|
|
||||||||
Systematics and Evolution |
Department of Biology1 and Department of Civil and Environmental Engineering2, Massachusetts Institute of Technology, Cambridge, MA 02139, USA
Author for correspondence: Sallie Chisholm. Tel: +1 617 253 1771. Fax: +1 617 258 7009. e-mail: chisholm{at}mit.edu
| ABSTRACT |
|---|
|
|
|---|
Keywords: cyanobacteria, light-harvesting complex, phycoerythrin, phylogeny, relative rates of evolution
Abbreviations: Chl, chlorophyll; PE, phycoerythrin
| INTRODUCTION |
|---|
|
|
|---|
Although Prochlorococcus and Synechococcus share close phylogenetic ties and several ecological and physiological characteristics, a fundamental difference exists between these genera in their photosynthetic light-harvesting apparatus. A major antenna of the latter consists of phycobiliproteins that are covalently bound to linear tetrapyrrole prosthetic groups and are organized into phycobilisomes (Bryant, 1991
). The phycobilisomes of marine cluster-A Synechococcus are phycoerythrin (PE)-rich, and two types of PE (I, II) have been identified that differ in their number of associated bilins (Ong & Glazer, 1991
; Wilbanks et al., 1991
). In contrast, the major antenna complex of Prochlorococcus is based on the pigments divinyl chlorophyll a (Chl a2) and divinyl and/or monovinyl chlorophyll b (Chl b2, Chl b) (Chisholm et al., 1992
; Goericke & Repeta, 1992
; LaRoche et al., 1996
; Partensky et al., 1997
). Its light-harvesting complex polypeptides (Pcb) are members of the Chl a-binding core complex family of antenna proteins, which includes CP43 and CP47 (LaRoche et al., 1996
; Partensky et al., 1997
).
Recently, genes encoding the
(cpeA) and ß (cpeB) subunits of PE were identified in Prochlorococcus sp. strain SS120 (CCMP1375) (Hess et al., 1996
). In SS120, both cpeB and cpeA are found in a gene cluster containing genes that are homologous to those encoding other phycobiliproteins (MpeC, CpeZ) and bilin biosynthesis proteins (Hess et al., 1999
). Although low levels of cpeB and cpeA expression have been detected in SS120 (Hess et al., 1996
, 1999
), the functional significance of PE in SS120 is unknown. PE genes have since been found in Prochlorococcus isolates PAC1 and PAC2 (Penno et al., 2000
), and we have also identified cpeB in the genome of Prochlorococcus MED4. This latter isolate is capable of growing at higher (>300 µmol photons m-2 s-1) irradiance levels than low-light-adapted Prochlorococcus isolates such as SS120, and is a member of the high-light-adapted clade (Urbach et al., 1998
; Moore et al., 1998
; Rocap, 2000
).
We have in our collection two low-light-adapted Prochlorococcus isolates, MIT9303 and MIT9313, which are the most deeply branching in the Prochlorococcus lineage (Moore et al., 1998
; Rocap, 2000
). In this unique phylogenetic position, their 16S rDNA sequences differ by approximately 23% from other isolates of both Prochlorococcus sp. and marine Synechococcus sp. In order to obtain a more complete understanding of the evolution of phycobiliproteins in Prochlorococcus, we sequenced the cpeB and cpeA genes of both MIT9303 and MIT9313. Our analyses suggest that within the Prochlorococcus lineage the selective forces shaping the evolution of the PE gene set have not been uniform. Furthermore, the PE gene sequence heterogeneity we document between Prochlorococcus and Synechococcus is consistent with a model of elevated mutation rates, rather than relaxed selection. Elucidating the rates and pathways of genetic change in this important phototroph may help in assessing its response to rapid environmental change.
| METHODS |
|---|
|
|
|---|
Genomic DNA isolation.
Genomic DNA was prepared from Prochlorococcus according to standard methods (Ausubel et al., 1995
) that were optimized for this bacterium (Rocap, 2000
). Briefly, cells were lysed in the presence of lysozyme, and DNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1, by vol.), precipitated with 2-propanol, and resolubilized in TE buffer (pH 7·6).
PCR amplification, cloning and sequencing.
Genes encoding the ß- (cpeB) and
- (cpeA) subunits of PE were amplified from Prochlorococcus genomic DNA by PCR. The primers, cpeB1.2 (ATGCTTGATGCATTCTCAAG) and cpeA 2.2 (AAGGCATTAATAAGGTAATC), were designed as exact matches to the SS120 cpeB 5'-end and cpeA 3'-end (Hess et al., 1996
). PCR samples contained 13 µg genomic DNA, 0·5 µM of each primer, 250 µM each dNTP, 03·5 mM MgCl2, cloned Pfu buffer (1x) (Stratagene), and 2·5 units Pfu DNA polymerase (Stratagene). Cycle parameters were 94 °C for 1 min, 50 °C for 1 min and 72 °C for 2 min. Samples were processed for 30 or 40 cycles prior to a final extension at 72 °C for 10 min.
PCR products were separated on 1·5% agarose gels and visualized by UV fluorescence after staining with ethidium bromide. Selected PCR products of
1000 bp were purified from agarose gels using the QIAEXII Kit (QIAGEN), and then ligated to the pCR-Script Amp SK(+) Cloning Vector (PCR-Script Amp Cloning Kit, Stratagene). Vectors containing this insert were used to transform Escherichia coli (Epicurian Coli XL 10-Gold Kan ultracompetent cells, Stratagene). Size-selected clones were sequenced and final cpeB and cpeA sequences were obtained from three clones for MIT9303 and two clones for MIT9313. Plasmids were sequenced using M13 forward and reverse primers in our laboratory using SequiTherm LongRead Cycle Sequencing Kits on LI-COR model 4000L sequencers or by the MITCCR HHMI Biopolymers Laboratory.
Phylogenetic analysis.
Sequences used in comparisons were obtained from GenBank and from the complete MED4 genome (http://spider.jgi-psf.org/JGI_microbial/html/). All analyses utilized cpeB sequences minus the first 20 nucleotides (5' primer region) and cpeA minus the last 24 nucleotides (3' primer region). Data and alignments for 16S rDNA analyses were downloaded directly from the Ribosomal Database Project (RDP) (Maidak et al., 2000
).
PE protein sequences were aligned using the CLUSTAL W program with the BLOSUM matrix (Thompson et al., 1994
). Gaps were included to optimize the alignments. Only unambiguously aligned positions were used in the phylogenetic analyses (146 amino acids for
-PE, 159 amino acids for ß-PE). The percentage identities summarized in Table 1
were calculated from uncorrected distances. Total G+C base content ratios were calculated using GeneMark (Borodovsky & McIninch, 1993
). MEGA version 2.0 (Kumar et al., 2001
) was used to calculate the number of synonymous and nonsynonymous substitutions using both the original and modified NeiGojobori method (R=1·28 for cpeB, R=1·35 for cpeA) (Nei & Gojobori, 1986
; Ina, 1995
; Nei & Kumar, 2000
; Kumar et al., 2001
). The numbers of synonymous and nonsynonymous differences were compared using p-distances, where the number of synonymous differences was normalized to the number of synonymous sites, and the number of nonsynonymous differences was normalized to the number of nonsynonymous sites. Conclusions drawn from the original and modified NeiGojobori analyses were the same, and only the results of the latter analyses have been reported. Nonparametric relative rate tests were conducted in MEGA version 2.0 (Kumar et al., 2001
) using Tajimas general method (Tajima, 1993
), with one degree of freedom and a significance level of 5%.
|
PAUP* version 4.0 beta 2a (Swofford, 1999
) was used for all nucleotide analyses. Percentage identities reported in Table 6
were calculated from uncorrected distances. Distance trees were inferred using minimum evolution as the objective criterion and paralinear (logdet) distances, which are relatively insensitive to differences in G+C content (Lake, 1994
). Nucleotide maximum-likelihood analyses were done via the HKY85 model of nucleotide substitution with rate heterogeneity and empirical nucleotide frequencies. Bootstrap analyses (100 resamplings for maximum-likelihood, 1000 for distance and maximum-parsimony) were performed with heuristic searches utilizing random addition and tree-bisection reconnection branch-swapping methods. Phylogenetic trees were displayed using TREEVIEW (Page, 1996
).
|
| RESULTS |
|---|
|
|
|---|
1000 bp) (Fig. 1
- and ß-subunits of PE from the genomic DNA of MIT9303 and MIT9313. Separation of the MIT9303 PCR products on an agarose gel revealed a single major DNA fragment of
1000 bp (Fig. 1
1000 bp DNA fragments from the two isolates identified them as putative cpeA and cpeB genes. Using these gene and derived amino acid sequences, as well as those from SS120 (Hess et al., 1996
|
The number of synonymous (Ks) and nonsynonymous (Ka) differences for cpeB and cpeA of Prochlorococcus as well as other cyanobacteria, and the Ka/Ks ratios, are reported in Tables 2
and 3
, respectively. For both cpeB and cpeA, Ka/Ks values were not elevated within the Prochlorococcus genus relative to marine Synechococcus (Table 3
). Comparisons between the different genera, as well as between specific strains, indicated that the range of Ka/Ks ratios was comparable (Table 3
). Interestingly, while Ka/Ks was consistently greater than one for cpeB, Ka/Ks was less than one for cpeA, suggesting that the functional constraints on the evolution of these genes are different.
|
|
C). Similar nucleotide frequency biases towards T (T >A>C or G) have been reported previously for psbB and petB/D genes of several Prochlorococcus isolates, including SS120 and NATL2A (Urbach et al., 1998
|
-PE amino acid sequences
41%) of sequence identity with the ß-PE sequences of the other isolates (Table 1
-PE sequences of Prochlorococcus (Table 1
Both the derived ß-PE sequences and
-PE sequences exhibited 99% amino acid identity between MIT9303 and MIT9313 (Table 1
). While the single amino acid residue difference between ß-PE of MIT9303 and MIT9313 involved the conserved substitution of Asp-144 (MIT9303) and Asn-144 (MIT9313), the single residue difference between
-PE involved the semi-conserved substitution of Ala-29 (MIT9303) and Val-29 (MIT9313).
Within the Prochlorococcus lineage, relative rate tests for ß- and
-PE revealed that mutations in these sequences appear to be accumulating at approximately the same rate for low-light-adapted strains such as MIT9303 and SS120 (
2 was not significant at the 5% level) (Table 5
). However, the rate at which the ß-PE sequence is evolving in MED4 is not the same as that in MIT9303 or SS120. Instead, relative rate tests suggested an elevated rate of evolution for the high-light-adapted MED4 sequence (Table 5
).
|
Identification of putative functional residues
Alignments of the derived amino acid sequences of the ß-PE subunit of MIT9303 and MIT9313 indicated that many residues known for their functional importance in the ß-PE subunits of other organisms (Apt et al., 1995
) were conserved in all of the Prochlorococcus sequences, excluding MED4 (Fig. 2a
, b
). These included residues that serve as putative chromophore attachment sites (Cys-50, Cys-61, Cys-82, Cys-162), function in chromophore interaction and stabilization (Arg-77, Arg-78, Ala-80/81, Arg-84, Asp-85), and have a role in subunit interactions (Asp-13, Arg-91, Tyr-92, Tyr-95, Arg-108) (Apt et al., 1995
). In contrast, the MED4 ß-PE sequence lacked several of these highly conserved residues, including Cys-50(43), Cys-162(155), Ala-80(73)/81(74) and Tyr-92(85) (Fig. 2a
).
|
-PE sequences indicated that several residues important in chromophore attachment or protein interactions were also conserved in this subunit (Fig. 2b
-PE sequences of any other Prochlorococcus isolate (Fig. 2b
Phylogenetic analyses
Phylogenetic trees constructed using protein sequences deduced from cpeB and cpeA genes (Fig. 3a
, b
) revealed that the position of the Prochlorococcus cluster relative to marine Synechococcus was not congruent with 16S rDNA based phylogenetic groupings (Fig. 4![]()
). Prochlorococcus ß-PE and
-PE sequences did not group with either type I or type II ß-PE and
-PE sequences from marine Synechococcus (Fig. 3a
, b
). However, within the Prochlorococcus limb, the clustering of isolates based on both ß- and
-PE sequences was consistent with their positions in the 16S rDNA-based tree. As in ribosomal trees, MIT9303 and MIT9313 are very closely related (Table 6
, Fig. 4
) and form the basal branch of the Prochlorococcus clade. Similar tree topologies and levels of support were obtained in trees rooted using phycocyanin sequences and in trees constructed using cpeB and cpeA nucleotide sequences (both all positions and only the first two codon positions) (data not shown). The MED4 ß-PE sequence was not included in the tree (Fig. 3a
) because it is highly degenerate and shared low sequence identity (
36%) with other cyanobacterial and red algal ß-PEs (Table 1
). This resulted in its branch length being five times longer than any of the others in the tree. In phylogenetic trees, the placement of such long branches is often at odds with true evolutionary position (Swofford et al., 1996
).
|
|
| DISCUSSION |
|---|
|
|
|---|
Our sequence analyses suggest that within the Prochlorococcus lineage, the selective forces shaping the evolution of the PE gene set have not been uniform. Notably, this is apparent in the unique loss of the gene encoding the
-PE subunit in the MED4 strain compared to more deeply branching isolates such as MIT9303 and MIT9313. Loss of PE genes has been suggested to have occurred in other cyanobacterial lines (Apt et al., 1995
). MIT9303 and MIT9313 have the highest degree of 16S rDNA sequence similarity to marine Synechococcus relative to other cultured Prochlorococcus isolates (Table 6
), and only they have retained a highly conserved putative chromophore binding site (Cys-130) in their
-PE subunit. Furthermore, relative rate tests suggest that mutations have not accumulated at an equivalent rate in the ß-PE sequences of Prochlorococcus. In MED4, the presence of a degenerate form of ß-PE, characterized by several point mutations and deletions at highly conserved sites, is consistent with an elevated rate of evolution. In addition, the ratios of nonsynonymous (Ka) to synonymous (Ks) substitutions were not elevated in MED4 relative to other Prochlorococcus or Synechococcus strains. Thus, even though MED4 lacks the gene encoding the
-PE subunit, these results suggest that its cpeB gene is still under selection, although likely a different type of selection than in other Prochlorococcus strains. As a high-light-adapted strain of Prochlorococcus, MED4 is thought to have arisen more recently than its low-light-adapted counterparts (e.g. MIT9303, MIT9313, SS120, PAC1) (Urbach et al., 1998
; Rocap, 2000
), and thus could have been subjected to different selective pressures (i.e. light and/or nutrient availability), leading to dissimilar genetic recombination and/or deletion events.
Although cpeB and/or cpeA expression has been detected in SS120 (Hess et al., 1996
, 1999
), and in MIT9303 and MIT9313 (C. Ting, unpublished results), the exact role of PE in the Prochlorococcus genus remains to be established. PE is clearly not the major constituent of the light-harvesting apparatus in any extant Prochlorococcus strain (Chisholm et al., 1992
; Goericke & Repeta, 1992
; LaRoche et al., 1996
; Partensky et al., 1997
), as it is in Synechococcus (Ong & Glazer, 1991
; Wilbanks et al., 1991
). In SS120, the PE genes are part of a larger cluster, within which other phycobiliprotein-related genes (cpeZ, cpeY, mpeX, ppeC) can be found (Hess et al., 1999
). But there is no evidence that PE forms part of a cyanobacterial-like phycobilisome structure in Prochlorococcus (Chisholm et al., 1988
; Fields et al., 1997
; C. S. Ting and others, unpublished). It remains to be explored whether the phycobiliproteins of Prochlorococcus are located within the intracytoplasmic lamellar space, as in cryptophytes (Gantt et al., 1971
).
Our phylogenetic analyses based on PE sequences show that the position of the Prochlorococcus cluster relative to Synechococcus was not congruent with 16S rDNA-based trees. Additional analyses indicated that the ratios of nonsynonymous (Ka) to synonymous (Ks) substitutions for the cpeB and cpeA genes were not elevated in Prochlorococcus relative to Synechococcus. Instead, Ka/Ks ratios were similar between these genera. This suggests that the sequence differences we observed may be due to elevated mutation rates rather than relaxed selection. This is consistent with the results of relative rate tests between Prochlorococcus ß/
-PE and Synechococcus ß/
-PE (I) sequences. Thus although PE has a different function in Prochlorococcus, these results suggest that the cpeB and cpeA genes are still under selection, albeit a different type of selection than in Synechococcus.
Future work on the role of PE in Prochlorococcus may help to identify whether this protein confers a biological advantage under specific environmental conditions. However, with the change in selection on the PE genes we have observed within the Prochlorococcus lineage, it is unlikely that the function of PE will be conserved among all strains. Comparisons between Prochlorococcus and Synechococcus provide a striking example of how the evolution of a key protein complex, the light-harvesting antenna system, has proceeded along very different paths in two globally important marine prokaryotes.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1995). Short Protocols in Molecular Biology, 3rd edn. New York: Wiley.
Borodovsky, M. & McIninch, J. (1993). GeneMark: parallel gene recognition for both DNA strands. Comp Chem 17, 123-133.
Bryant, D. A. (1991). Cyanobacterial phycobilisomes: progress toward complete structural and functional analysis via molecular genetics In The Photosynthetic Apparatus: Molecular Biology and Operation , pp. 257-300. Edited by L. Bogorad & K. Vasil. Boston, MA:Academic Press.
Chisholm, S. W., Olson, R. J., Zettler, E. R., Waterbury, J., Goericke, R. & Welschmeyer, N. (1988). A novel free-living prochlorophyte occurs at high cell concentrations in the oceanic euphotic zone. Nature 334, 340-343.
Chisholm, S. W., Frankel, S. L., Goericke, R., Olson, R. J., Palenik, B., Waterbury, J. B., West-Johnsrud, L. & Zettler, E. (1992). Prochlorococcus marinus nov. gen. nov. sp.: an oxyphototrophic marine prokaryote containing divinyl chlorophyll a and b. Arch Microbiol 157, 297-300.
Felsenstein, J. (1989). PHYLIP phylogeny inference package (version 3.2). Cladistics 5, 164-166.
Fields, S. D., Strout, G. W. & Russell, S. D. (1997). Spray-freezing and freeze substitution (SFFS) of cell suspensions for improved preservation of ultrastructure. Microsc Res Tech 38, 315-328.[Medline]
Gantt, E., Edwards, M. R. & Provasoli, L. (1971). Chloroplast structure of the Cryptophyceae. Evidence for phycobiliproteins within intrathylakoidal spaces. J Cell Biol 48, 280-290.
Goericke, R. & Repeta, D. J. (1992). The pigments of Prochlorococcus marinus: the presence of divinyl chlorophyll a and b in a marine procaryote. Limnol Oceanogr 37, 425-433.
Hess, W. R., Weihe, A., Loiseaux-de Goer, S., Partensky, F. & Vaulot, D. (1995). Characterization of the single psbA gene of Prochlorococcus marinus CCMP 1375 (Prochlorophyta). Plant Mol Biol 27, 1189-1196.[Medline]
Hess, W. R., Partensky, F., van der Staay, G. W. M., Garcia-Fernandez, J. M., Borner, T. & Vaulot, D. (1996). Coexistence of phycoerythrin and a chlorophyll a/b antenna in a marine prokaryote. Proc Natl Acad Sci USA 93, 11126-11130.
Hess, W. R., Steglich, C., Lichtle, C. & Partensky, F. (1999). The phycoerythrins of Prochlorococcus marinus are associated to the thylakoid membrane and are encoded by a single large gene cluster. Plant Mol Biol 40, 507-521.[Medline]
Ina, Y. (1995). New methods for estimating the numbers of synonymous and nonsynonymous substitutions. J Mol Evol 40, 190-226.[Medline]
Kumar, S., Tamura, K., Jakobsen, I. B. & Nei, M. (2001). MEGA2: molecular evolutionary genetics analysis software. Bioinformatics (in press).
Lake, J. A. (1994). Reconstructing evolutionary trees from DNA and protein sequences: paralinear distances. Proc Natl Acad Sci USA 91, 1455-1459.
LaRoche, J., van der Staay, G. W. M., Partensky, F. & 8 other authors (1996). Independent evolution of the prochlorophyte and green plant chlorophyll a/b light-harvesting proteins. Proc Natl Acad Sci USA 93, 1524415248.
Maidak, B. L., Cole, J. R., Lilburn, T. G. & 12 other authors (2000). The RDP (Ribosomal Database Project) continues. Nucleic Acids Res 28, 173174.
Moore, L. R. & Chisholm, S. W. (1999). Photophysiology of the marine cyanobacterium Prochlorococcus: ecotypic differences among cultured isolates. Limnol Oceanogr 44, 628-638.
Moore, L. R., Rocap, G. & Chisholm, S. W. (1998). Physiology and molecular phylogeny of coexisting Prochlorococcus ecotypes. Nature 393, 464-467.[Medline]
Nei, M. & Gojobori, T. (1986). Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol 3, 418-426.[Abstract]
Nei, M. & Kumar, S. (2000). Molecular Evolution and Phylogenetics. New York: Oxford University Press.
Ong, L. J. & Glazer, A. N. (1991). Phycoerythrins of marine unicellular cyanobacteria. I. Bilin types and locations and energy transfer pathways in Synechococcus spp. phycoerythrins. J Biol Chem 266, 9515-9527.
Page, R. D. M. (1996). TREEVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12, 357-358.
Palenik, B. & Haselkorn, R. (1992). Multiple evolutionary origins of prochlorophytes, the chlorophyll b-containing prokaryotes. Nature 355, 265-267.[Medline]
Partensky, F., LaRoche, J., Wyman, K. & Falkowski, P. G. (1997). The divinyl-chlorophyll a/bprotein complexes of two strains of the oxyphototrophic marine prokaryote Prochlorococcus characterization and response to changes in growth irradiance. Photosynth Res 51, 209-222.
Partensky, F., Hess, W. R. & Vaulot, D. (1999). Prochlorococcus, a marine photosynthetic prokaryote of global significance. Microbiol Mol Biol Rev 63, 106-127.
Penno, S., Campbell, L. & Hess, W. R. (2000). Presence of phycoerythrin in two strains of Prochlorococcus (cyanobacteria) isolated from the subtropical north Pacific ocean. J Phycol 36, 723-729.
Rocap, G. (2000). Phylogenetic diversity and ecotypic differentiation in the marine cyanobacteria Prochlorococcus and Synechococcus. PhD thesis, Massachusetts Institute of Technology, Cambridge, MA.
Strimmer, K. & von Haeseler, A. (1996). Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol Biol Evol 13, 964-969.
Swofford, D. L. (1999). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sunderland, MA: Sinauer Associates.
Swofford, D. L., Olsen, G. J., Wadell, P. J. & Hillis, D. M. (1996). Phylogenetic inference In Molecular Systematics , pp. 407-415. Edited by D. M. Hillis, C. Moritz & B. K. Mable. Sunderland, MA:Sinauer Associates.
Tajima, F. (1993). Simple methods for testing molecular clock hypothesis. Genetics 135, 599-607.[Abstract]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680.
Ting, C., Rocap, G., King, J. & Chisholm, S. W. (1999). Characterization of phycoerythrin genes in the chlorophyll a2/b2-containing prokaryote, Prochlorococcus sp. MIT9303 In Photosynthesis: Mechanisms and Effects , pp. 225-228. Edited by G. Garab. Dordrecht:Kluwer.
Urbach, E., Robertson, D. L. & Chisholm, S. W. (1992). Multiple evolutionary origins of prochlorophytes within the cyanobacterial radiation. Nature 355, 267-269.[Medline]
Urbach, E., Scanlan, D. J., Distel, D. L., Waterbury, J. B. & Chisholm, S. W. (1998). Rapid diversification of marine picoplankton with dissimilar light harvesting structures inferred from sequences of Prochlorococcus and Synechococcus (cyanobacteria). J Mol Evol 46, 188-201.[Medline]
Wilbanks, S. M., de Lorimier, R. & Glazer, A. N. (1991). Phycoerythrins of marine unicellular cyanobacteria. III. Sequence of a class II phycoerythrin. J Biol Chem 266, 9535-9539.
Received 7 December 2000;
revised 10 June 2001;
accepted 9 July 2001.
This article has been cited by other articles:
![]() |
D. J. Scanlan, M. Ostrowski, S. Mazard, A. Dufresne, L. Garczarek, W. R. Hess, A. F. Post, M. Hagemann, I. Paulsen, and F. Partensky Ecological Genomics of Marine Picocyanobacteria Microbiol. Mol. Biol. Rev., June 1, 2009; 73(2): 249 - 299. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |