Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 147 (2001), 851-860
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adams, M. M.
Right arrow Articles by Verma, N. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adams, M. M.
Right arrow Articles by Verma, N. K.
Agricola
Right arrow Articles by Adams, M. M.
Right arrow Articles by Verma, N. K.
Microbiology (2001), 147, 851-860.
© 2001 Society for General Microbiology


Genetics and Molecular Biology

Type IV O antigen modification genes in the genome of Shigella flexneri NCTC 8296

Mathew M. Adams1, Gwen E. Allison1 and Naresh K. Verma1

Division of Biochemistry and Molecular Biology, School of Life Sciences, Faculty of Science, The Australian National University, Canberra, ACT 0200, Australia1

Author for correspondence: Naresh K. Verma. Tel: +61 2 6125 2666. Fax: +61 2 6125 0313. e-mail: Naresh.Verma{at}anu.edu.au


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The genes encoding type IV O antigen glucosylation were characterized from both Escherichia coli and Shigella flexneri. The putative O antigen modification genes from E. coli, o120 o306 o443, were PCR-amplified and introduced into S. flexneri serotype Y strain SFL124. Immunogold labelling and phage sensitivity indicated the presence of both serotype Y and serotype 4a O antigens on the cell surface of the resulting recombinant SFL124 strains, suggesting that only partial serotype conversion was conferred by the E. coli genes. The type IV O antigen modification genes were then isolated and characterized from S. flexneri serotype 4a strain NCTC 8296. A 3·8 kb chromosomal fragment conferred complete conversion to serotype 4a when introduced into SFL124. Sequence analysis of the fragment revealed the presence of three genes, gtrAIV gtrBIV gtrIVSf. DNAs homologous to bacteriophage int and attP were located upstream of gtrAIV, suggesting that this region of the NCTC 8296 genome may have originated from a bacteriophage; however, a serotype-converting phage could not be induced from this strain nor from other strains used in this study. Comparison of the GtrIVSf and GtrIVEc (o443) proteins revealed that they are 41% identical and 63% similar, which is the highest degree of similarity reported among the S. flexneri O antigen glucosyltransferases.

Keywords: bacteriophage, serotype conversion, lipopolysaccharide, glucosyltransferase

The GenBank accession number for the sequence reported in this paper is AF288197.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Shigella flexneri is the main cause of bacillary dysentery in developing countries (Kotloff et al., 1999Down ). Annually, there are estimated to be 164·7 million cases of shigellosis worldwide. The majority of cases (163·2 million) occur in developing countries and result in 1·1 million fatalities, which largely occur in children under 5 years of age (Kotloff et al., 1999Down ). The poor sanitary conditions prevalent in these areas contribute to the spread of the bacteria, and the expense of antibiotics and increasing antibiotic resistance complicate treatment. Consequently, the development of a vaccine against Shigella has become a priority of the World Health Organization (Kotloff et al., 1999Down ).

Infection with S. flexneri results in serotype-specific immunity (Phalipon et al., 1995Down ). There are 13 different serotypes of S. flexneri, which differ in the nature of the O antigen component of the outer-membrane lipopolysaccharide. S. flexneri O antigens, except for serotype 6, have the same basic repeating tetrasaccharide unit, comprised of N-acetylglucosamine attached to three rhamnose units (Simmons & Romanowska, 1987Down ). The basic O antigen structure is referred to as serotype Y (Simmons & Romanowska, 1987Down ) (Fig. 1Down). The addition of glucosyl and/or O-acetyl residues to the basic O antigen results in type- (i.e. I, II, III, IV, V) and group- (i.e. 3,4; 7,8; 6) specific antigenic determinants. The addition of an O-acetyl residue occurs only on rhamnose III of the basic tetrasaccharide unit, and confers group 6 O antigen modification. Acetylation is mediated by an O-acetyltransferase which is encoded by bacteriophage Sf6 (Clark et al., 1991Down ; Verma et al., 1991Down ). Glucosylation of the O antigen can occur on any of the residues in the tetrasaccharide unit and can vary in the nature of the linkage. The genes responsible for O antigen glucosylation of type I, II and V and group 7,8 serotypes have been identified (Adhikari et al., 1999Down ; Bastin et al., 1997Down ; Guan et al., 1999Down ; Guan & Verma, 1998Down ; Huan et al., 1997aDown , bDown ; Mavris et al., 1997Down ; Verma et al., 1993Down ). In all cases, the factors required for serotype conversion or O antigen modification are encoded by temperate or cryptic bacteriophages. The organization of the genes encoding glucosylation is conserved (reviewed by Allison & Verma, 2000Down ): the first two genes, designated gtrAtype and gtrBtype, are highly homologous and interchangeable whereas the third gene, referred to as gtr(type), is unique and encodes the serotype-specific glucosyltransferase. In the phage genome, the glucosylation genes are typically located downstream of the integrase gene and attP site, which mediates integration of the phage into the prolac region of the host genome (Adhikari et al., 1999Down ; Guan & Verma, 1998Down ; Petrovskaya & Licheva, 1982Down ). The genes involved in O antigen modification are of interest because of their potential application in the development of S. flexneri vaccine strains expressing specific and, potentially, multiple serotypes (Guan & Verma, 1998Down ; Huan et al., 1995Down ; Verma et al., 1991Down ).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Structure of the O antigen in S. flexneri serotypes Y, 4a and 4b and E. coli K-12. The nature of the linkages between the sugars, and the D and L enantiomers of the sugars, are indicated. The type- and group-specific antigens of the different serotypes are designated by roman and arabic numerals, respectively. Sugars involved in the tetrasaccharide repeats are indicated as follows: GlcNAc, N-acetylglucosamine; Rha, rhamnose; Glc, glucose; and Gal, galactose. Residues involved in O antigen modification in S. flexneri and E. coli are represented as follows: {circ}, glucosyl; and {square}, O-acetyl.

 
The factors involved in type IV glucosylation are the only O antigen modification genes of S. flexneri that remain to be characterized. The type IV determinant of serotypes 4a and 4b consists of the addition of a glucosyl residue through an {alpha}1,6 linkage to the N-acetylglucosamine of the basic O antigen tetrasaccharide repeat (Simmons & Romanowska, 1987Down ) (Fig. 1Up). We report on the analysis of the putative type IV O antigen modification genes from Escherichia coli, which mediate only partial O antigen modification in S. flexneri serotype Y strain SFL124, and on the isolation and characterization of the type IV O antigen modification genes from S. flexneri serotype 4a strain NCTC 8296, which are capable of conferring complete O antigen modification in SFL124.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacteria, phage and plasmids.
The bacterial strains and plasmids used in this study are listed in Table 1Down. E. coli JM109 was used for routine transformation and plasmid propagation, and S. flexneri SFL124 was used in serotype conversion experiments. Luria–Bertani broth and agar (Sambrook et al., 1989Down ) were used for routine propagation and cultures were grown in a 37 °C incubator or orbital shaker. When necessary, media were supplemented with 100 µg ampicillin ml-1.


View this table:
[in this window]
[in a new window]
 
Table 1. Strains and plasmids used in this study

 
Bacteriophage {phi}9725 was induced from S. flexneri NCTC 9725 using the UV irradiation protocol described by Huan et al. (1997aDown ) with the following modifications: bacterial cultures suspended in MgSO4 were exposed to a Philips UV germicidal lamp at a distance of 15 cm for 30–90 s; and after UV exposure, the culture was diluted in 15 ml LB, protected from light, and incubated for 24 h in an orbital shaker. SFL124 was used as the phage-sensitive host for propagation of the bacteriophage. Phage purification and DNA extraction were performed as described for phage {lambda} (Sambrook et al., 1989Down ). Sensitivity of recombinant strains to bacteriophage SfV was conducted using standard protocols (Sambrook et al., 1989Down ). When necessary, colony agglutination was conducted using group- and type-specific antisera according to the manufacturer’s instructions (Denka Seiken, Oxoid).

DNA techniques.
Plasmid DNA was routinely prepared by alkaline lysis (Sambrook et al., 1989Down ). The BRESAClean DNA Purification Kit (Geneworks) was used to further purify plasmid DNA when required and was also used to gel-purify DNA fragments. Chromosomal DNA was prepared using the procedure outlined by Bastin et al. (1997)Down . Restriction enzymes were used according to the manufacturers’ directions (Progen and Amersham Pharmacia).

Purified DNA was sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit in a GeneAmp 2400 thermal cycler (Perkin Elmer) according to the manufacturer’s protocol. Sequencing was carried out on an ABI Prism 377 Automated Sequencer at the Biomolecular Resource Facility in the John Curtin School of Medical Research, The Australian National University. Sequence analysis was performed using the GCG group of programs (University of Wisconsin) available through the Australian National Genomic Information System.

DNA for Southern hybridization was digested with the appropriate restriction enzymes and subjected to electrophoresis on a 0·6% agarose gel. The alkali blot method was used to transfer DNA onto Hybond-N+ membrane (Amersham Pharmacia) using the manufacturer’s protocol. The Gigaprime DNA Labelling Kit (Geneworks) was used to label probe DNA with [{alpha}-32P]dCTP (Amersham Pharmacia). The DNA for the probes was prepared as follows: the 524 bp EcoRI fragment of pNV734 was used for the gtrAEc probe; the 957 bp EcoRV fragment of pNV677 [pBluescript containing the gtrAX and gtrBX genes of SfX (Guan et al., 1999Down )] provided the gtrBX probe; and the 1527 bp EcoRI fragment of pNV734 provided the gtrIVEc probe. Southern hybridization was performed as outlined in Sambrook et al. (1989)Down . The membrane was washed twice with 2xSSPE containing 0·1% SDS at 45 °C, and once with 1xSSPE containing 0·1% SDS at 65 °C.

For colony hybridization, overnight colonies were transferred and fixed to a sterile nitrocellulose filter (MSI) using the manufacturer’s protocols, and screened as described elsewhere (Sambrook et al., 1989Down ).

PCR.
Colony PCR (Schuch & Maurelli, 1997Down ) was used to amplify the putative serotype 4a O antigen modification genes (o120 o306 o443) from the E. coli K-12 genome using primers based on sequence accession number AE000323 (Blattner et al., 1997Down ): forward primer, TAATGGTACCACAGCAAGTATCGAT (nt 7253–7270); and reverse primer, TTAGGATCCCGCAATTCTATCAGGAG (complementary to nt 10012–10029). KpnI and BamHI restriction sites introduced into the primers are underlined. The PCR reaction conditions were 94 °C for 5 min followed by 30 cycles of 94 °C for 30 s, 50 °C for 30 s, and 65 °C for 4 min. PCR products were cloned directly into the pGEM-T Easy TA cloning vector (Promega).

Immunogold labelling and electron microscopy.
Immunogold labelling was conducted as described by Huan et al. (1997b)Down with the following modifications: the primary antibodies, MASF Y-5 (serotype-Y-specific) and MASF IV-2 (serotype-4a- and -4b-specific), both kindly supplied by Nils Carlin (Carlin & Lindberg, 1987Down ), were diluted 1:50 in PBS containing 0·4% BSA (PBS-BSA); and the secondary antibodies, goat anti-mouse IgM conjugated to 10 nm gold particles (MASF Y-5) and goat anti-mouse IgG conjugated to 20 nm gold particles (MASF IV-2) (British Biocell International), were diluted 1:9 in PBS-BSA. The samples were viewed under a Joel 2000X transmission electron microscope at 80 kV.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Characterization of the putative type IV O antigen modification genes in E. coli
Functional and genomic data suggested that the type IV O antigen modification genes were present in the E. coli genome. Morona et al. (1995)Down reported that introduction of the S. flexneri rfb locus, which encodes the synthesis of the basic O antigen tetrasaccharide unit, into E. coli DH1 resulted in a recombinant E. coli strain expressing O antigen that reacted with anti-type IV serum. Analysis of the E. coli K-12 genome sequence (Blattner et al., 1997Down ) revealed that homologues of the conserved gtrA and gtrB genes, o120 and o306, respectively, were found in section 213 (accession no. AE000323) (Mavris et al., 1997Down ). A third gene located immediately downstream of o306, o443, encoded a protein that showed limited homology to GtrII (Mavris et al., 1997Down ). The organization of the three genes is similar to that of other S. flexneri O antigen glucosylation loci (Mavris et al., 1997Down ).

Based on these data, Allison & Verma (2000)Down renamed the E. coli o120 o306 o443 genes gtrAEc gtrBEc gtrIVEc, consistent with the newly proposed nomenclature system. To determine if these E. coli genes were capable of mediating serotype conversion in S. flexneri, the gtrAEc gtrBEc gtrIVEc genes were amplified from E. coli DH1 by colony PCR. The 2·78 kb PCR product was ligated directly into pGEM-T Easy and transformed into E. coli JM109. Plasmid DNA from three transformants, B831, B832 and B833, was subjected to restriction analysis and the corresponding plasmids, pNV734, pNV735 and pNV736, respectively, were found to contain the correct 2·78 kb fragment. The gtrAEc gtrBEc gtrIVEc genes were in the correct orientation to the lac promoter of the vector in pNV736, whereas the genes in pNV734 and pNV735 were in the opposite orientation.

Plasmids pNV734, pNV735 and pNV736 were transformed into serotype Y strain SFL124 to create recombinant strains SFL1258, SFL1259 and SFL1260, respectively. All three recombinant strains, SFL124 and NCTC 8296 (serotype 4a) were analysed by immunogold labelling with monoclonal antibodies MASF Y-5 (serotype-Y-specific) and MASF IV-2 (type-IV-specific) as the MASF antibodies have been shown to be serotype-specific when used in immunogold labelling and Western blots (Adhikari et al., 1999Down ; Guan et al., 1999Down ; Huan et al., 1997aDown , bDown ). The O antigen of the control strains SFL124 and NCTC 8296 was only recognized by MASF Y-5 and MASF IV-2, respectively (Fig. 2Down). The O antigen of recombinant strains SFL1258, SFL1259 and SFL1260, however, was recognized by MASF IV-2 and MASF Y-5 antibodies, indicating the presence of both serotype Y and type IV antigens on the surface of the bacteria (the results for SFL1258 are shown in Fig. 2Down). The degree of O antigen modification was confirmed by analysing bacteriophage sensitivity. Bacteriophage SfV is a serotype-converting bacteriophage (Huan et al., 1997aDown , bDown ). While serotype Y strain SFL124, and strains partially converted to serotype 5a, are sensitive to SfV, recombinant strains of SFL124 which are completely converted to serotype 5a are resistant to SfV infection (Huan et al., 1997aDown , bDown ). Similar results were obtained with complete and partial conversion to serotype 4a. While NCTC 8296 was resistant to infection by SfV, SFL1258 and SFL1260 remained sensitive (only 10-fold less sensitive than control strain SFL1257; data not shown). Taken collectively, the immunogold and phage sensitivity data confirm the partial serotype conversion of SFL1258, SFL1259 and SFL1260.



View larger version (82K):
[in this window]
[in a new window]
 
Fig. 2. Immunogold labelling of SFL124 (a, b) and NCTC 8296 (c, d) and recombinant strains SFL1258 (e, f) (containing the E. coli gtrAEc gtrBEc gtrIVEc genes) and SFL1265 (g, h) (containing the BamHI chromosomal fragment from NCTC 8296). MASF Y-5 was the primary antibody used in (a), (c), (e) and (g); MASF IV-2 was the primary antibody used in (b), (d), (f) and (h). The presence of gold particles (10 nm) represents the expression of serotype Y O antigen on the cell surface of SFL124 (a) and SFL1258 (e). The presence of gold particles (20 nm) represents the expression of type IV antigen on the cell surface of NCTC 8296 (d), SFL1258 (f) and SFL1265 (h). Bars, 200, 250 or 500 nm as indicated.

 
The phenomenon of expressing dual serotypes, referred to as partial serotype conversion, on the surface of recombinant SFL124 has been observed previously (Adhikari et al., 1999Down ; Guan et al., 1999Down ; Huan et al., 1995Down , 1997aDown , bDown ). When only the serotype-specific gtr gene is present, or when gtrA or gtrB are present along with the gtr gene, partial serotype conversion is observed and is proposed to result from the incomplete modification of the O antigen (Adhikari et al., 1999Down ; Guan et al., 1999Down ; Huan et al., 1995Down , 1997aDown , bDown ). While the function of GtrA in O antigen modification is not known, it has been proposed to be a flippase that flips undecaprenol phosphate (UndP)-glucose from the inside of the cell to the outside of the cell where glucose is then transferred to the O antigen by the serotype-specific glucosyltransferase (Guan et al., 1999Down ). The protein encoded by gtrB functions as a bactoprenol transferase that catalyses the formation of the glucose precursor by transferring glucose from UDP-glucose to UndP (Guan et al., 1999Down ). When gtrA and gtrB are both present along with the serotype-specific glucosyltransferase, complete conversion is always observed in SFL124 (Adhikari et al., 1999Down ; Guan et al., 1999Down ; Huan et al., 1997aDown , bDown ), even when only a single copy of gtrA gtrB gtr(type) is present (Guan & Verma, 1998Down ).

To ensure that the partial serotype conversion observed for SFL1258, SFL1259 and SFL1260 was not the result of a PCR-induced mutation in either gtrA or gtrB, the gtrAEc gtrBEc genes from pNV734 were cloned in front of the gtrX gene, which encodes the glucosyltransferase responsible for group 7,8 glucosylation (Guan et al., 1999Down ). The resulting recombinant plasmid, pNV781, was introduced into SFL124 to create recombinant strain SFL1350. Sensitivity to bacteriophage SfV and colony agglutination were used to determine if gtrAEc gtrBEc could completely complement gtrX. SFL1350 was resistant to infection by SfV (data not shown) whereas partially converted strain SFL1096 (SFL124 containing the gtrX gene only: Verma et al., 1993Down ; Huan et al., 1995Down ) was sensitive to SfV. These data were confirmed with colony agglutination where SFL1350 agglutinated strongly with group 7,8 sera compared to SFL1096, which reacted very weakly (data not shown). These data suggest that the GtrAEc and GtrBEc proteins are functional in SFL124. These results also suggest that the partial conversion observed for strains SFL1258, SFL1259 and SFL1260 is related to GtrIVEc activity.

The basic structure of the native E. coli K-12 O16 O antigen (Stevenson et al., 1994Down ) differs from that of S. flexneri (Fig. 1Up). While the rhamnose III-N-acetylglucosamine disaccharide is present in both, the bonds between these two sugars differ, with a 1,3-ß bond present in S. flexneri O antigen and a 1,3-{alpha} bond present in E. coli (Fig. 1Up). The activity of GtrIVEc may be specific for the E. coli O antigen and it is possible that this activity and/or specificity is reduced when presented with the heterologous S. flexneri substrate. Differences in the GtrIVEc and GtrIVSf proteins (refer to results below) could be related to this substrate-specificity. Since partially converted recombinant vaccine strains do not confer complete protection (Huan et al., 1995Down ; Verma et al., 1991Down ), the E. coli genes are poor candidates for the development of recombinant vaccine strains. Consequently, we decided to isolate the type IV glucosylation factors from S. flexneri.

Induction of temperate bacteriophages from S. flexneri serotype 4a and 4b strains
The O antigen glucosylation genes encoding type II and V and group 7,8 (serotype X) modifications have been successfully isolated and characterized from bacteriophages SfII, SfV and SfX, respectively (Guan et al., 1999Down ; Huan et al., 1997aDown , bDown ; Mavris et al., 1997Down ; Verma et al., 1993Down ). A bacteriophage, designated {phi}9725, was induced from serotype 4a strain NCTC 9725, but phages were not induced from serotype 4a strain NCTC 8296 and serotype 4b strain NCTC 8336. To determine if the phage genome contained the O antigen modification genes, attempts were initially made to create a {phi}9725 lysogen in SFL124 that could be analysed for serotype conversion; however, a lysogen was not obtained. Subsequently, the phage DNA was subjected to Southern hybridization using the conserved gtrA and gtrB genes and gtrIVEc as probes. The {phi}9725 genome failed to hybridize to any of the probes, with results from the gtrAEc hybridization shown in Fig. 3Down. The absence of the conserved gtrA and gtrB genes associated with other serotype conversion loci suggests that the phage is not involved in serotype conversion. Phage {phi}9725 is one of the few S. flexneri bacteriophages described in the literature that does not confer O antigen modification. Further studies will focus on characterizing the molecular biology of this phage.



View larger version (88K):
[in this window]
[in a new window]
 
Fig. 3. Localization of the serotype conversion genes in various strains. Chromosomal DNA from the phage and bacterial strains indicated was digested with BamHI and EcoRV and subjected to Southern hybridization with the 32P-labelled gtrAEc probe. The molecular mass marker was EcoRI-digested SPP-1 bacteriophage DNA (Progen).

 
Isolation and characterization of the O antigen modification genes from S. flexneri
Since a serotype-converting phage could not be isolated, we endeavoured to isolate the O antigen modification genes from the S. flexneri genome. Southern hybridization was first used to localize the serotype conversion genes. Genomic DNA obtained from NCTC 8296 (serotype 4a), NCTC 9725 (serotype 4a), NCTC 8336 (serotype 4b), SFL124 and E. coli DH1 (controls) was digested with BamHI and EcoRV and analysed using Southern hybridization. When the gtrIVEc gene was used as a probe, single BamHI and EcoRV fragments hybridized strongly in DH1, whereas multiple fragments hybridized very weakly in all S. flexneri genomic DNAs (data not shown, refer to the discussion of the results for gtrAEc below). The S. flexneri fragments hybridizing to the probe were visually evident on the agarose gel and it was concluded that the probe had bound non-specifically to abundant DNA, presumably plasmid DNA. The fact that the gtrIVEc probe did not hybridize to the gtrIV gene of S. flexneri under these experimental conditions suggests that the two genes are not homologous. The same membrane was stripped and rehybridized consecutively with the gtrAEc and gtrBX probes. The patterns of hybridization obtained from both experiments were essentially identical and the results for the gtrAEc hybridization are shown in Fig. 3Up. The gtrA and gtrB probes hybridized strongly to single large-molecular-mass fragments in SFL124 (BamHI), NCTC 9725 (EcoRV and BamHI) and NCTC 8336 (EcoRV and BamHI); the probes hybridized to fragments of approximately 5·2, 4·3 and 4 kb in DH1 (EcoRV), SFL124 (EcoRV) and NCTC 8296 (BamHI), respectively. Weak hybridization signals, corresponding to the pattern observed with the gtrIVEc probe, were also evident with the gtrAEc probe only and presumably resulted from non-specific binding.

The fact that both gtrA and gtrB probes hybridized to the same fragment in all strains is consistent with the organization of other loci encoding O antigen modification, where the gtrA and gtrB genes are adjacent to one another. The hybridization data for gtrB are consistent with that of Mavris et al. (1997)Down , who reported that all serotypes of S. flexneri as well as E. coli K-12 hybridized to the gtrBII (bgt) probe. All the strains tested in this study also hybridized to the gtrAEc probe. Hybridization of SFL124 DNA to both gtrA and gtrB suggests that this strain may contain homologues of these genes, which may explain why partial serotype conversion is observed when only the serotype-specific gtr gene, or gtr in combination with only gtrA or gtrB, is introduced into SFL124 (Adhikari et al., 1999Down ; Guan et al., 1999Down ; Huan et al., 1995Down , 1997aDown , bDown ). The activity and/or specificity of the gtrA gtrB homologues in SFL124 may be reduced relative to that of the glucosylation genes and, therefore, results in partial serotype conversion. It is also interesting to note that the patterns of hybridization for all strains except NCTC 9725 (serotype 4a) and NCTC 8336 (serotype 4b) are different. These observations suggest that the nature and/or completeness of the serotype-converting phages, and/or overall chromosome organization, can vary significantly among different strains, including those of the same serotype.

The approximately 4 kb chromosomal fragment from NCTC 8296, which hybridized to the gtrA and gtrB probes, was theoretically large enough to contain all three serotype conversion genes and was a convenient size for cloning. Genomic DNA from NCTC 8296 was digested with BamHI and fragments from 3·6 to 4·2 kb were gel-purified, ligated into the BamHI site of pUC18, and transformed into E. coli JM109. White colonies (800) were restreaked and screened by colony hybridization using gtrBX as a probe. Seven transformants hybridized strongly to the probe and were analysed further. Plasmid DNA from B837 and B838 contained the approximately 4 kb BamHI fragment and the respective plasmids were designated pNV739 and pNV740.

To determine if pNV739 and pNV740 contained the serotype conversion genes, the plasmids were transformed into serotype Y strain SFL124 to create recombinant strains SFL1264 and SFL1265, respectively. Both recombinant strains, SFL124 (serotype Y) and NCTC 8296 (serotype 4a) were analysed by immunogold labelling using MASF Y-5 (serotype-Y-specific) and MASF IV-2 (type-IV-specific) monoclonal antibodies (Fig. 2Up). The O antigen of the control strains was only recognized by the respective serotype-specific antibody as described previously (Fig. 2Up). The O antigen of recombinant strains SFL1264 and SFL1265 was no longer bound by MASF Y-5 but was recognized by MASF IV-2 in a pattern similar to that of NCTC 8296 (results for SFL1265 shown in Fig. 2Up). These data indicate that the approximately 4 kb BamHI chromosomal fragment from NCTC 8296 contained the type IV O antigen modification genes, which conferred complete serotype conversion from Y to 4a in SFL124.

The complete BamHI fragment was sequenced and analysed. The sequence has been deposited in GenBank under accession number AF288197. The 3834 bp fragment was predicted to contain three complete open reading frames (orf1,2,3) and one incomplete ORF. All ORFs were transcribed in the same direction (Table 2Down). Putative promoter (-35 region, nt 830–835; -10 region, nt 845–850) and rho-independent terminator (nt 3478–3502) sequences were located upstream of orf1 and downstream of orf3, respectively, suggesting that these three ORFs are transcribed in an operon. When the sequencing data were compared to the restriction map of pNV739 and pNV740, it was determined that the putative operon was in both orientations, with the operon in pNV739 being in the correct orientation to the lac promoter of pUC18 and in the opposite orientation in pNV740.


View this table:
[in this window]
[in a new window]
 
Table 2. Sequence analysis of the 3·8 kb BamHI chromosomal fragment from serotype 4a strain NCTC 8296

 
The proteins encoded by orf1 and orf2 showed significant homology to the GtrA and GtrB proteins encoded by other serotype conversion loci (Table 2Up). Based on sequence and functional analyses, these ORFs were named gtrAIV and gtrBIV. The third open reading frame, called gtrIVSf, encoded the type-IV-specific glucosyltransferase (437 amino acids), which mediates the addition of the glucosyl residue through an {alpha}1,6 linkage to the N-acetylglucosamine of the basic O antigen (Fig. 1Up). Analysis of GtrIVSf revealed that GtrIVEc was the only protein showing significant homology which was evident over the entire length of both proteins (41% identity and 63% similarity; Table 2Up and Fig. 4Down). Similar to the observations reported with other glucosyltransferase genes of S. flexneri, the GC content of the three genes, gtrIVSf in particular, is lower than the mean GC content of the S. flexneri genome (reviewed by Allison & Verma, 2000Down ) (Table 2Up).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4. Best Fit comparison of GtrIVSf and GtrIVEc. Lines represent amino acid residues that are identical whereas dots represent amino acids that are similar. Extended regions of homology between GtrIVSf and GtrIVEc have been boxed. The secondary structure of GtrIVEc, predicted by PhD Predict PHDhtm (Rost et al., 1995Down ), is indicated as follows: plain text, intracellular regions; italics, transmembrane regions; and underlined, extracellular regions.

 
Comparison of GtrIVSf and GtrIVEc
The glucosyltransferases characterized from S. flexneri to date appear to be a very heterogeneous group of proteins that show very little amino acid sequence homology, even though all proteins interact with the same acceptor, the tetrasaccharide O antigen unit, and precursor, UndP-glucose (reviewed by Allison & Verma, 2000Down ). The predicted secondary structure, which indicates the presence of multiple transmembrane regions, is the only similarity found among the glucosyltransferases (Allison & Verma, 2000Down ). Relative to other S. flexneri glucosyltransferases, GtrIVSf and GtrIVEc are very similar (Fig. 4Up). There are four main regions of homology (Fig. 4Up): region I is located within the N-terminal approximately 100 amino acids; and regions II, III and IV are located in the C-terminal approximately 200 amino acids. When comparing the location of regions I, II, III and IV to the predicted secondary structure of GtrIVEc, it is interesting to note that most of the homology is found in areas of the protein that are predicted to be outside the cell, with regions II and III occurring in a large central extracellular region. Of particular interest, there is a VDE (GtrIVSf) motif and a VDD (GtrIVEc) motif located at the beginning of region II. Many bacterial glycosyl transferases contain a conserved DxD motif which is involved in binding of the nucleotide-activated sugar (reviewed by Breton & Imberty, 1999Down ). Related motifs such as NDD and S/TDD perform the same function (Breton & Imberty, 1999Down ). Given the predicted location of this motif in the GtrIV proteins, it is tempting to speculate that these residues may be involved in the catalytic activity of these glucosyltransferases. Since these two proteins both catalyse the addition of {alpha}1,6 glucose from UndP-glucose to the O antigen, it is possible that some of the differences observed may be related to substrate-specificity as the O antigens of E. coli and S. flexneri are different (refer to discussion above, Fig. 1Up). These differences may explain why GtrIVEc is only capable of conferring partial serotype conversion in S. flexneri. Further analysis of the similarities and differences between GtrIVSf and GtrIVEc will form the basis for structural and functional studies.

Organization of the serotype conversion genes in NCTC 8296
Upstream of gtrAIV, a 46 nt sequence showing 100% identity to the attachment sites of S. flexneri serotype-converting phages, and other related phages, was identified (Table 2Up). The incomplete ORF located immediately upstream of attP also showed significant homology to related integrase genes (Table 2Up). In fact, the nucleotide sequence of int', the intervening non-coding attP region, gtrAIV, and the first approximately one-third of the gtrBIV gene in NCTC 8296 (nt 1–1580) is almost identical to the nucleotide sequence of the corresponding regions in phages SfII and SfV (98·9% identity). In the SfII and SfV genomes, the glucosylation genes are located downstream of the integration module in the order of int attP gtrA gtrB gtr. Upon integration of the phage into the host chromosome, the int and gtr genes are separated by the phage genome but are still transcribed in the same direction. In SfII and SfV lysogens, host DNA would be expected up- and downstream of the attL and attR sites, respectively. This organization was largely conserved in serotype 1a strain Y53 even though a large portion of the phage genome had been deleted (Adhikari et al., 1999Down ). The organization of the genes in this region of NCTC 8296, however, suggests that the int attP located upstream of the glucosylation genes belongs to a phage which has integrated adjacent to the type IV O antigen modification genes. These data suggest that this region of the NCTC 8296 genome has been derived from two bacteriophages, neither of which was induced using the UV induction.


    ACKNOWLEDGEMENTS
 
The authors would like to thank N. Carlin for the monoclonal antibodies and L. Shen and S. Stowe of the Electron Microscopy Unit at the Research School for Biological Sciences for their assistance with the microscopy. The authors would also like to thank the National Health and Medical Research Council of Australia for funding this project.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Adhikari, P., Allison, G., Whittle, B. & Verma, N. K. (1999). Serotype 1a O-antigen modification: molecular characterization of the genes involved and their novel organization in the Shigella flexneri chromosome. J Bacteriol 181, 4711-4718.[Abstract/Free Full Text]

Allison, G. A. & Verma, N. K. (2000). Serotype-converting bacteriophages and O-antigen modification in Shigella flexneri. Trends Microbiol 8, 17-23.[Medline]

Bastin, D. A., Lord, A. & Verma, N. K. (1997). Cloning and analysis of the glucosyl transferase gene encoding type I antigen in Shigella flexneri. FEMS Microbiol Lett 156, 133-139.[Medline]

Blattner, F. R., Plunkett, G., III, Bloch, C. A. & 14 other authors (1997). The complete genome sequence of Escherichia coli K-12. Science 277, 1453–1462.[Abstract/Free Full Text]

Breton, C. & Imberty, A. (1999). Structure/function studies of glycosyltransferases. Curr Opin Struct Biol 9, 563-571.[Medline]

Carlin, N. I. A. & Lindberg, A. A. (1987). Monoclonal antibodies specific for Shigella flexneri lipopolysaccharides: clones binding to type IV, V, and VI antigens, group 3,4 antigen, and an epitope common to all Shigella flexneri and Shigella dysenteriae type 1 strains. Infect Immun 55, 1412-1420.[Abstract/Free Full Text]

Clark, C. A., Beltrame, J. & Manning, P. A. (1991). The oac gene encoding a lipopolysaccharide O-antigen acetylase maps adjacent to the integrase-encoding gene on the genome of Shigella flexneri bacteriophage Sf6. Gene 107, 43-52.[Medline]

Guan, S. & Verma, N. K. (1998). Serotype conversion of a Shigella flexneri candidate vaccine strain via a novel site-specific chromosome-integration system. FEMS Microbiol Lett 166, 79-87.[Medline]

Guan, S., Bastin, D. A. & Verma, N. K. (1999). Functional analysis of the O antigen glucosylation gene cluster of Shigella flexneri bacteriophage SfX. Microbiology 145, 1263-1273.[Abstract]

Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557-580.[Medline]

Huan, P. T., Taylor, R., Lindberg, A. A. & Verma, N. K. (1995). Immunogenicity of the Shigella flexneri serotype Y (SFL124) vaccine strain expressing cloned glucosyl transferase gene of converting bacteriophage SfX. Microbiol Immunol 39, 467-472.[Medline]

Huan, P. T., Whittle, B. L., Bastin, D. A., Lindberg, A. A. & Verma, N. K. (1997a). Shigella flexneri type-specific antigen V: cloning, sequencing and characterization of the glucosyl transferase gene of temperate bacteriophage SfV. Gene 195, 207-216.[Medline]

Huan, P. T., Bastin, D. A., Whittle, B. L., Lindberg, A. A. & Verma, N. K. (1997b). Molecular characterisation of the genes involved in O-antigen modification, attachment, integration and excision in Shigella flexneri bacteriophage SfV. Gene 195, 217-227.[Medline]

Kotloff, K. L., Winickoff, J. P., Ivanoff, B., Clemens, J. D., Swerdlow, D. L., Sansonetti, P. J., Adak, G. K. & Levine, M. M. (1999). Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull WHO 77, 651-666.[Medline]

Lindberg, A. A., Karnell, A., Stocker, B. A., Katakura, S., Sweiha, H. & Rienholt, F. P. (1988). Development of an auxotrophic oral live Shigella flexneri vaccine. Vaccine 6, 146-150.[Medline]

Mavris, M., Manning, P. A. & Morona, R. (1997). Mechanism of bacteriophage SfII-mediated serotype conversion in Shigella flexneri. Mol Microbiol 26, 939-950.[Medline]

Morona, R., MacPherson, D. F., Van Den Bosch, L., Carlin, N. I. A. & Manning, P. A. (1995). Lipopolysaccharide with an altered O-antigen produced by Escherichia coli K-12 harbouring mutated, cloned Shigella flexneri rfb genes. Mol Microbiol 18, 209-223.[Medline]

Petrovskaya, V. G. & Licheva, T. A. (1982). A provisional chromosome map of Shigella and the regions related to pathogenicity. Acta Microbiol Acad Sci Hung 29, 41-53.[Medline]

Phalipon, A., Kaufmann, M., Michetti, P., Cavaillon, J.-M., Huerre, M., Sansonetti, P. & Kraehenbuhl, J.-P. (1995). Monoclonal immunoglobulin A antibody directed against serotype-specific epitope of Shigella flexneri lipopolysaccharide protects against murine experimental shigellosis. J Exp Med 182, 769-778.[Abstract/Free Full Text]

Rost, B., Casadio, R., Fariselli, P. & Sander, C. (1995). Prediction of helical transmembrane segments at 95% accuracy. Protein Sci 4, 521-533.[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schuch, R. & Maurelli, A. T. (1997). Virulence plasmid instability in Shigella flexneri 2a is induced by virulence gene expression. Infect Immun 65, 3686-3692.[Abstract]

Simmons, D. A. R. & Romanowska, E. (1987). Structure and biology of Shigella flexneri O antigens. J Med Microbiol 23, 289-302.[Medline]

Stevenson, G., Neal, B., Liu, D., Hobbs, M., Packer, N. H., Batley, M., Redmond, J. W., Lindquist, L. & Reeves, P. (1994). Structure of the O antigen of Escherichia coli K-12 and the sequence of its rfb gene cluster. J Bacteriol 176, 4144-4156.[Abstract/Free Full Text]

Verma, N. K., Brandt, J. M., Verma, D. J. & Lindberg, A. A. (1991). Molecular characterisation of the O-acetyl transferase gene of converting bacteriophage SF6 that adds group antigen 6 to Shigella flexneri. Mol Microbiol 5, 71-75.[Medline]

Verma, N. K., Verma, D. K., Huan, P. T. & Lindberg, A. A. (1993). Cloning and sequencing of the glucosyl transferase-encoding gene from converting bacteriophage X (SfX) of Shigella flexneri. Gene 129, 99-101.[Medline]

Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.[Medline]

Received 14 August 2000; revised 20 November 2000; accepted 14 December 2000.


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
K. Kaluzny, P. D. Abeyrathne, and J. S. Lam
Coexistence of Two Distinct Versions of O-Antigen Polymerase, Wzy-Alpha and Wzy-Beta, in Pseudomonas aeruginosa Serogroup O2 and Their Contributions to Cell Surface Diversity
J. Bacteriol., June 1, 2007; 189(11): 4141 - 4152.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Markine-Goriaynoff, L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen
Glycosyltransferases encoded by viruses
J. Gen. Virol., October 1, 2004; 85(10): 2741 - 2754.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
K. A. Talukder, Z. Islam, M. Aminul Islam, D. K. Dutta, A. Safa, M. Ansaruzzaman, A. S. G. Faruque, S. N. Shahed, G. B. Nair, and D. A. Sack
Phenotypic and Genotypic Characterization of Provisional Serotype Shigella flexneri 1c and Clonal Relationships with 1a and 1b Strains Isolated in Bangladesh
J. Clin. Microbiol., January 1, 2003; 41(1): 110 - 117.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
G. E. Allison, D. Angeles, N. Tran-Dinh, and N. K. Verma
Complete Genomic Sequence of SfV, a Serotype-Converting Temperate Bacteriophage of Shigellaflexneri
J. Bacteriol., April 1, 2002; 184(7): 1974 - 1987.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adams, M. M.
Right arrow Articles by Verma, N. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adams, M. M.
Right arrow Articles by Verma, N. K.
Agricola
Right arrow Articles by Adams, M. M.
Right arrow Articles by Verma, N. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2001 Society for General Microbiology.