|
|
||||||||
Genetics and Molecular Biology |
54-dependent genes in Enterococcus faecalis: a mannose PTS permease (EIIMan) is involved in sensitivity to a bacteriocin, mesentericin Y105
Laboratoire de Microbiologie Fondamentale et Appliquée, CNRS FRE 2224, IBMIG, UFR Sciences, 40 avenue du Recteur Pineau, 86022 Poitiers Cedex, France1
Author for correspondence: Yann Héchard. Tel: +33 5 49 45 40 07. Fax: +33 5 49 45 35 03. e-mail: yann.hechard{at}univ-poitiers.fr
| ABSTRACT |
|---|
|
|
|---|
54 RNA polymerase subunit has a prominent role in susceptibility of Listeria monocytogenes and Enterococcus faecalis to mesentericin Y105, a class IIa bacteriocin. Consequently,
54-dependent genes as well as specific activators also required for expression of these genes were sought. Five putative
54-associated activators were detected in the genome of E. faecalis V583, and all but one could activate the transcription of permease genes belonging to sugar phosphotransferase systems (PTSs). Interestingly, these activators display a helicase signature not yet reported in this activator family, which could explain the ATP-dependent mechanism of DNA unwinding preceding the start of transcription. To find which activator is linked to susceptibility of E. faecalis to mesentericin Y105, their respective genes were subsequently interrupted. Among them, only mptR gene interruption led to a resistance phenotype. Immediately downstream from mptR, a putative
54-dependent operon was found to encode a mannose PTS permease, namely
. Moreover, in liquid culture, glucose and mannose induced the sensitivity of E. faecalis to mesentericin Y105. Since sugars have previously been reported to induce PTS permease expression, it appears that
expression, presumably induced in the presence of glucose and mannose, leads to an enhanced sensitivity of E. faecalis to the bacteriocin. Additional information was gained from knockouts within the permease operon. Interruption of the distal mptD gene, which encodes the IID subunit of
, strikingly led to resistance to mesentericin Y105. Moreover, MptD appears to be a peculiar membrane subunit, bearing an additional domain compared to most known IID subunits. According to these results,
is clearly involved in susceptibility to mesentericin Y105 and could even be its receptor at the E. faecalis surface. Finally, it is hypothesized that MptD could be responsible for the targeting specificity, via an interaction between its additional domain and mesentericin Y105. Keywords: antagonism, subclass IIa, phosphotransferase, sugar, helicase
Abbreviations: 2DG, 2-deoxyglucose; PTS, phosphotransferase system
| INTRODUCTION |
|---|
|
|
|---|
54 transcription factor is involved in sensitivity of L. monocytogenes (Robichon et al., 1997
54 directs the expression of an essential protein for sensitivity.
factors are subunits of bacterial RNA polymerase holoenzymes responsible for recognition of promoters. Among the
family,
54 is a unique factor (Merrick, 1993
54-associated activators, share a conserved central domain, already used to identify new protein members of this family. The first
54 factor described in Gram-positive bacteria is encoded by sigL in Bacillus subtilis (Débarbouillé et al., 1991b
Interestingly, most of the subclass IIa bacteriocins were described to be also active against another pathogenic species, E. faecalis, in which the
54 factor is involved in sensitivity (Dalet et al., 2001
). Consequently,
54-associated activators and
54-dependent genes were sought and analysed. Knockout of these different genes was then achieved to study their involvement in E. faecalis sensitivity to mesentericin Y105.
| METHODS |
|---|
|
|
|---|
DNA manipulations and gene interruption.
Molecular cloning and DNA manipulations were performed as described previously (Sambrook et al., 1989
). Restriction and modification enzymes purchased from Life technologies were used as recommended by the manufacturer. Internal gene fragments, used for knockout experiments, were amplified by PCR with the following primers bearing a HindIII site: mpoR primers, GTCAAGCTTCTGGCTATACCCG and TTTTAAGCTTCGCCCATCCGTG; mptR primers, GTAAAGCTTTGAATCAACTGGTTCG and CAGAAAGCTTCCATCTGCTTCATC; mphR primers, TCAAAGCTTCCAAGAAATGATCGATG and TGGCAAAGCTTAACCGACACG; lpoR primers, AGTAAGCTTCGGACAAGTCAGCG and TCCAAGCTTAATGGCAAAAGCAGATG; mptB primers, CGTTAAGCTTGAATTGATGATCG and AATAAGCTTGGCTGTCTGCTGC; mptD primers, AGCTGAAGCTTGGCGTTCAAC and AGAACAAGCTTTGTAACCAAACTC. The resulting PCR fragments were digested with HindIII and ligated at the same site in pUCB300 (Frère et al., 1993
), a non-replicative plasmid bearing an erythromycin-resistance gene. It gave rise to the pEF17 (mpoR), pEF16 (mptR), pEF23 (mphR), pEF5 (lpoR), pEF18 (mptB) and pEF19 (mptD) plasmids. They were then used to transform E. faecalis JH2-2 as described by Wyckoff et al. (1991)
to achieve independent gene knockout by homologous recombination with the E. faecalis JH2-2 chromosome. The resulting interrupted mutants (erythromycin-resistant) from each experiment were analysed by Southern blotting of chromosomal DNA (Sambrook et al., 1989
), previously digested by HindIII. The DNA probes used for hybridization were synthesized by random priming from the PCR fragments described above.
2-Deoxyglucose-resistant strain selection.
E. faecalis JH2-2 was grown on LB agar plates supplemented with fructose at 2 g l-1, as a carbon source, and 2-deoxyglucose (2DG), a non-metabolizable analogue of glucose, at 10 mM. The resulting colonies, corresponding to the growth of 2DG-resistant mutants, were isolated twice on the same medium. 2-DG is a toxic molecule that enters bacteria via a PTS permease of the mannose family (Bond et al., 1999
). Consequently, this permease is not usually expressed in 2DG-resistant mutants.
Bacteriocin purification and assays.
Mesentericin Y105, produced by Leuconostoc mesenteroides Y105, was purified as previously described (Guyonnet et al., 2000
). E. faecalis susceptibility was assayed by spot on lawn or microtitre plate tests. The former was achieved by overlaying a BHI agar plate (1·5%) with a BHI agar lawn (0·7%) inoculated at 1% with an E. faecalis culture. Purified mesentericin Y105 (5 µl) was spotted on the lawn and the plate was then incubated overnight at 37 °C before inhibition zones were noted. The microtitre plate assay was carried out by inoculating 200 µl BHI or LB supplemented with various sugars at 2 g l-1. Bacterial growth was monitored by measurement of the OD620 and 5 µl purified mesentericin Y105 was added when the OD620 reached 0·1.
DNA sequencing.
Cycle sequencing was achieved with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer) and analysed with the ABI Prism 310 genetic analyser. Sequence data from E. faecalis V583 were obtained from the Institute for Genomic Research through the website at http://www.tigr.org/.
| RESULTS |
|---|
|
|
|---|
54-dependent genes
54-associated activators nor
54-dependent genes have been reported so far in E. faecalis. We first looked for
54-associated activator genes within the E. faecalis V583 genome, taking advantage of two main features: one, the activator genes are often found upstream from the
54-dependent genes they control; and two, the activator proteins have a highly conserved central domain, used for their identification (Studholme & Buck, 2000
Thus, we first used an amino acid sequence of the central domain to screen the E. faecalis V583 genome. BLAST results displayed five high scores (>45% identities), corresponding to five ORFs, named mpoR, mptR, mphR, lpoR and xpoR. These genes potentially encode
54-associated activators of 937, 961, 923, 901 and 403 amino acids, respectively. The latter, xpoR, is interrupted by a sequence which is identical to the transposon Tn4001 from Staphylococcus aureus (Byrne et al., 1989
). Interestingly, all these activators share highest identities, about 30%, with an unusual member of the
54-associated activator family, LevR of B. subtilis (Débarbouillé et al., 1991a
). Besides the classical motifs usually described in
54-associated activators, the central domain of all these activators displayed a DEAH motif, according to Prosite (Fig. 1
), usually found in helicases. Such similarities with helicases have already been looked for in activators to explain their involvement in DNA conformational changes (Buck et al., 2000
), but none have been found. We suggest that, owing to the presence of the DEAH motifs, these activators could be directly responsible for ATP-dependent DNA unwinding, allowing initiation of transcription. In addition, we found degenerate DEAH motifs in all the other
54-associated activators so far described in the database (data not shown), indicating that they could also bear a helicase activity.
|
54. A
54 promoter was found just downstream of every activator gene, except the truncated xpoR, therefore preceding a putative
54-dependent operon. Four ORFs were found in each operon downstream of mpoR, mptR and mphR (Fig. 2
54 promoter sequences were found, respectively followed by three ORFs that putatively encode proteins with highest similarities with PTS permease of the lactose family, i.e. IIALac, IIBLac and IICLac subunits. Surprisingly, all these
54-dependent operons probably encode a PTS permease, while to date only one
54-dependent PTS permease has been described (Débarbouillé et al., 1991a
|
54-associated activators in sensitivity to mesentericin Y105
54 involvement were conducted with the latter strain. Each activator gene, i.e. mpoR, mptR, mphR and lpoR, was knocked-out in E. faecalis JH2-2 to assess its involvement in mesentericin Y105 sensitivity. To this aim, an internal fragment of each gene was amplified by PCR from JH2-2 genomic DNA and cloned in pUCB300. The resulting plasmids were independently used to transform E. faecalis JH2-2 and led to homologous recombination in the chromosome. Knockout of mpoR, mptR, mphR and lpoR, verified by both PCR and Southern blotting (data not shown), led to the JH8, JH7, JH11 and JH3 strains, respectively.
The sensitivity of these knockout strains was then tested by a spot on lawn assay with purified mesentericin Y105 (Table 1
). E. faecalis JH3, JH8 and JH11 remained sensitive to mesentericin Y105, similarly to the wild-type JH2-2 strain. In contrast, the JH7 strain (knockout of mptR) became fully resistant to purified mesentericin Y105, as was the previously described JH1 strain (
54-deficient mutant) (Dalet et al., 2001
). Consequently, MptR is the only E. faecalis
54-associated activator presumably involved in sensitivity to mesentericin Y105. This suggests that MptR and
54 control the expression of proteins involved in E. faecalis sensitivity to mesentericin Y105.
|
in sensitivity to mesentericin Y105
54-associated activator genes were often found just upstream of the operon controlled by the activator. Downstream of mptR, four ORFs flanked by two hairpin loops with a calculated free energy of -84 and -109·2 kJ, respectively, probably compose an operon, named mpt. As described above, these ORFs putatively encode four proteins that display highest similarities with PTS permease components of the mannose family. They were consequently named MptB (170 aa), MptA (342 aa), MptC (267 aa) and MptD (303 aa). Knockout of mptB and mptD, the proximal and the distal genes of the mpt operon, was achieved independently by homologous recombination, leading to the JH9 and JH10 mutants, respectively. These knockout mutants were tested for sensitivity to mesentericin Y105. They were both resistant to mesentericin Y105, as were MptR- and
54-deficient mutants (Table 1
54. Moreover, since knockout of mptD, the distal gene of the operon, led to resistance, the corresponding MptD protein should play a crucial role in sensitivity. In this respect, the resistance of JH9 (knockout of mptB) was probably due to the lack of mptD expression through a polar effect. Interestingly, MptD displays an additional domain compared to the other IID subunits found within the E. faecalis genome (Fig. 3
|
, is actually involved in sensitivity to mesentericin Y105, because 2DG-resistant strains are known to be defective in EIIMan expression (Veyrat et al., 1994
Sugar effects on E. faecalis JH2-2 sensitivity to mesentericin Y105
Since E. faecalis JH2-2 sensitivity to mesentericin Y105 seems to be linked to a specific PTS mannose permease, the effect of various sugars on sensitivity was tested. Indeed, expression of PTS permeases is specifically induced by the transported sugar (Saier & Reizer, 1994
). E. faecalis JH2-2 was grown in LB medium supplemented independently with the following sugars at 2 g l-1: fructose, cellobiose, glucose and mannose. Fig. 4
shows that the sensitivity of E. faecalis was highly increased in the presence of glucose or mannose, compared to cellobiose or fructose. E. faecalis was also weakly sensitive to mesentericin Y105 in LB medium without any added sugar (data not shown). This suggests that glucose and mannose activate the expression of a protein involved in sensitivity to mesentericin Y105, probably the
PTS permease.
|
| DISCUSSION |
|---|
|
|
|---|
54 factor of E. faecalis is involved in sensitivity to mesentericin Y105 and various subclass IIa bacteriocins (Dalet et al., 2001
54 regulon, via the characterization of five
54-associated activators and several
54-dependent genes. Although previous sequence analysis of
54-associated activators did not reveal any similarity with helicases (Buck et al., 2000
According to the acquired resistance phenotype displayed by knockout mutants, MptR appears as the only one, among the five activators, to be involved in sensitivity to mesentericin Y105. MptR probably activates the transcription, together with
54, of the flanking downstream operon, which encodes a mannose PTS permease,
. In addition, knockout within this operon also led to resistance, which supports
being involved in resistance and being dependent on MptR. We have also recently shown that knockout within an operon encoding a
54-dependent PTS permease of the mannose family leads to L. monocytogenes resistance (K. Dalet, Y. Cenatiempo, P. Cossart, The European Listeria Genome Consortium and Y. Héchard, unpublished results). Moreover, the IIAB subunit of a mannose PTS permease was shown to be absent in a spontaneous mutant of L. monocytogenes resistant to leucocin A (Ramnath et al., 2000
), favouring the lack of EIIMan expression. Another spontaneous mutant of L. monocytogenes, resistant to pediocin PA-1 (a subclass IIa bacteriocin), has been reported by others to overexpress a PTS permease from the ß-glucoside family (Gravesen et al., 2000
). However, the same group found out that knockout of the ß-glucoside operon did not modify the sensitivity to pediocin PA-1 and that this PTS is also overexpressed in our L. monocytogenes rpoN mutant, lacking
54 (A. L. Gravesen, personal communication). These results on both E. faecalis and L. monocytogenes point towards an essential role of an EIIMan permease in sensitivity to mesentericin Y105 and related subclass IIa bacteriocins. Our current hypothesis is that EIIMan is probably a receptor for these bacteriocins. Finally, we showed that the presence of glucose and mannose in the culture medium greatly increases E. faecalis sensitivity to mesentericin Y105. Since PTS permease expression has been reported to be specifically induced by transported sugars, we hypothesize that glucose and mannose induce the expression of
, thereby leading to an increase in the number of potential protein receptors for mesentericin Y105.
Further data favour the above hypotheses and focus on a particular component of the permease. Knockout of mptD, the distal gene of this operon, led to resistance and thus the corresponding MptD subunit seems essential in E. faecalis sensitivity to mesentericin Y105. In L. monocytogenes, knockout or in-frame deletion of a gene, encoding a IIDMan subunit, also led to resistance (K. Dalet, Y. Cenatiempo, P. Cossart, The European Listeria Genome Consortium and Y. Héchard, unpublished results). Moreover, this IIDMan subunit of L. monocytogenes harbours an additional motif, as found here in E. faecalis MptD, and the above-mentioned in-frame deletion removed this domain. Thus, in these two organisms, the IID subunit of the EIIMan involved in sensitivity bears an additional motif (a putative external loop) not found within the other IID subunits described, except ManN of S. salivarius. The additional domain of E. faecalis shares 64% similarity with that of L. monocytogenes and only 39% with that of S. salivarius. Moreover, IID subunits are integral membrane proteins and could therefore interact directly with mesentericin Y105. Accordingly, we propose that an EIIMan is a receptor for various subclass IIa bacteriocins in L. monocytogenes and E. faecalis and that its IIDMan component plays a central role in bacteriocin action, probably by a direct proteinprotein interaction involving the additional domain.
Whether an EIIMan is also implicated in sensitivity to subclass IIa bacteriocins when present in other bacteria is being analysed. Direct proteinprotein interaction between subclass IIa bacteriocins and the permease will be further investigated, together with the implication of the additional domain found in their IID components.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bond, D. R., Tsai, B. M. & Russell, J. B. (1999). Physiological characterization of Streptococcus bovis mutants that can resist 2-deoxyglucose-induced lysis. Microbiology 145, 2977-2985.
Breukink, E. & de Kruijff, B. (1999). The lantibiotic nisin, a special case or not? Biochim Biophys Acta 1462, 223-234.[Medline]
Buck, M., Gallegos, M. T., Studholme, D. J., Guo, Y. & Gralla, J. D. (2000). The bacterial enhancer-dependent sigma(54) (sigma(N)) transcription factor. J Bacteriol 182, 4129-4136.
Byrne, M. E., Rouch, D. A. & Skurray, R. A. (1989). Nucleotide sequence analysis of IS256 from the Staphylococcus aureus gentamicin-tobramycin-kanamycin-resistance transposon Tn4001. Gene 81, 361-367.[Medline]
Dalet, K., Briand, C., Cenatiempo, C. & Héchard, Y. (2001). The rpoN gene of Enterococcus faecalis directs sensitivity to subclass IIa bacteriocins. Curr Microbiol 41, 441-443.
Débarbouillé, M., Martin-Verstraete, I., Klier, A. & Rapoport, G. (1991a). The transcriptional regulator LevR of Bacillus subtilis has domains homologous to both sigma 54- and phosphotransferase system-dependent regulators. Proc Natl Acad Sci USA 88, 2212-2216.
Débarbouillé, M., Martin-Verstraete, I., Kunst, F. & Rapoport, G. (1991b). The Bacillus subtilis sigL gene encodes an equivalent of sigma 54 from gram-negative bacteria. Proc Natl Acad Sci USA 88, 9092-9096.
Ennahar, S., Sashihara, T., Sonomoto, K. & Ishizaki, A. (2000). Class IIa bacteriocins: biosynthesis, structure and activity. FEMS Microbiol Rev 24, 85-106.[Medline]
Frère, J., Benachour, A., Novel, M. & Novel, G. (1993). Identification of the theta-type minimal replicon of the Lactococcus lactis subsp. lactis CNRZ270 lactose protease plasmid pUCL22. Curr Microbiol 27, 97-102.
Gravesen, A., Warthoe, P., Knochel, S. & Thirstrup, K. (2000). Restriction fragment differential display of pediocin-resistant Listeria monocytogenes 412 mutants shows consistent overexpression of a putative ß-glucoside-specific PTS system. Microbiology 146, 1381-1389.
Guyonnet, D., Fremaux, C., Cenatiempo, Y. & Berjeaud, J.-M. (2000). Method for rapid purification of class IIa bacteriocins and comparison of their activities. Appl Environ Microbiol 66, 1744-1748.
Héchard, Y., Dérijard, B., Letellier, F. & Cenatiempo, Y. (1992). Characterization and purification of mesentericin Y105, an anti-Listeria bacteriocin from Leuconostoc mesenteroides. J Gen Microbiol 138, 2725-2731.[Medline]
Jack, R. W., Tagg, J. R. & Ray, B. (1995). Bacteriocins of gram-positive bacteria. Microbiol Rev 59, 171-200.
Klaenhammer, T. R. (1993). Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol Rev 12, 39-85.[Medline]
Maftah, A., Renault, D., Vignoles, C., Héchard, Y., Bressollier, P., Ratinaud, M. H., Cenatiempo, Y. & Julien, R. (1993). Membrane permeabilization of Listeria monocytogenes and mitochondria by the bacteriocin mesentericin Y105. J Bacteriol 175, 3232-3235.
Merrick, M. J. (1993). In a class of its own the RNA polymerase sigma factor sigma 54 (sigma N). Mol Microbiol 10, 903-909.[Medline]
Postma, P. W., Lengeler, J. W. & Jacobson, G. R. (1993). Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57, 543-594.
Ramnath, M., Beukes, M., Tamura, K. & Hastings, J. W. (2000). Absence of a putative mannose-specific phosphotransferase system enzyme IIAB component in a leucocin A-resistant strain of Listeria monocytogenes, as shown by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Appl Environ Microbiol 66, 3098-3101.
Robichon, D., Gouin, E., Débarbouillé, M., Cossart, P., Cenatiempo, Y. & Héchard, Y. (1997). The rpoN (sigma54) gene from Listeria monocytogenes is involved in resistance to mesentericin Y105, an antibacterial peptide from Leuconostoc mesenteroides. J Bacteriol 179, 7591-7594.
Saier, M. H.Jr & Reizer, J. (1994). The bacterial phosphotransferase system: new frontiers 30 years later. Mol Microbiol 13, 755-764.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Studholme, D. J. & Buck, M. (2000). The biology of enhancer-dependent transcriptional regulation in bacteria: insights from genome sequences. FEMS Microbiol Lett 186, 1-9.[Medline]
Veyrat, A., Monedero, V. & Perez-Martinez, G. (1994). Glucose transport by the phosphoenolpyruvate:mannose phosphotransferase system in Lactobacillus casei ATCC 393 and its role in carbon catabolite repression. Microbiology 140, 1141-1149.
Wyckoff, H. A., Sandine, W. E. & Kondo, J. K. (1991). Transformation of dairy Leuconostoc using plasmid vectors from Bacillus, Escherichia and Lactococcus hosts. J Dairy Sci 74, 1454-1460.[Abstract]
Received 1 November 2000;
revised 6 January 2001;
accepted 11 January 2001.
This article has been cited by other articles:
![]() |
P. M. Swe, G. M. Cook, J. R. Tagg, and R. W. Jack Mode of action of dysgalacticin: a large heat-labile bacteriocin J. Antimicrob. Chemother., April 1, 2009; 63(4): 679 - 686. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rihakova, V. W. Petit, K. Demnerova, H. Prevost, S. Rebuffat, and D. Drider Insights into Structure-Activity Relationships in the C-Terminal Region of Divercin V41, a Class IIa Bacteriocin with High-Level Antilisterial Activity Appl. Envir. Microbiol., April 1, 2009; 75(7): 1811 - 1819. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. K. Heng, G. A. Burtenshaw, R. W. Jack, and J. R. Tagg Ubericin A, a Class IIa Bacteriocin Produced by Streptococcus uberis Appl. Envir. Microbiol., December 1, 2007; 73(23): 7763 - 7766. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Calvez, A. Rince, Y. Auffray, H. Prevost, and D. Drider Identification of new genes associated with intermediate resistance of Enterococcus faecalis to divercin V41, a pediocin-like bacteriocin Microbiology, May 1, 2007; 153(5): 1609 - 1618. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deutscher, C. Francke, and P. W. Postma How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 939 - 1031. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bieler, F. Silva, C. Soto, and D. Belin Bactericidal Activity of both Secreted and Nonsecreted Microcin E492 Requires the Mannose Permease. J. Bacteriol., October 1, 2006; 188(20): 7049 - 7061. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Drider, G. Fimland, Y. Hechard, L. M. McMullen, and H. Prevost The Continuing Story of Class IIa Bacteriocins Microbiol. Mol. Biol. Rev., June 1, 2006; 70(2): 564 - 582. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Diep, L. Godager, D. Brede, and I. F. Nes Data mining and characterization of a novel pediocin-like bacteriocin system from the genome of Pediococcus pentosaceus ATCC 25745 Microbiology, June 1, 2006; 152(6): 1649 - 1659. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. E. Kramer, S. A. F. T. van Hijum, J. Knol, J. Kok, and O. P. Kuipers Transcriptome Analysis Reveals Mechanisms by Which Lactococcus lactis Acquires Nisin Resistance. Antimicrob. Agents Chemother., May 1, 2006; 50(5): 1753 - 1761. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tominaga and Y. Hatakeyama Determination of Essential and Variable Residues in Pediocin PA-1 by NNK Scanning Appl. Envir. Microbiol., February 1, 2006; 72(2): 1141 - 1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Yebra, V. Monedero, M. Zuniga, J. Deutscher, and G. Perez-Martinez Molecular analysis of the glucose-specific phosphoenolpyruvate : sugar phosphotransferase system from Lactobacillus casei and its links with the control of sugar metabolism Microbiology, January 1, 2006; 152(1): 95 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Tsang, J. Merritt, T. Nguyen, W. Shi, and F. Qi Identification of genes associated with mutacin I production in Streptococcus mutans using random insertional mutagenesis Microbiology, December 1, 2005; 151(12): 3947 - 3955. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Johnsen, G. Fimland, and J. Nissen-Meyer The C-terminal Domain of Pediocin-like Antimicrobial Peptides (Class IIa Bacteriocins) Is Involved in Specific Recognition of the C-terminal Part of Cognate Immunity Proteins and in Determining the Antimicrobial Spectrum J. Biol. Chem., March 11, 2005; 280(10): 9243 - 9250. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xue, I. Hunter, T. Steinmetz, A. Peters, B. Ray, and K. W. Miller Novel Activator of Mannose-Specific Phosphotransferase System Permease Expression in Listeria innocua, Identified by Screening for Pediocin AcH Resistance Appl. Envir. Microbiol., March 1, 2005; 71(3): 1283 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ramnath, S. Arous, A. Gravesen, J. W. Hastings, and Y. Hechard Expression of mptC of Listeria monocytogenes induces sensitivity to class IIa bacteriocins in Lactococcus lactis Microbiology, August 1, 2004; 150(8): 2663 - 2668. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vadyvaloo, J. L. Snoep, J. W. Hastings, and M. Rautenbach Physiological implications of class IIa bacteriocin resistance in Listeria monocytogenes strains Microbiology, February 1, 2004; 150(2): 335 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Katla, K. Naterstad, M. Vancanneyt, J. Swings, and L. Axelsson Differences in Susceptibility of Listeria monocytogenes Strains to Sakacin P, Sakacin A, Pediocin PA-1, and Nisin Appl. Envir. Microbiol., August 1, 2003; 69(8): 4431 - 4437. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vadyvaloo, J. W. Hastings, M. J. van der Merwe, and M. Rautenbach Membranes of Class IIa Bacteriocin-Resistant Listeria monocytogenes Cells Contain Increased Levels of Desaturated and Short-Acyl-Chain Phosphatidylglycerols Appl. Envir. Microbiol., November 1, 2002; 68(11): 5223 - 5230. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fimland, V. G. H. Eijsink, and J. Nissen-Meyer Comparative studies of immunity proteins of pediocin-like bacteriocins Microbiology, November 1, 2002; 148(11): 3661 - 3670. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gravesen, M. Ramnath, K. B. Rechinger, N. Andersen, L. Jansch, Y. Hechard, J. W. Hastings, and S. Knochel High-level resistance to class IIa bacteriocins is associated with one general mechanism in Listeria monocytogenes Microbiology, August 1, 2002; 148(8): 2361 - 2369. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dalet, Y. Cenatiempo, P. Cossart, and Y. Hechard A {sigma}54-dependent PTS permease of the mannose family is responsible for sensitivity of Listeria monocytogenes to mesentericin Y105 Microbiology, December 1, 2001; 147(12): 3263 - 3269. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |