by PCR. The same number of colonies bearing the ycgO deletion were obtained with or without the rescue plasmid, which indicates that the ycgO gene is not essential.
Expression of ycgO in the rescue plasmid.
The pBAD expression vector includes a sequence encoding a 6xHis tag at its N-terminus. To test for arabinose-induced expression of the recombinant ycgO gene product, the cell membrane fraction was subjected to SDS-PAGE and Western blotting using antibodies that recognize histidine tags (tetra-His antibody; Qiagen).
GRD22 double mutant.
A mutant strain that features both interruption of the yjcE gene (from the GRN11 strain) and deletion of the ycgO gene (from the GRF55 strain) was generated by P1 transduction. Preparation of lysates and transduction were carried out according to Silhavy et al. (1982)
. Transductants were grown on LB agar with chloramphenicol and kanamycin. The acquisition of the silenced gene from the lysate was checked by PCR using primers located 50 bp above and below the coding region.
Measurements of Na+ and K+ content in cells.
Sodium and potassium content of cells and membrane vesicles was determined by flame photometry as described by Verkhovskaya et al. (1996)
. Na+-loaded cells were produced by diethanolamine treatment as described by Nakamura et al. (1982)
. All transport experiments were reproduced three to four times. The individual curves are presented.
| RESULTS |
|---|
|
|
|---|
We found that EIPA is a specific inhibitor of Na+ transport in E. coli. As shown in Fig. 1(a)
, Na+ efflux from wild-type E. coli was blocked by 100 µM EIPA. This inhibition takes place without affecting the rate of respiration or 
across the cell membrane (not shown). Since the enzyme generally believed to be the main Na+ transport system in E. coli, NhaA, is not sensitive to EIPA (Padan & Schuldiner, 1996)
, these findings could be an indication that NHE-like proteins are involved in Na+ transport in E. coli. However, Na+ transport in the GRD22 double mutant showed the same sensitivity to EIPA as wild-type cells (Fig. 1b
). This shows that there must be a Na+ transporter in E. coli, which (1) is different from NhaA, since it is EIPA-sensitive, and (2) is not an NHE-like protein, since the activity was observed even after the genes for the only two such proteins in E. coli (yjcE and ycgO) were inactivated.
|
However, GRF55 was sensitive to low osmolarity. (GRN11 may also be sensitive but to a much smaller extent.) When GRF55 was inoculated into rich medium without added salt (TY), or into a synthetic low-salt glycerol medium (LSG), growth was observed for 23 h, but it then stopped completely, and no further growth was observed in the next 8 h (Fig. 2a
, b
). When LSG medium was initially supplemented with 50 mM KCl, 50 mM LiCl, 30 mM MgSO4 or 200 mM mannitol (but not sucrose), GRF55 grew at the wild-type rate (Fig. 2c
). Similar data were obtained with TY medium. However, when grown in TY supplemented with only 20 mM KCl or NaCl, growth stopped after three to four generations. Growth resumed after a delay, but only at a lower rate. Both the length of this pause and the growth rate thereafter were strictly dependent on salt concentration (shown for NaCl in Fig. 2d
). The double mutant (ycgO- yjcE-) showed the same phenotype as the ycgO- mutant; no additional effects of the yjcE interruption on growth were found.
|
Intracellular alkali cation levels and cation transport activity in GRF55 grown at low osmolarity
To analyse the capability of the GRF55 strain for alkali cation transport, a relatively low osmolarity (20 mM NaCl added to rich medium) was chosen for cell growth. The cells were collected when growth had recovered after the delay (see Fig. 2d
), loaded with Na+ and suspended in medium containing NaCl and buffer. Cation transport was initiated by the addition of 10 mM KCl. Under these conditions, transport of both K+ and Na+ was significantly lower in GRF55 than in the parent, GR70N, strain (Fig. 3a
). To exclude the possibility that the altered alkali cation transport in GRF55 was due to the mutant being more susceptible to cell damage during the Na+ loading procedure, 100 mM NaCl was added directly to the growth medium, and the intracellular alkali cation levels were followed. Fig. 3(b)
shows that exposing GRF55 cells to a high Na+ concentration caused a significant rise in intracellular Na+ content, in contrast to the case with the parent strain. Potassium accumulation due to osmotic up-shock was not altered. The observed increase in the intracellular Na+ level in GRF55 could be due to either lower Na+ efflux or higher Na+ influx in the mutant cells. To resolve this question, the intracellular Na+ content was measured in mutant cells in the absence of K+, under conditions where active Na+ efflux was impossible due to lack of a counterion. Fig. 3(c)
shows the change in intracellular alkali cation content in GRF55 and wild-type (GR70N) cells grown at low osmolarity and transferred to a medium containing 100 mM NaCl and 34 mM HEPES/NaOH, pH 7·5. In GRF55, the Na+ content increased rapidly, and became as high as K+, whereas in the parent strain the change was insignificant. This confirms that GRF55 has a higher Na+ permeability.
|
Lack of ycgO results in loss of intracellular K+ upon growth at low osmolarity
Cell protein and intracellular alkali cation content were measured during growth of GRF55 and wild-type (GR70N) cells in TY+20 mM NaCl (Fig. 4
). During the first 2·53·5 h, when growth of the two strains was identical, Na+ and K+ levels in the GRF55 cells parallelled those in GR70N. However, at some point the K+ content in GRF55 dropped and simultaneously Na+ began to accumulate until the content of the two cations was equal (Fig. 4
). Then growth of GRF55 halted abruptly, while GR70N continued to grow. No Na+ could be detected in GR70N cells during growth, while the intracellular K+ content initially increased and then gradually decreased. After some hours, cell growth in GRF55 recovered partially; K+ gradually accumulated and Na+ was expelled, but the ion gradients did not return to wild-type levels (Fig. 4
).
|
| DISCUSSION |
|---|
|
|
|---|
|
The loss of K was not due to non-specific inhibition of the K+ uptake systems, or the loss of the cell membrane integrity. During the growth delay, there was no visible indication of cell lysis or cell damage since the GRF55 cells retained the capability for K+ accumulation in response to osmotic up-shock (not shown). It seems reasonable that the ycgO gene product participates in a system that determines the amount of intracellular K+ that is required to keep the necessary free water volume normal at low osmolarity.
One may speculate that there are two systems for regulation of intracellular K+ in E. coli operating at low and high osmolarity, respectively. A decrease in osmolarity would cause a switch between these high and low systems, i.e. inhibition of the former and activation of the latter. If, as we suggest, the ycgO gene product is an essential part of the low system, this switch would result in total loss of cell volume control in GRF55 cells, leading to the pause in growth. This model would also explain why there is no difference between GRF55 and GR70N in growth at low osmolarity for the first few generations, since the high system would be functional in both strains. Partial recovery of growth and alkali cation gradients after the pause might be due to some reactivation of the high system; this effect would be more pronounced with increasing salt concentration in the medium.
Hence, we conclude that the ycgO gene product participates in cell volume regulation in E. coli growing at low osmolarity, and we therefore suggest renaming ycgO as cvrA.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Chambrey, R., Achard, J.-M. & Warnock, D. G. (1997). Heterologous expression of rat NHE4: a highly amiloride-resistant Na+/H+ exchanger isoform. Am J Physiol 272, C90-98.
Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16, 10881-10890.
Koch, A. L. (1990). Additional arguments for the key role of smart autolysins in the enlargement of the wall of gram-negative bacteria. Res Microbiol 141, 529-541.[Medline]
Koch, A. L. (2000). Length distribution of the peptidoglycan chains in the sacculus of Escherichia coli. J Theor Biol 204, 533-541.[Medline]
Link, A. J., Phillips, D. & Church, G. M. (1997). Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J Bacteriol 179, 6228-6237.
McLaggan, D., Naprstek, J., Buurman, E. T. & Epstein, W. (1994). Interdependence of K+ and glutamate accumulation during osmotic adaptation of Escherichia coli. J Biol Chem 269, 1911-1917.
Miller, V. L. & Mekalanos, J. J. (1988). A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 170, 2575-2583.
Nakamura, T., Tokuda, H. & Unemoto, T. (1982). Effect of pH and monovalent cations on the potassium ion exit from the marine bacterium, Vibrio alginolyticus, and the manipulation of cellular cation content. Biochim Biophys Acta 692, 389-396.
Nass, R., Cunningham, K. W. & Rao, R. (1997). Intracellular sequestration of sodium by a novel Na+/H+ exchanger in yeast is enhanced by mutations in the plasma membrane H+-ATPase. J Biol Chem 272, 26145-26152.
Norris, V. & Manners, B. (1993). Deformations in the cytoplasmic membrane of Escherichia coli direct the synthesis of peptidoglycan. Biophys J 64, 1691-1700.[Medline]
Orlowski, J. & Grinstein, S. (1997). Na+/H+ exchangers of mammalian cells. J Biol Chem 272, 22373-22376.
Padan, E. & Schuldiner, S. (1996). Bacterial Na+/H+ antiporters molecular biology, biochemistry, and physiology. In The Handbook of Biological Physics, vol. II, Transport Processes in Membranes , pp. 501-531. Edited by W. N. Konings, H. R. Kaback & J. Lolkema. Amsterdam:Elsevier.
Record, M. T.Jr, Courtenay, E. S., Cayley, D. S. & Guttman, H. J. (1998a). Responses of E. coli to osmotic stress: large changes in amount of cytoplasmic solutes and water. Trends Biochem Sci 23, 143-148.[Medline]
Record, M. T.Jr, Courtenay, E. S., Cayley, D. S. & Guttman, H. J. (1998b). Biophysical compensation mechanisms buffering E. coli protein-nucleic acid interactions against changing environments. Trends Biochem Sci 23, 190-194.[Medline]
Saier, M. H., Jr, Eng, B. H., Fard, S. & 15 other authors (1999). Phylogenetic characterization of novel transport protein families revealed by genome analyses. Biochim Biophys Acta 1422, 156.[Medline]
Silhavy, T., Berman, M. L. & Enquist, L. W. (1982). Experiments with Gene Fusions, pp. 107112. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Towle, D. W., Rushton, M. E., Heidysch, D., Magnani, J. J., Rose, M. J., Amstutz, A., Jordan, M. K., Shearer, D. W. & Wu, W. S. (1997). Sodium/proton antiporter in the euryhaline crab Carcinus maenas: molecular cloning, expression and tissue distribution. J Exp Biol 200, 1003-1014.[Abstract]
Verkhovskaya, M. L., Verkhovsky, M. I. & Wikström, M. (1996). K+-dependent Na+ transport driven by respiration in Escherichia coli cells and membrane vesicles. Biochim Biophys Acta 1273, 207-216.[Medline]
Verkhovskaya, M. L., Barquera, B., Verkhovsky, M. I. & Wikström, M. (1998). The Na+ and K+ transport deficiency of an E. coli mutant lacking the NhaA and NhaB proteins is apparent and caused by impaired osmoregulation. FEBS Lett 439, 271-274.[Medline]
Wakabayashi, S., Shigekawa, M. & Pouyssegur, J. (1997). Molecular physiology of vertebrate Na+/H+ exchangers. Physiol Rev 77, 51-74.
Received 10 April 2001;
revised 8 June 2001;
accepted 29 June 2001.
This article has been cited by other articles:
![]() |
M. Morino, S. Natsui, T. H. Swartz, T. A. Krulwich, and M. Ito Single Gene Deletions of mrpA to mrpG and mrpE Point Mutations Affect Activity of the Mrp Na+/H+ Antiporter of Alkaliphilic Bacillus and Formation of Hetero-Oligomeric Mrp Complexes J. Bacteriol., June 15, 2008; 190(12): 4162 - 4172. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wei, J. Liu, Y. Ma, and T. A. Krulwich Three putative cation/proton antiporters from the soda lake alkaliphile Alkalimonas amylolytica N10 complement an alkali-sensitive Escherichia coli mutant Microbiology, July 1, 2007; 153(7): 2168 - 2179. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Swartz, M. Ito, T. Ohira, S. Natsui, D. B. Hicks, and T. A. Krulwich Catalytic Properties of Staphylococcus aureus and Bacillus Members of the Secondary Cation/Proton Antiporter-3 (Mrp) Family Are Revealed by an Optimized Assay in an Escherichia coli Host J. Bacteriol., April 15, 2007; 189(8): 3081 - 3090. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |