|
|
||||||||
Genetics and Molecular Biology |
Department of Microbiology and Immunology, University of California, San Francisco, CA 94143-0414, USA1
Author for correspondence: M. Andrew Uhl. Tel:+1 415 502 0859. Fax: +1 415 476 8201. e-mail: uhl{at}socrates.ucsf.edu
| ABSTRACT |
|---|
|
|
|---|
Keywords: ß-galactosidase, yeast, fungal pathogen, gene regulation
a Present address: Department of Biochemistry and Biophysics, University of California, San Francisco, CA, USA.
| INTRODUCTION |
|---|
|
|
|---|
Studies of transcriptional regulation in C. albicans have been limited by several properties of the organism; e.g. it is diploid with a little-understood sexual cycle, making conventional genetic analysis impossible (Odds, 1988
). Additionally, expression of foreign genes, including reporter genes, in C. albicans has been complicated by the alternative codon usage of the organism. The codon CTG is read as a serine in C. albicans but as a leucine in other organisms (Ohama et al., 1993
). Escherichia coli lacZ, which has been successfully adapted as a reporter gene in many organisms, contains 51 CTG codons (Gilbert & Maxam, 1973
); therefore successful expression of a functional enzyme seems unlikely without extensive alteration. Other common reporter genes, such as uidA (ß-glucuronidase) also contain several CTG codons (Blanco et al., 1985
). We were particularly interested in developing a ß-galactosidase as a reporter for C. albicans because of the extensive variety of substrates available for this enzyme. In addition, C. albicans is not known to have an endogenous ß-galactosidase and cannot utilize lactose as a carbon source (Kwon-Chung, 1992
).
Here we report the use of lacZ from Streptococcus thermophilus as a versatile reporter gene for C. albicans. We show that ß-galactosidase activity can be readily detected by a variety of methods when lacZ is expressed from several C. albicans promoters.
| METHODS |
|---|
|
|
|---|
The Strep. thermophilus lacZ gene was amplified from pRH116 using the primers LacZ5' (GTGTCCCGGGTCCATGAACATGACTGAAAAAATTCAA) and LacZ3' (TCCACGAGGATCCCTAATTTAGTGGTTCAATCATGAAG) and cloned into the various expression constructs to create the following plasmids: MAL2lacZ (pAU22), HWP1lacZ (pAU95) and ACT1lacZ (pAU36). Alteration of the CTG codon to TTA in lacZ was done by PCR-based mutagenesis using the primer pairs LacZ-1631 (ATGGTGTCGTGAGTTTGA) and LacZm3' (CAGTTGCTTCTCTTAAGACACAAGCAACTTCGTAAATTTG), and LacZm5' (GTTGCTTGTGTCTTAAGAGAAGCAACTGAATGGGCTCC) and LacZ3'. The resulting PCR fragments were mixed and served as a template for amplification with the primers LacZ-1631 and LacZ3'; this was cloned into pAU22 to give pAU106. Presence of the mutation was screened for by creation of an AflII site and confirmed by sequencing. For expression of Strep. thermophilus lacZ in Saccharomyces cerevisiae, lacZ was amplified with Pfu DNA polymerase (Stratagene) using linearized pAU22 as a template and the primers LacZ5' and MAL2-3'Bln (CCTGCCTAGGAGACATACGCTTTGCAGGTGGTGTT). The resulting product was digested with XmaI and BlnI and cloned into XmaI/XbaI-cut pDK20 (a gift from Doug Kellogg, Sinsheimer Laboratories, Dept of Biology, University of California, Santa Cruz).
C. albicans methods.
C. albicans strain CAI4 (ura3::imm434/ura3::imm434) served as the parent strain for all manipulations (Fonzi & Irwin, 1993
). Linearized DNA was transformed into CAI4 by the modified lithium acetate method (Hill et al., 1991
; Gietz et al., 1995
), and transformants were selected on medium lacking uridine (Guthrie & Fink, 1991
). Standard recipes were utilized for all media, and carbon sources such as maltose, glucose, galactose or lactose were added at a final concentration of 2% (v/v) (Guthrie & Fink, 1991
). For expression of lacZ in Sacch. cerevisiae, strain W303 (ade2-1 trp1-1 cau1-100 leu2-3,112 his3-11 ura3 psi+) was utilized (Guthrie & Fink, 1991
). Plasmids were introduced into W303 by lithium acetate transformation (Hill et al., 1991
; Gietz et al., 1995
).
ß-Galactosidase assays.
C. albicans ß-galactosidase assays were performed as described by Ausubel et al. (1992)
for Sacch. cerevisiae with minor modifications. For liquid assays, 1 ml cells was resuspended in an equal volume of Z buffer (Ausubel et al., 1992
) and placed on ice. The OD600 was determined for each sample. Then 10100 µl of cells was added to Z buffer to a final volume of 1 ml, and the cells were permeabilized with 15 µl 0·1% SDS and 30 µl chloroform. There was no appreciable change in activity when alternative methods such as toluene or glass beads were used for permeabilizing cells. Cells were equilibrated at 37 °C for 5 min, then 0·2 ml ONPG (4 mg ml-1) was added and the cells were mixed and incubated at 37 °C. Reactions were stopped by addition of 0·5 ml 1 M Na2CO3, spun for 5 min at 10000 g and the A420 and A550 were read. Units of activity were determined by the standard equation given by Ausubel et al. (1992)
.
Filter assays were performed as described by Ausubel et al. (1992)
. Patched colonies of C. albicans were replica-plated onto solid medium with an overlay of a circular Whatman filter and grown overnight. Filters were frozen in liquid nitrogen and incubated in 3 ml Z buffer with 20 µl 3% X-Gal and incubated at 37 °C.
Visual screens for C. albicans were carried out by patching colonies onto X-Gal plates (Ausubel et al., 1992
). The standard formulation for X-Gal plates was utilized for most applications. A slightly modified recipe proved more sensitive for detection of ß-galactosidase, although strains grew more slowly on this medium (X-Gal Modified Medium, XMM). XMM contained 1·7 g Yeast Nitrogen Base (without amino acids or ammonium sulfate), 20 g glucose, 5 g ammonium sulfate and 20 g agar in 930 ml H2O. After autoclaving, 70 ml 1 M potassium phosphate pH 7·0 and 2 ml of a 20 mg ml-1 X-Gal solution were added.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
|
Expression of the ACT1lacZ construct was constant during all growth conditions, varying less than 1·5-fold during all growth conditions (Table 1
). The ACT1 gene is known to be downregulated by starvation and during growth-phase changes; these conditions were not tested for the ACT1lacZ fusion (Delbruck & Ernst, 1993
; Swoboda et al., 1994
). In contrast, the HWP1lacZ construct was strongly induced by growth under filamentous conditions, including YEP-glucose+10% fetal calf serum at 37 °C. Compared to growth in YEP-glucose, the HWP1lacZ construct was induced approximately 250-fold by growth in YEP-glucose+10% fetal calf serum. This is consistent with measurements of RNA levels of HWP1 in cells grown in YEP-glucose or YEP-glucose+10% fetal calf serum at 37 °C (data not shown). HWP1lacZ was also induced to a lesser degree by substitution of maltose for glucose in the growth medium (see Table 1
and Fig. 2
), and utilization of maltose as a carbon source has been reported to be an inducer of filamentous growth in C. albicans (Odds, 1988
).
In order to optimize enzymic assays for the Strep. thermophilus ß-galactosidase, we performed assays at various temperatures and pH values. The temperature optimum of Strep. thermophilus LacZ was found to lie between 45 and 50 °C; enzymic activity fell sharply at temperatures higher than 50 °C. Activity of the enzyme was 2·2-fold higher at 45 °C than at 30 °C. The pH optimum of the enzyme was between 6·8 and 7·2.
Expression of lacZ does not allow growth on lactose as a sole carbon source
Since expression of ACT1lacZ was independent of carbon source, this allowed a test of whether C. albicans expressing ß-galactosidase could utilize lactose as a sole carbon source. We grew C. albicans SC5314 (wild-type) and C. albicans CA361 (ACT1::lacZ) on minimal medium with glucose (SG), minimal medium with lactose (SL) and minimal medium without any carbon source (S). No growth of SC5314 or CA361 was observed on SL or S medium, while both strains grew on SG medium (data not shown). A similar phenotype has been noticed for Sacch. cerevisiae strains expressing ß-galactosidase, and expression of a lactose permease was necessary before lactose could be utilized as a carbon source (Sreekrishna & Dickson, 1985
).
Qualitative assays of ß-galactosidase activity
Growth of cells on medium containing X-Gal provides a useful method of screening large numbers of cells for the expression of ß-galactosidase activity under particular sets of conditions. When cells were plated on the appropriate medium containing X-Gal, activity was easily detectable from C. albicans strains expressing MAL2lacZ (CAU221), HWP1lacZ (CAU951) and ACT1lacZ (CAU361) (Fig. 2
). After 2 d, colonies expressing the HWP1lacZ fusions turned blue on X-Gal+10% fetal calf serum, but remained white on X-Gal+glucose or X-Gal+maltose (not shown). However, after 5 d, strains with the HWP1lacZ fusion began to turn blue on all media (Fig. 2
). This result was expected since HWP1 expression is highly induced under a variety of conditions that promote filamentous growth, including starvation, a condition that arises in colonies upon prolonged growth (see below). Colonies of the ACT1lacZ fusion strain turned visibly blue on all media as soon as 2 d, and developed further after 5 d (Fig. 3
). Colonies of the MAL2lacZ fusion strain turned blue on X-Gal+maltose medium in 45 d, but remained white on X-Gal+glucose medium (Fig. 2
). The longer developing time of the MAL2lacZ fusion strains compared with the other strains is consistent with the lower level of expression as detected by the liquid assays (Table 1
).
|
Although growth on X-Gal medium is a useful monitor of lacZ expression, it can require several days for the colour to develop. For more rapid detection of ß-galactosidase activity, colonies grown on solid medium can be transferred to paper filters, permeabilized by freezing in liquid nitrogen and incubated with X-Gal (Ausubel et al., 1992
). Results with filter assays matched results of the liquid ß-galactosidase assays and plate assays (not shown). Positive reactions were obtained after only a few hours incubation at 37 °C for C. albicans strains with integrated MAL2lacZ, HWP1lacZ or ACT1lacZ fusions.
Strep. thermophilus lacZ in Sacch. cerevisiae
Since it is often useful to compare regulatory pathways in C. albicans and Sacch. cerevisiae (Gimeno et al., 1992
), we tested whether Strep. thermophilus lacZ also functioned in Sacch. cerevisiae. Sacch. cerevisiae strains that contain the Strep. thermophilus lacZ fused to the GAL1,10 promoter and integrated in the genome readily exhibit regulated ß-galactosidase activity as determined by filter assays (Guthrie & Fink, 1991
). When grown on YEP-galactose, 88% of the transformants produced ß-galactosidase activity within 1 h, while no activity was observed when transformants were grown on YEP-glucose. No activity was detected from Sacch. cerevisiae stains containing the GAL1,10 vector alone. Thus, Strep. thermophilus lacZ can be shuttled between C. albicans and Sacch. cerevisiae and used as a reporter gene in both yeasts.
The results presented in this paper show that lacZ from Strep. thermophilus is a useful reporter gene for the human pathogen C. albicans. Other reporter genes have been developed for C. albicans, including the sea pansy luciferase (Srikantha et al., 1996
), the K. lactis ß-galactosidase LAC4 (Leuker et al., 1992
), the URA3 gene from C. albicans (Myers et al., 1995
) and the yeast-enhanced green fluorescent protein (yEGFP; Cormack et al., 1997
). These reporter genes have been used effectively for studies of transcriptional regulation in C. albicans (Wirsching et al., 2000
; Srikantha et al., 1996
, 1997
; Stoldt et al., 1997
; Leuker et al., 1997
). Strep. thermophilus LacZ combines the advantages of sensitivity, simplicity of qualitative assays, and ease of colorimetric visual screens in growing colonies of C. albicans.
E. coli lacZ has proved to be a highly versatile reporter gene in Sacch. cerevisiae and has been used to study many aspects of signal-transduction pathways, gene regulation and other cellular processes (Guarente & Ptashne, 1981
; Rose et al., 1981
; Guarente, 1983
; Burns et al., 1994
). We believe that the Strep. thermophilus lacZ reporter gene can be used for many of these same purposes in C. albicans.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1992). Current Protocols in Molecular Biology. New York: Greene Publishing Associates and Wiley-Interscience.
Blanco, C., Ritzenthaler, P. & Mata-Gilsinger, M. (1985). Nucleotide sequence of a regulatory region of the uidA gene in Escherichia coli K12. Mol Gen Genet 199, 101-105.[Medline]
Braun, B. R. & Johnson, A. D. (1997). Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science 277, 105-109.
Brown, A. J. & Gow, N. A. (1999). Regulatory networks controlling Candida albicans morphogenesis. Trends Microbiol 7, 333-338.[Medline]
Brown, D. H.Jr, Slobodkin, I. V. & Kumamoto, C. A. (1996). Stable transformation and regulated expression of an inducible reporter construct in Candida albicans using restriction enzyme-mediated integration. Mol Gen Genet 251, 75-80.[Medline]
Burns, N., Grimwade, B., Ross-Macdonald, P. B., Choi, E. Y., Finberg, K., Roeder, G. S. & Snyder, M. (1994). Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae. Genes Dev 8, 1087-1105.
Calera, J. A., Zhao, X. J. & Calderone, R. (2000). Defective hyphal development and avirulence caused by a deletion of the SSK1 response regulator gene in Candida albicans. Infect Immun 68, 518-525.
Cormack, B. P., Bertram, G., Egerton, M., Gow, N. A. R., Falkow, S. & Brown, A. J. (1997). Yeast-enhanced green fluorescent protein (yEGFP): a reporter of gene expression in Candida albicans. Microbiology 143, 303-311.
Csank, C., Makris, C., Meloche, S., Schröppel, K., Röllinghoff, M., Dignard, D., Thomas, D. Y. & Whiteway, M. (1997). Derepressed hyphal growth and reduced virulence in a VH1 family-related protein phosphatase mutant of the human pathogen Candida albicans. Mol Biol Cell 8, 2539-2551.
Csank, C., Schroppel, K., Leberer, E., Harcus, D., Mohamed, O., Meloche, S., Thomas, D. Y. & Whiteway, M. (1998). Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis. Infect Immun 66, 2713-2721.
Delbruck, S. & Ernst, J. F. (1993). Morphogenesis-independent regulation of actin transcript levels in the pathogenic yeast Candida albicans. Mol Microbiol 10, 859-866.[Medline]
Fonzi, W. A. & Irwin, M. Y. (1993). Isogenic strain construction and gene mapping in Candida albicans. Genetics 134, 717-728.[Abstract]
Gale, C. A., Bendel, C. M., McClellan, M., Hauser, M., Becker, J. M., Berman, J. & Hostetter, M. K. (1998). Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1. Science 279, 1355-1358.
Gietz, R. D., Schiestl, R. H., Willems, A. R. & Woods, R. A. (1995). Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11, 355-360.[Medline]
Gilbert, W. & Maxam, A. (1973). The nucleotide sequence of the lac operator. Proc Natl Acad Sci USA 70, 3581-3584.
Gimeno, C. J., Ljungdahl, P. O., Styles, C. A. & Fink, G. R. (1992). Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68, 1077-1090.[Medline]
Guarente, L. (1983). Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol 101, 181-191.[Medline]
Guarente, L. & Ptashne, M. (1981). Fusion of Escherichia coli lacZ to the cytochrome c gene of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 78, 2199-2203.
Guthrie, C. & Fink, G. R. (1991). Guide to Yeast Genetics and Molecular Biology. San Diego: Academic Press.
Hill, J., Donald, K. A., Griffiths, D. E. & Donald, G. (1991). DMSO-enhanced whole cell yeast transformation. [An erratum appears in Nucleic Acids Res 11, 6688.] Nucleic Acids Res 19, 5791.
Jacobson, R. H., Zhang, X. J., DuBose, R. F. & Matthews, B. W. (1994). Three-dimensional structure of beta-galactosidase from E. coli. Nature 369, 761-766.[Medline]
Kwon-Chung, K. B. (1992). Medical Mycology. Philadelphia: Lea & Febinger.
Leberer, E., Harcus, D., Broadbent, I. D. & 7 other authors (1996). Signal transduction through homologues of the Ste20p and Ste7p protein kinases can trigger hyphal formation in the pathogenic fungus Candida albicans. Proc Natl Acad Sci USA 93, 1321713222.
Leberer, E., Ziegelbauer, K., Schmidt, A., Harcus, D., Dignard, D., Ash, J., Johnson, L. & Thomas, D. Y. (1997). Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p. Curr Biol 7, 539-546.[Medline]
Leuker, C. E., Hahn, A. M. & Ernst, J. F. (1992). ß-Galactosidase of Kluyveromyces lactis (Lac4p) as reporter of gene expression in Candida albicans and C. tropicalis. Mol Gen Genet 235, 235-241.[Medline]
Leuker, C. E., Sonneborn, A., Delbruck, S. & Ernst, J. F. (1997). Sequence and promoter regulation of the PCK1 gene encoding phosphoenolpyruvate carboxykinase of the fungal pathogen Candida albicans. Gene 192, 235-240.[Medline]
Liu, H., Kohler, J. & Fink, G. R. (1994). Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266, 1723-1726.
Lo, H. J., Kohler, J. R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A. & Fink, G. R. (1997). Nonfilamentous C. albicans mutants are avirulent. Cell 90, 939-949.[Medline]
Myers, K. K., Sypherd, P. S. & Fonzi, W. A. (1995). Use of URA3 as a reporter of gene expression in C. albicans. Curr Genet 27, 243-248.[Medline]
Newport, G. & Agabian, N. (1997). KEX2 influences Candida albicans proteinase secretion and hyphal formation. J Biol Chem 272, 28954-28961.
Odds, F. C. (1988). Candida and Candidosis, 2nd edn. London: Baillière Tindall.
Ohama, T., Suzuki, T., Mori, M., Osawa, S., Ueda, T., Watanabe, K. & Nakase, T. (1993). Non-universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21, 4039-4045.
Poch, O., LHote, H., Dallery, V., Debeaux, F., Fleer, R. & Sodoyer, R. (1992). Sequence of the Kluyveromyces lactis beta-galactosidase: comparison with prokaryotic enzymes and secondary structure analysis. Gene 118, 55-63.[Medline]
Rose, M., Casadaban, M. J. & Botstein, D. (1981). Yeast genes fused to beta-galactosidase in Escherichia coli can be expressed normally in yeast. Proc Natl Acad Sci USA 78, 2460-2464.
Schroeder, C. J., Robert, C., Lenzen, G., McKay, L. L. & Mercenier, A. (1991). Analysis of the lacZ sequences from two Streptococcus thermophilus strains: comparison with the Escherichia coli and Lactobacillus bulgaricus ß-galactosidase sequences. J Gen Microbiol 137, 369-380.
Sreekrishna, K. & Dickson, R. C. (1985). Construction of strains of Saccharomyces cerevisiae that grow on lactose. Proc Natl Acad Sci USA 82, 7909-7913.
Srikantha, T., Klapach, A., Lorenz, W. W., Tsai, L. K., Laughlin, L. A., Gorman, J. A. & Soll, D. R. (1996). The sea pansy Renilla reniformis luciferase serves as a sensitive bioluminescent reporter for differential gene expression in Candida albicans. J Bacteriol 178, 121-129.
Srikantha, T., Tsai, L. K. & Soll, D. R. (1997). The WHI1 gene of Candida albicans is regulated in two distinct developmental programs through the same transcription activation sequences. J Bacteriol 179, 3837-3844.
Staab, J. F., Ferrer, C. A. & Sundstrom, P. (1996). Developmental expression of a tandemly repeated, proline- and glutamine-rich amino acid motif on hyphal surfaces of Candida albicans. J Biol Chem 271, 6298-6305.
Stoldt, V. R., Sonneborn, A., Leuker, C. E. & Ernst, J. F. (1997). Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J 16, 1982-1991.[Medline]
Swoboda, R. K., Bertram, G., Delbruck, S., Ernst, J. F., Gow, N. A. R., Gooday, G. W. & Brown, A. J. (1994). Fluctuations in glycolytic mRNA levels during morphogenesis in Candida albicans reflect underlying changes in growth and are not a response to cellular dimorphism. Mol Microbiol 13, 663-672.[Medline]
Timpel, C., Strahl-Bolsinger, S., Ziegelbauer, K. & Ernst, J. F. (1998). Multiple functions of Pmt1p-mediated protein O-mannosylation in the fungal pathogen Candida albicans. J Biol Chem 273, 20837-20846.
Wirsching, S., Michel, S., Kohler, G. & Morschhauser, J. (2000). Activation of the multiple drug resistance gene MDR1 in fluconazole-resistant, clinical Candida albicans strains is caused by mutations in a trans-regulatory factor. J Bacteriol 182, 400-404.
Received 12 December 2000;
accepted 15 January 2001.
This article has been cited by other articles:
![]() |
R. Manoharlal, J. Gorantala, M. Sharma, D. Sanglard, and R. Prasad PAP1 [poly(A) polymerase 1] homozygosity and hyperadenylation are major determinants of increased mRNA stability of CDR1 in azole-resistant clinical isolates of Candida albicans Microbiology, February 1, 2010; 156(2): 313 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Enjalbert, A. Rachini, G. Vediyappan, D. Pietrella, R. Spaccapelo, A. Vecchiarelli, A. J. P. Brown, and C. d'Enfert A Multifunctional, Synthetic Gaussia princeps Luciferase Reporter for Live Imaging of Candida albicans Infections Infect. Immun., November 1, 2009; 77(11): 4847 - 4858. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ramsdale, L. Selway, D. Stead, J. Walker, Z. Yin, S. M. Nicholls, J. Crowe, E. M. Sheils, and A. J.P. Brown MNL1 Regulates Weak Acid-induced Stress Responses of the Fungal Pathogen Candida albicans Mol. Biol. Cell, October 1, 2008; 19(10): 4393 - 4403. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Manoharlal, N. A. Gaur, S. L. Panwar, J. Morschhauser, and R. Prasad Transcriptional Activation and Increased mRNA Stability Contribute to Overexpression of CDR1 in Azole-Resistant Candida albicans Antimicrob. Agents Chemother., April 1, 2008; 52(4): 1481 - 1492. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chiranand, I. McLeod, H. Zhou, J. J. Lynn, L. A. Vega, H. Myers, J. R. Yates III, M. C. Lorenz, and M. C. Gustin CTA4 Transcription Factor Mediates Induction of Nitrosative Stress Response in Candida albicans Eukaryot. Cell, February 1, 2008; 7(2): 268 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gacser, F. Stehr, C. Kroger, L. Kredics, W. Schafer, and J. D. Nosanchuk Lipase 8 Affects the Pathogenesis of Candida albicans Infect. Immun., October 1, 2007; 75(10): 4710 - 4718. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Rognon, Z. Kozovska, A. T. Coste, G. Pardini, and D. Sanglard Identification of promoter elements responsible for the regulation of MDR1 from Candida albicans, a major facilitator transporter involved in azole resistance Microbiology, December 1, 2006; 152(12): 3701 - 3722. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-U. Baek, S. J. Martin, and D. A. Davis Evidence for Novel pH-Dependent Regulation of Candida albicans Rim101, a Direct Transcriptional Repressor of the Cell Wall {beta}-Glycosidase Phr2. Eukaryot. Cell, September 1, 2006; 5(9): 1550 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Zordan, D. J. Galgoczy, and A. D. Johnson From the Cover: Epigenetic properties of white-opaque switching in Candida albicans are based on a self-sustaining transcriptional feedback loop PNAS, August 22, 2006; 103(34): 12807 - 12812. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garcia-Sanchez, A. L. Mavor, C. L. Russell, S. Argimon, P. Dennison, B. Enjalbert, and A. J.P. Brown Global Roles of Ssn6 in Tup1- and Nrg1-dependent Gene Regulation in the Fungal Pathogen, Candida albicans Mol. Biol. Cell, June 1, 2005; 16(6): 2913 - 2925. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shen, W. Guo, and J. R. Kohler CaNAT1, a Heterologous Dominant Selectable Marker for Transformation of Candida albicans and Other Pathogenic Candida Species Infect. Immun., February 1, 2005; 73(2): 1239 - 1242. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Coste, M. Karababa, F. Ischer, J. Bille, and D. Sanglard TAC1, Transcriptional Activator of CDR Genes, Is a New Transcription Factor Involved in the Regulation of Candida albicans ABC Transporters CDR1 and CDR2 Eukaryot. Cell, December 1, 2004; 3(6): 1639 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Li, V. Gurkovska, M. Sheridan, R. Calderone, and N. Chauhan Studies on the regulation of the two-component histidine kinase gene CHK1 in Candida albicans using the heterologous lacZ reporter gene Microbiology, October 1, 2004; 150(10): 3305 - 3313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nicholls, M. Straffon, B. Enjalbert, A. Nantel, S. Macaskill, M. Whiteway, and A. J. P. Brown Msn2- and Msn4-Like Transcription Factors Play No Obvious Roles in the Stress Responses of the Fungal Pathogen Candida albicans Eukaryot. Cell, October 1, 2004; 3(5): 1111 - 1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Ullmann, H. Myers, W. Chiranand, A. L. Lazzell, Q. Zhao, L. A. Vega, J. L. Lopez-Ribot, P. R. Gardner, and M. C. Gustin Inducible Defense Mechanism against Nitric Oxide in Candida albicans Eukaryot. Cell, June 1, 2004; 3(3): 715 - 723. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Li and S. P. Palecek EAP1, a Candida albicans Gene Involved in Binding Human Epithelial Cells Eukaryot. Cell, December 1, 2003; 2(6): 1266 - 1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Staab, Y.-S. Bahn, and P. Sundstrom Integrative, multifunctional plasmids for hypha-specific or constitutive expression of green fluorescent protein in Candida albicans Microbiology, October 1, 2003; 149(10): 2977 - 2986. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. T. Magee, C. Gale, J. Berman, and D. Davis Molecular Genetic and Genomic Approaches to the Study of Medically Important Fungi Infect. Immun., May 1, 2003; 71(5): 2299 - 2309. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |