Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marx, C. J.
Right arrow Articles by Lidstrom, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marx, C. J.
Right arrow Articles by Lidstrom, M. E.
Agricola
Right arrow Articles by Marx, C. J.
Right arrow Articles by Lidstrom, M. E.
Microbiology (2001), 147, 2065-2075.
© 2001 Society for General Microbiology


Genetics and Molecular Biology

Development of improved versatile broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria

Christopher J. Marx1 and Mary E. Lidstrom1,2

Departments of 1Microbiology, Box 357242, and 2Chemical Engineering, Box 351750, University of Washington, Seattle, WA 98195-1750, USA

Author for correspondence: Mary E. Lidstrom. Tel: +1 206 616 5282. Fax: +1 206 616 5721. e-mail: lidstrom{at}u.washington.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Full exploitation of the information available in bacterial genome sequences requires the availability of facile tools for rapid genetic manipulation. One bacterium for which new genetic tools are needed is the methylotroph Methylobacterium extorquens AM1. IncQ and small IncP vectors were shown to be unsuitable for use in this bacterium, but a spontaneous mutant of a small IncP plasmid was isolated that functioned efficiently in M. extorquens AM1. This plasmid was sequenced and used as a base for developing improved broad-host-range cloning vectors. These vectors were found to replicate in a wide variety of bacterial species and have the following advantages: (1) high copy number in Escherichia coli; (2) small size (7·2 and 8·0 kb); (3) complete sequences; (4) variety of unique restriction sites; (5) blue–white screening via lacZ{alpha}; (6) conjugative mobilization between bacterial species; and (7) readily adaptable into species-specific promoter-probe and expression vectors. Two low-background promoter-probe vectors were constructed based on these cloning vectors with either lacZ or xylE as reporter genes; these were shown to report gene expression effectively in M. extorquens AM1. Specific expression vectors were developed for use in M. extorquens AM1, which were shown to express foreign genes at significant levels, and a simple strategy is outlined to develop specific expression vectors for other bacteria. The strong mxaF promoter was used for expression, since E. coli lac-derived promoters were expressed at very low levels. This suite of genetic tools will enable a more sophisticated analysis of the physiology of M. extorquens AM1, and these vectors should also be valuable tools in the study of a variety of bacterial species.

Keywords: plasmids, cloning vectors, expression vectors, promoter-probe vectors, Methylobacterium extorquens AM1

Abbreviations: Ap, ampicillin; ßGal, ß-galactosidase; bhr, broad-host-range; Km, kanamycin; LB, Luria–Bertani (medium); oligo, oligodeoxyribonucleotide; ori, origin(s) of DNA replication; P, promoter; Rif, rifamycin; Sm, streptomycin; t, terminator of transcription; Tc, tetracycline; wt, wild-type

The GenBank accession numbers for the sequences reported in this paper are AF327711, AF327712, AF327713, AF327714, AF327715, AF327716, AF327717, AF327718, AF327719 and AF327720.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
In the past six years, the complete nucleotide sequences for dozens of prokaryotic genomes have been determined and published, and nearly 200 more are currently being sequenced (listed at http://216.190.101.28/GOLD/). Advances in bioinformatics have permitted phylogenetic classification of up to 80% of the putative ORFs in these organisms (Tatusov et al., 2000Down ). Biochemical and genetic experiments are required to test the myriad of biological hypotheses that have been generated. A major hurdle for studying the majority of these organisms is the paucity of sophisticated genetic tools. The capabilities and user-friendliness of broad-host-range (bhr) vector tools lag far behind those of the plasmids available for use in model organisms such as Escherichia coli. In order to take full advantage of the wealth of information available from bacterial genome sequencing, significant advances in the quality of bhr vectors are required.

The majority of bhr vectors are based upon IncP or IncQ replicons. Most IncP plasmids are derived from RK2, a 60·1 kb self-transmissible plasmid (Pansegrau et al., 1994Down ). RK2 has an estimated copy number in E. coli of five to seven per chromosome (Figurski et al., 1979Down ), and plasmids containing the IncP origin of transfer, oriT, can be mobilized by IncP transfer proteins provided in trans (Figurski & Helinski, 1979Down ). Currently available vector tools based on IncP replicons are low- to medium-copy in E. coli, and few are fully sequenced or have a large number of available restriction sites.

Methylobacterium extorquens AM1 is an example of an organism for which improved genetic tools are needed. The {alpha}-proteobacterium M. extorquens AM1 is the best-studied representative of the methylotrophic bacteria, which are those capable of using single-carbon (C1) substrates as their sole source of carbon and energy (Lidstrom, 1991Down ). Methylotrophs play a critical role in the biogeochemical cycling of C1 compounds (Hanson & Hanson, 1996Down ) and have the potential to convert alternate feedstocks, such as methanol or methane, into fine chemicals and/or biopolymers. M. extorquens AM1 is a facultative methylotroph capable of growth on C1 substrates, such as methanol and methylamine, as well as on a limited number of multi-carbon compounds, such as succinate and pyruvate. The ability to grow on nonmethylotrophic compounds and the ease of DNA transfer by either conjugation (Windass et al., 1980Down ) or electroporation (Toyama et al., 1998Down ) have made M. extorquens AM1 a model organism for the genetic dissection of the methylotrophic metabolism. In addition, the availability of genome-level sequence data for this strain (http://faculty.washington.edu/lidstrom/genome/genome/genome.html) is providing a rich database of information on metabolic potential. Thus far, only large (19–23 kb) IncP vectors with limited cloning sites available have been used with success in M. extorquens AM1. These include the cloning vectors pRK310 (Ditta et al., 1985Down ) and pVK100 (Knauf & Nester, 1982Down ), and the promoter-probe vectors pHX200 (Xu et al., 1993Down ) and pGD500 (Ditta et al., 1985Down ). No IncQ vectors or smaller IncP vectors have been found to be maintained in this strain (Lidstrom, 1992Down ). Here we present the isolation of a spontaneous mutant of a small IncP plasmid that functions efficiently in M. extorquens AM1, the development of improved bhr cloning vectors based upon this plasmid, and their modification into host-specific promoter-probe and expression tools.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacterial strains, plasmids and media.
Wild-type (wt) M. extorquens AM1 (Peel & Quayle, 1961Down ) and the UV-induced mxaF mutant UV26 (Nunn & Lidstrom, 1986Down ) were used for the experiments described. The E. coli strains JM109 (Promega) and TOP10 (Invitrogen) were used as the hosts for construction and amplification of all plasmids used in this study. The plasmids used in this study are presented in Table 1Down. M. extorquens AM1 was cultured at 30 °C in a minimal salts medium described previously (Harder et al., 1973Down ) containing 50 µg rifamycin (Rif) ml-1 and supplemented with either 125 mM methanol or 15 mM succinate. E. coli strains were grown in LB medium at 37 °C (Sambrook et al., 1989Down ). Additional antibiotics were used when relevant at the following concentrations (µg ml-1): 100 ampicillin (Ap), 50 kanamycin (Km), 35 streptomycin (Sm) and 10 (for M. extorquens AM1) or 12·5 (for E. coli) tetracycline (Tc).


View this table:
[in this window]
[in a new window]
 
Table 1. Plasmids used in this study

 
Genetic procedures and recombinant DNA techniques.
All DNA manipulations were performed according to standard techniques (Sambrook et al., 1989Down ). Plasmids were transferred between E. coli and M. extorquens AM1 by conjugative transfer using an E. coli helper strain bearing pRK2013 or pRK2073 as described previously (Chistoserdov et al., 1994Down ). DNA sequencing was performed at the Biochemistry DNA Sequencing Facility of the University of Washington.

Construction of the minimal transferable and selectable replicon for use in M. extorquens AM1.
The 2·0 kb NdeI–NotI region of pDN19X containing the traJ' allele that allowed efficient replication and/or transfer in M. extorquens AM1 was transferred into the corresponding region of pTJS75 (Schmidhauser & Helinski, 1985Down ), a parent vector of pDN19 (Nunn et al., 1990Down ), to create pCM48. The plasmid pCM48 was then cut with MunI and BlnI, and the DNA ends were blunted and self-ligated to produce pCM50. pCM50 was then digested with HindIII and XmnI, and the DNA ends were blunted and self-ligated to produce the 5·3 kb minimal transferable and selectable replicon pCM51. Two additional plasmids were created to confirm that the traJ' allele present in pDN19X is sufficient to maintain and/or transfer the plasmid into M. extorquens AM1. The 2·0 kb NdeI–NotI region surrounding the substitution in pDN19X was swapped into the corresponding region of pDN19 to create the plasmid pCM46. Similarly, the 2·0 kb NdeI–NotI region from pDN19 encoding the full-length TraJ was cloned into pDN19X to create the plasmid pCM47.

To compare the reduced gene complement of the minimal selectable and transferable replicon pCM51 to the cloning vector previously used with M. extorquens AM1, pRK310 (Ditta et al., 1985Down ), we have pieced together the complete sequence of this large IncP vector by determining the sequence over the junctions created during the partial digestion steps in its cloning history (Fig. 1Down).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Plasmid maps depicting the relevant features of the large IncP cloning vector pRK310, the small IncP cloning vector pDN19, and the minimal transferable and selectable IncP replicon pCM51. The C to A transversion present in pDN19X that created the truncated traJ' allele is diagrammed. The GenBank accession numbers for these plasmids are AF327712, AF327711 and AF327713, respectively.

 
Construction of improved bhr cloning vectors.
The improved bhr vector pCM62 was created by combining the functions present in the minimal transferable and selectable replicon pCM51 with the polylinker and ColE1 origin of replication (ori) of pUC19 (Fig. 1Up). This was accomplished by ligating the blunted 5·3 kb HindIII–XmnI region of pCM50 (used to make pCM51) with the blunted 1·9 kb AatII–AvaII region of pUC19 (Yanisch-Perron et al., 1985Down ). During the construction of pCM62 an additional 356 bp inward from the site of XmnI cleavage of pCM50 was lost, presumably caused by either non-specific cleavage or by the exonuclease activity of T4 DNA polymerase. Loss of this region leads to a small alteration of the C-terminus of the TetR protein, from ·GDD-COOH to ·GAKKPLLS-COOH, but this mutation does not adversely affect the tetracycline resistance conferred by this plasmid in either E. coli or M. extorquens AM1. A derivative of pCM62 conferring resistance to kanamycin, pCM66, was constructed by inserting the 1·3 kb HincII fragment of pUC4K (Veira & Messing, 1982Down ) between the EcoRV and NruI sites of pCM62 (Fig. 2Down).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Plasmid maps depicting the relevant features of the improved bhr cloning vectors pCM62 and pCM66. The GenBank accession numbers for these plasmids are AF327714 and AF327715.

 
Construction of plasmids containing the reporter genes xylE and gfp, and the PmxaFand mxaF gene of M. extorquens AM1.
xylE was amplified by PCR from the promoter-probe vector pHX200 (Xu et al., 1993Down ) using the following primers: CM-xylEf, 5'-TAGCTGCAGTAAGCTTCAGGAGGTGACGTC-3', and CM-xylEr, 5'-AGGGATCCGAGCTCCATCAGGTGAGCACGGTC-3'. The resulting PCR product was cloned into pCR2.1 (Invitrogen) to create pCM20. Two other plasmids were created to allow the introduction of xylE into various plasmids. The 1·0 kb HindIII–BamHI region of pCM20 containing xylE was cloned between the HindIII and BamHI sites of the cloning vector pMTL23 (Chambers et al., 1988Down ) to produce pCM22. Finally, the 1·0 kb HindIII–SacI fragment of pCM22 containing xylE was inserted into pMTL23 cut with HindIII and SacI to create pCM75. lacZ was amplified by PCR from pMUTIN2 (Vagner et al., 1998Down ) and cloned into pCR2.1 (Invitrogen) to create pLacZ2.1+ (R. Meima & M. E. Lidstrom, unpublished results). gfp was amplified by PCR from pGFPuv (Clontech) using the following primers: CM-gfpf, 5'-TAGCTGCAGTAAGCTTGTCGACTCTAGAGGATCCCC-3', and CM-gfpr, 5'-AGGGGATCCGAGCTCGGCGCTCAGTTGGAAT-3'. The resulting PCR product was cloned into pCR2.1 (Invitrogen) to create pCM21. An additional plasmid bearing gfp, pCM23, was created by inserting the 0·8 kb HindIII–NsiI fragment of pCM21 into pMTL23 cut with HindIII and NsiI. The PmxaF of M. extorquens AM1 was amplified by PCR from pDN411 (Nunn & Lidstrom, 1986Down ) using the following primers: CM-PmxaFf, 5'-TAGATCTCGACAAGCTTCCCGCTTGG-3', and CM-PmxaFr, 5'-AGGATCCGCGGTATCTCTCAGACG-3'. The resulting 324 bp PCR product was cloned into pCR2.1 (Invitrogen) to create pCM27. Similarly, a 1·9 kb region bearing the mxaF gene without its promoter was amplified by PCR from pDN411 (Nunn & Lidstrom, 1986Down ) using the following primer pair: CM-mxaFf, 5'-GGCATGCGAGGAGACGCAGGATG-3', and CM-mxaFr, 5'-CGAATTCCGGCTTCAGACGTTAC-3'. This product was introduced into pCR2.1 (Invitrogen) to create pCM74.

Construction of low-background promoter-probe vectors.
Two low-background bhr promoter-probe vectors with different reporters were created using the cloning vectors pCM62 and pCM66 as their vector backbone. The 1·0 kb HindIII–NcoI fragment from pCM75 containing xylE was inserted into pCM62 cut with AflIII and HindIII to create pCM76. Similarly, the 3·2 kb EcoRI fragment of pLacZ2.1+ (R. Meima & M. E. Lidstrom, unpublished) containing lacZ was blunted and cloned into the BamHI site of pCM66 which had been similarly blunted to create pCM66LacZ. pCM76 and pCM66LacZ were each found to have a high background reporter gene activity in M. extorquens AM1 (data not shown). To reduce this background activity, an E. coli terminator, trrnB, was introduced upstream of the multiple cloning sites on the two vectors. The 0·5 kb XbaI–XmnI fragment of pMTL20T1T2 (Cordes et al., 1996Down ) containing trrnB was excised, blunted and ligated into the blunted EcoRI site of pCM76 to create pCM130 (Fig. 3Down). The 1·0 kb EcoRI–RsrII fragment of pCM130 containing trrnB was then transferred into pCM66LacZ, cut with EcoRI and RsrII, to create pCM132 (Fig. 3Down). In order to test the ability of these vectors to detect promoter activity, the PmxaF of M. extorquens AM1 was introduced into both plasmids. The 0·4 kb EcoRI–BamHI fragment from pCM27 was cloned into pCM130 cut with EcoRI and BamHI to create pCM131. Similarly, the 0·4 kb EcoRI fragment from pCM27 was inserted into the EcoRI site of pCM132 to produce pCM133.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Plasmid maps depicting the relevant features of the low-background bhr promoter-probe vectors pCM130 and pCM132. The GenBank accession numbers for these plasmids are AF327719 and AF327720.

 
Construction of facile expression vectors specifically developed for use in M. extorquens AM1.
The first step toward the creation of the expression vector pCM80 was the introduction of the PmxaF of M. extorquens AM1 into pCM62. This was accomplished by ligating the 0·4 kb HindIII–BamHI fragment of pCM27 into pCM62 cut with HindIII and BamHI to produce pCM64. To keep the HindIII site in the pCM80 polylinker unique, pCM64 was cut with HindIII, blunted with T4 DNA polymerase, and self-ligated to produce pCM79. Finally, the polylinker present in pCM62, including an intact lacZ{alpha}, was restored through the introduction of a 64 bp linker (Fig. 4Down). A pair of overlapping oligos with BamHI compatible 5' overhangs were designed for this purpose: CM-L64f, 5'-GATCTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAG - 3', and CM-L64r, 5'-GATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGA-3'. These oligos were mixed to a final concentration of 100 µM each in distilled water, heated to 95 °C for 5 min, and then allowed to cool at 70 °C for 5 min followed by 50 °C for 5 min. The linker was then added directly to a ligation mix containing pCM79 cut with BamHI. Plates containing X-Gal were used to screen for clones containing a linker region inserted in the desired orientation. Restriction analysis and sequence data across this region from one such clone, pCM80, confirmed the genuine insertion of a single linker in the desired orientation (Fig. 4Down). A kanamycin-resistant derivative, pCM160, was created by ligating together the 2·4 kb NotI–EcoRI region of pCM80 containing PmxaF with the 5·6 kb NotI–EcoRI region of pCM66 containing the kanamycin-resistance cassette (Fig. 4Down).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Plasmid maps depicting the relevant features of the M. extorquens AM1 expression vectors pCM80, pCM110 and pCM160. The GenBank accession numbers for these plasmids are AF327716, AF327718 and AF327717, respectively.

 
A number of genes were introduced into pCM80 and pCM62, in order to demonstrate the utility of pCM80 as an expression vector. The 0·8 kb HindIII–BglII fragment of pCM23 bearing gfp was inserted into both pCM62 and pCM80 cut with HindIII and BamHI to create pCM87 and pCM88. Similarly, the 1·0 kb HindIII–BamHI fragment of pCM22 containing xylE was introduced into both pCM62 and pCM80 cut with HindIII and BamHI to produce pCM63 and pCM81, respectively. Finally, the 2·0 kb HindIII–XbaI fragment of pCM74 containing mxaF was cloned into both pCM62 and pCM80 cut with HindIII and XbaI, generating pCM85 and pCM86.

In addition to pCM80 and pCM160, an additional expression vector, pCM110, was created that would provide minimal expression in E. coli to allow toxic genes to be introduced into M. extorquens AM1 (Fig. 4Up). pCM110 was constructed by inserting the 0·4 kb HindIII–NsiI fragment of pCM27 containing PmxaF into pCM60 (C. J. Marx & M. E. Lidstrom, unpublished results) which had been cut with HindIII and NsiI. To compare expression from the PmxaF in pCM80 to that in pCM110, the 1·0 kb EcoRI fragment from pCM20 containing xylE was inserted into the EcoRI site in pCM110 to create pCM111.

Reporter gene assays and SDS-PAGE analysis of vector expression.
Cell extracts for enzyme assays and SDS-PAGE gels were prepared from mid-exponential cultures of M. extorquens AM1 harvested at an OD600 of 0·7–0·8, as determined using 1·0 cm cuvettes in a Beckmann DU 640B spectrophotometer. XylE and ß-galactosidase (ßGal) assays are reported as the mean and standard deviation of three replicates and were performed as described previously (Zukowski et al., 1983Down ; Kataeva & Golovleva, 1990Down ; Miller, 1972Down ). XylE activities in E. coli JM109 were assayed in extracts prepared from cultures grown to an OD600 of 0·6–1·0 in LB. The total protein was estimated either by direct spectrophotometric methods (Kalb & Bernlohr, 1977Down ; Whitaker & Granum, 1980Down ) for enzyme assays, or by the Bradford method using the Protein Assay Kit (Bio-Rad), using BSA as a standard, for SDS-PAGE analysis on 15% gels. The relative intensities of selected bands on Coomassie-blue-stained SDS-PAGE gels were determined using Kodak 1D Image Analysis Software (Eastman Kodak).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Isolation of a spontaneous mutant of the small IncP plasmid pDN19 that could be maintained efficiently in M. extorquens AM1
The initial step toward the construction of improved genetic tools for use in M. extorquens AM1 was to examine a few small bhr vectors for their ability to be transferred by conjugation and maintained efficiently relative to the large IncP cloning vector pRK310 (Ditta et al., 1985Down ). The plasmids tested included the small IncP vectors pDN19 (Nunn et al., 1990Down ) and pJB656 (Blatny et al., 1997Down ), the IncQ vector pMMB67HE.tet (Jiang & Howard, 1992Down ), and pBBR1MCS-2 from Bordetella bronchiseptica (Kovach et al., 1995Down ). Tetracycline-resistant colonies were not obtained using pMMB67HE.tet, consistent with the previous observation that IncQ plasmids serve as suicide plasmids in Methylobacterium strains (Biville et al., 1989Down ). The vectors pJB656 and pBBR1MCS-2 could be established in M. extorquens AM1. However, both plasmids were transferred at a low efficiency relative to pRK310 and caused M. extorquens AM1 to grow at a significantly reduced growth rate. Only the small IncP vector pDN19 was maintained at a growth rate comparable to strains carrying pRK310 (data not shown), and was thus chosen as the basis for further vector development.

Initially, it appeared that pDN19 was transferred from E. coli to M. extorquens AM1 with an efficiency 1000 times less than that observed for pRK310. Following transfer of pDN19 from M. extorquens AM1 back into E. coli, however, the plasmid could be reintroduced into M. extorquens AM1 at the same high transfer efficiency as pRK310 (data not shown). This result suggested that the original pDN19 plasmid may have acquired a mutation that increased its transfer efficiency or the ability of M. extorquens AM1 to maintain this plasmid. No difference was observed in the maintenance of this plasmid derivative in E. coli (data not shown). We designated this pDN19 derivative as pDN19X.

Sequencing of pDN19 and the identification of the spontaneous mutation present in pDN19X
The exact sequence of the RK2-derived vector pDN19 (Nunn et al., 1990Down ) was not known. Therefore, single-strand sequence was obtained for pDN19. A map of pDN19 and the features present on this plasmid are presented in Fig. 1Up. Seven single-nucleotide differences were observed relative to the reported sequence of RK2. These included single-nucleotide deletions and insertions, and nucleotide replacements. The only changes present in coding regions disrupt upf-16.5, a putative ORF of unknown function (Pansegrau et al., 1994Down ). The single-strand sequence of pDN19X revealed a single nucleotide difference relative to the parent plasmid, pDN19, which was located within traJ. This C to A transversion results in an early stop codon in traJ, whose gene product recognizes the origin of transfer, oriT, initiating the DNA-processing events required for conjugal transfer (Ziegelin et al., 1989Down ). This early stop codon creates a TraJ' polypeptide that is missing the final 85 of 123 amino acids.

To determine whether the traJ' allele of pDN19X is sufficient to increase the maintenance and/or transfer of this plasmid in M. extorquens AM1, a 2·0 kb region encompassing traJ was swapped between pDN19X and the corresponding region of pDN19 to create pCM46. Similarly, the region from pDN19 encoding the full-length TraJ was cloned into pDN19X to create pCM47. The plasmid pCM46 bearing the mutation was maintained and/or transferred as had been observed for pDN19X, whereas pCM47 lacking the mutation lost this capacity. This confirmed that the ability of pDN19X to be efficiently maintained and/or transferred in M. extorquens AM1 was due to the region containing the traJ' allele, and not due to a distal region of the plasmid. The plasmid pRK310 is transferred and maintained in M. extorquens efficiently, and it has the same traJ allele as pDN19. In addition, all necessary tra functions including traJ are provided by the helper plasmid (pRK2013 or pRK2073) during triparental matings. Therefore, it is not clear why an alteration in TraJ would be required for efficient maintenance and/or transfer of pDN19 into M. extorquens AM1. It is possible that the effect may be due to altered expression of downstream genes, such as the essential initiator gene trfA. TrfA has been shown to affect copy number and host range (Haugan et al., 1995Down ). In addition, our sequencing has shown that pDN19 lacks the native trfA promoter and the only known upstream promoter is that for traJ. It was not possible to compare expression of trfA or copy number between pDN19 and pDN19X, because pDN19 is apparently not maintained in M. extorquens AM1.

Reduction of pDN19X to the minimal transferable and selectable replicon pCM51
The nucleotide sequence of pDN19X was utilized to guide the removal of potentially nonessential plasmid regions in order to create a minimal transferable and selectable bhr replicon that could be utilized as the backbone for further vector development. Three regions of the 7·8 kb pDN19X plasmid were sequentially excised to create the 5·3 kb minimal transferable and selectable replicon pCM51 (Fig. 1Up). The plasmid pCM51 consists solely of the IncP oriV and oriT, traJ', trfA and tetA and tetR. It behaved identically to pDN19X with regard to transfer and maintenance (data not shown), indicating that the regions of the parent plasmid that had been removed did not affect plasmid transfer or maintenance in M. extorquens AM1. Furthermore, pCM51 possesses a considerably reduced gene complement relative to the 19·1 kb IncP cloning vector previously used with M. extorquens AM1, pRK310 (Ditta et al., 1985Down ) (Fig. 1Up). Achieving a small, functional replicon was critical in the development of improved bhr cloning vectors, and the subsequent elaboration of these vectors into more sophisticated genetic tools.

Development of facile bhr cloning vectors pCM62 and pCM66
The first goal of this study was to develop improved bhr cloning vectors that could be maintained in M. extorquens AM1 and other bacterial species, based on the minimal transferable and selectable replicon pCM51. This was accomplished by fusing a portion of pUC19 containing its multiple cloning site and the ColE1 ori to the region of pCM50 present in the small IncP replicon pCM51, creating pCM62 (Fig. 2Up). A kanamycin-resistant derivative, pCM66, was constructed by inserting the kanamycin resistance cassette from pUC4K for use in bacteria such as methanotrophs in which tetracycline is a poor marker (Fig. 2Up). Both of these plasmids were maintained in and transferred into M. extorquens AM1 with efficiency equal to pCM51 (data not shown). Routine alkaline lysis plasmid minipreps of pCM62 and pCM66 from E. coli cloning strains, however, indicated that the presence of the ColE1 ori raised their copy number in E. coli to that typical of pUC19 and related plasmids (data not shown).

The bhr cloning vectors pCM62 and pCM66 have a number of features that simplify their routine use: (1) high copy number in E. coli; (2) small size (7·2 and 8·0 kb, respectively); (3) complete sequences; (4) variety of unique restriction sites; (5) blue–white screening via lacZ{alpha}; (6) conjugative mobilization between bacterial species; and (7) readily adaptable into species-specific promoter-probe and expression vectors.

A number of proteobacterial species other than E. coli and M. extorquens AM1 have been found to maintain pCM62 and/or pCM66. These include the {alpha}-proteobacteria Agrobacterium tumefaciens (L. Chen & E. Nester, personal communication), Methylobacterium strains CM4 and DM4 (S. Vuillemaier & T. Leisinger, personal communication), and Rhodobacter sphaeroides (J. Hickman & T. Donohue, personal communication), the ß-proteobacterium Ralstonia eutropha (O. Lenz & B. Friedrich, personal communication) and the {gamma}-proteobacteria Methylococcus capsulatus Bath (S. Stolyar & M. E. Lidstrom, unpublished) and Pseudomonas aeruginosa (T. Motley & S. Lory, personal communication). These reports suggest that the improved bhr cloning vectors and the promoter-probe vectors described below will be generally applicable to a wide variety of Gram-negative bacteria.

Conversion of bhr cloning vectors into low-background promoter-probe vectors pCM130 and pCM132 and their demonstration in M. extorquens AM1
The second goal of this work was to construct facile promoter-probe vectors for use in M. extorquens AM1, as well as other bacterial species. Two large IncP promoter-probe vectors have been used in M. extorquens AM1, pHX200 bearing xylE as a reporter (Xu et al., 1993Down ) and the lacZ-containing pGD500 (Ditta et al., 1985Down ). These plasmids are each greater than 20 kb in size, are not fully sequenced, and have limited cloning sites available upstream of their reporter genes. In addition, pGD500 has a high background reporter activity in M. extorquens AM1 (Morris & Lidstrom, 1992Down ). In order to facilitate the identification and dissection of promoter regions in M. extorquens AM1, we created two promoter-probe vectors, pCM130 and pCM132, that are based upon the cloning vectors pCM62 and pCM66, respectively (Fig. 3Up). These promoter-probe vectors were created from their respective cloning vectors in two cloning steps. The reporter genes xylE and lacZ were first introduced into one side of the polylinker. This was followed by the introduction of a transcriptional terminator into the opposite side of the polylinker, in order to reduce background activity. The resulting bhr promoter-probe vectors have low background reporter gene activity in M. extorquens AM1 (Table 2Down) as compared to pHX200, facilitating their use in analysing weak promoters as well as strong promoters.


View this table:
[in this window]
[in a new window]
 
Table 2. XylE or ßGal activity [nmol min-1 (mg protein)-1] present in cell extracts prepared from wt M. extorquens AM1 and E. coli JM109

 
To test the utility of pCM130 and pCM132 as promoter-probe vectors, we introduced the strong promoter upstream of the methanol dehydrogenase operon of M. extorquens AM1, PmxaF (Morris & Lidstrom, 1992Down ), to produce pCM131 and pCM133, respectively. High reporter activities were obtained with both constructs (Table 2Up). pCM131 showed an approximately twofold increase in XylE activity in methanol-grown cells as compared to succinate-grown cells, similar to previously reported results (Springer et al., 1998Down ). An analogous increase in ßGal activity was not observed with pCM133. This result supports previous data suggesting the inability to use lacZ as a plasmid-borne reporter gene to monitor PmxaF regulation (Morris & Lidstrom, 1992Down ). These results demonstrate the utility of pCM130 and pCM132 to locate, and potentially dissect, promoter regions. We expect that these low-background bhr promoter-probe vectors, and variants developed from them, will prove similarly useful in locating promoter regions in a wide variety of bacterial species.

Conversion of bhr cloning vectors into expression vectors pCM80 and pCM160 specifically designed for use in M. extorquens AM1
The final goal of this work was to create expression tools appropriate for use in M. extorquens AM1 based on these improved bhr cloning vectors. The three-step approach we outline below can be readily adapted to generate expression tools specific for any bacterial species found to maintain these plasmids. Firstly, amplify by PCR a known promoter region and insert this fragment into the Plac-proximal side of the pCM62 or pCM66 polylinker, taking advantage of sites introduced on the primers, if necessary. Secondly, fill in the upstream site used for the insertion of the promoter fragment to preserve it for eventual use as a unique site in the polylinker. Thirdly, design and insert a linker with ends compatible to the downstream site used for insertion that can reconstitute the original polylinker within lacZ. This strategy allows the development of an expression vector that retains all of the advantages outlined for these cloning vectors.

For the conversion of pCM62 into an expression vector specifically designed for use in M. extorquens AM1, we chose to utilize PmxaF (Morris & Lidstrom, 1992Down ). In the promoter-probe vectors described above, this promoter provides high-level expression during growth on both methylotrophic and nonmethylotrophic substrates. The expression vectors pCM80 and the kanamycin-resistant derivative, pCM160 (Fig. 4Up), were constructed using the strategy outlined above.

Demonstrations of the utility of the M. extorquens AM1 expression vector pCM80
As a first test of the ability of pCM80 to express cloned genes in M. extorquens AM1, we used the gene encoding GFP from pGFPuv (Clontech). gfp was cloned into the cloning vector pCM62 (containing the Plac promoter) and into pCM80 to produce pCM87 and pCM88, respectively. In vivo GFP activity of M. extorquens AM1 bearing pCM87, pCM88, or the ‘empty’ vector pCM80 was assessed on plates by observing the fluorescence of colonies during a brief exposure to UV light from a UV transilluminator (TFX-35M, Life Technologies). M. extorquens AM1 bearing pCM88 exhibited substantial fluorescence upon UV exposure, whereas colonies with pCM87 were indistinguishable from those carrying the ‘empty’ vector pCM80. These results suggested that substantial expression of a heterologous gene could be achieved in M. extorquens AM1 using pCM80, while the Plac promoter of pCM62 did not appear to direct significant expression.

To quantify gene expression in M. extorquens AM1 using pCM80, two constructs, pCM63 and pCM81, were made that contain xylE inserted into the polylinker of either pCM62 or pCM80, respectively. Only low-level XylE expression in M. extorquens AM1 was observed from the Plac of pCM62 (Table 2Up). Similar results using plasmids bearing the Plac derivatives Ptac and Pspac further suggest that Plac-derived expression vectors will not be useful for high-level expression in M. extorquens AM1 (C. J. Marx & M. E. Lidstrom, unpublished results). In contrast, a high level of XylE activity was detected in extracts prepared from M. extorquens AM1 bearing pCM81, which expresses XylE from the PmxaF of pCM80 (Table 2Up). Similar results were found for a pRK310-derived expression vector that bears PmxaF (C. J. Marx & M. E. Lidstrom, unpublished results). The modest induction observed using pCM81 during growth on methanol is similar to that observed from cells bearing the plasmid pCM131; however, the magnitude of XylE activity is roughly twofold higher. pCM131 differs from pCM81 by the presence of the trrnB upstream of PmxaF in pCM131 and the orientation of PmxaF::xylE relative to the remainder of the plasmid (Figs 3Up and 4Up).

One concern about the use of pCM80 is its high copy number in E. coli and the presence of Plac upstream of PmxaF. This could lead to significant expression of cloned genes in E. coli, preventing the use of this vector for the expression of genes in M. extorquens AM1 that are toxic in E. coli. Accordingly, XylE activity was measured in cell extracts prepared from E. coli strain JM109 bearing various plasmids that had been grown in LB and harvested at an OD600 of 0·6–1·0 (Table 2Up). Significant expression was observed from both pCM63 and pCM81 in JM109. An additional expression vector, pCM110, was constructed from an IncP plasmid that lacks both the ColE1 ori and Plac. A construct containing xylE cloned into pCM110 (pCM111) was created to compare its XylE expression level to that of pCM81 in both organisms. pCM111 provided a high level of expression in M. extorquens AM1, 1.5–2-fold higher than that achieved with pCM81; however, extracts from E. coli JM109 bearing pCM111 had a basal level of XylE activity, nearly at the background. These results indicate that the PmxaF is expressed at very low levels in E. coli. Therefore, while facile expression vectors such as pCM80 are useful for the expression of most cloned genes, an alternative expression vector, such as pCM110, may be required to express genes that are toxic in E. coli.

To determine the percentage of the total cell protein that could be obtained using pCM80, SDS-PAGE was used to estimate the relative content of the XylE and GFP polypeptides expressed from pCM81 and pCM88, respectively (Fig. 5Down). Protein bands could be identified specifically in the extracts from cells containing pCM81 and pCM88 that corresponded to the 35·1 and 26·8 kDa molecular masses predicted for XylE and GFP, respectively. Image analysis of the Coomassie-blue-stained SDS-PAGE gel indicated that pCM80 can express heterologous proteins at 5–9% of the total cell protein, with a modest increase in protein levels during growth on methanol relative to succinate. This level of induction corroborates the XylE activity data obtained from M. extorquens AM1 containing pCM81.



View larger version (95K):
[in this window]
[in a new window]
 
Fig. 5. SDS-PAGE of cell extracts prepared from M. extorquens AM1 bearing various plasmids. Lanes 1 and 8, molecular mass markers (Bio-Rad), masses in kDa indicated to the left; lanes 2 and 3, pCM80; lanes 4 and 5, pCM81; lanes 6 and 7, pCM88. Lanes 2, 4 and 6 were loaded with extracts prepared from methanol-grown cultures; lanes 3, 5 and 7 contain extracts from succinate-grown cells. Arrows indicate the position of XylE and GFP (predicted masses of 35·1 and 26·8 kDa, respectively).

 
Our final test of the utility of the expression vector pCM80 was to determine whether the expression level achieved is sufficient to complement a mutant of a highly expressed gene. For this, we chose to introduce a promoterless mxaF into pCM80 and examine the growth of an mxaF mutant strain bearing this plasmid on methanol. mxaF was amplified by PCR and cloned into both pCM62 and pCM80 to produce pCM85 and pCM86. These two plasmids were then introduced into the mxaF mutant UV26 (Nunn & Lidstrom, 1986Down ) by conjugation. UV26 carrying pCM86, which expresses mxaF from the PmxaF of pCM80, grew at the same rate on methanol plates as wt M. extorquens AM1 with the empty vector, pCM80. UV26 carrying pCM85, which expresses mxaF from the Plac of pCM62, however, grew very slowly on methanol plates and was indistinguishable from UV26 carrying the ‘empty’ vector pCM62. These results indicate that overexpression of MxaF from pCM80, but not the low-level expression from the cloning vector pCM62, is sufficient to replace that from PmxaF on the chromosome.

Conclusions
We report the development of improved bhr cloning vectors and low-background promoter-probe vectors, and demonstrate a simple strategy to convert these plasmids into species-specific expression vectors. This suite of tools possesses a number of advantages over previously described bhr genetic tools in terms of their ease of use and their ability to be adapted for multiple purposes. These genetic tools will greatly facilitate the genetic dissection of the metabolism of M. extorquens AM1. The observation that these vectors can be maintained in a wide variety of bacterial species suggests that these vectors, and future elaborations upon them, will help fulfil the need for more sophisticated bhr genetic tools in a variety of bacteria. Such tools are critical for the facile genetic analysis of the wide spectrum of bacterial species for which genome-level sequence data are now available.


    ACKNOWLEDGEMENTS
 
We thank Stephen Lory, Rob Meima, Penny Naranjo, Svein Valla and Cliff Unkefer for providing plasmids useful for this study; Lishan Chen, Eugene Nester, Stephane Vuillemaier, Thomas Leisinger, Oliver Lenz, Barbel Friedrich, Jason Hickman, Timothy Donohue, Timothy Motley and Stephen Lory for their personal communications; Marion Franke, Rob Meima and Sergey Stolyar for their helpful advice; and Nathaniel Cady for his critical review of our manuscript. This work was supported by grants from the US DOE (DE-FG03-96ER20226) and the NIH (GM 36296).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Biville, F., Mazodier, P., Turlin, E. & Gasser, F. (1989). Mutants of Methylobacterium organophilum unable to synthesize PQQ. Antonie Leeuwenhoek 56, 103-107.

Blatny, J. M., Brautaset, T., Winther-Larsen, H. C., Karunakaran, P. & Valla, S. (1997). Improved broad-host-range RK2 vectors useful for high and low regulated expression levels in Gram-negative bacteria. Plasmid 38, 35-51.[Medline]

Chambers, S. P., Prior, S. E., Barstow, D. A. & Minton, N. P. (1988). The pMTL nic- cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68, 139-149.[Medline]

Chistoserdov, A. Y., Chistoserdova, L. V., McIntire, W. S. & Lidstrom, M. E. (1994). Genetic organization of the mau gene cluster in Methylobacterium extorquens AM1: complete nucleotide sequence and generation and characteristics of mau mutants. J Bacteriol 176, 4052-4065.[Abstract/Free Full Text]

Cordes, C., Meima, R., Twiest, B., Kazemier, B., Venema, G., Maarten van Dijl, J. & Bron, S. (1996). The expression of a plasmid-specified exported protein causes structural plasmid instability in Bacillus subtilis. J Bacteriol 178, 5235-5242.[Abstract/Free Full Text]

Ditta, G., Schmidhauser, T., Yakobson, E., Lu, P., Liang, X.-W., Finlay, D. R., Guiney, D. & Helinski, D. R. (1985). Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid 13, 149-153.[Medline]

Figurski, D. & Helinski, D. R. (1979). Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA 76, 1648-1652.[Abstract/Free Full Text]

Figurski, D. H., Meyer, R. J. & Helinski, D. R. (1979). Suppression of ColE1 replication properties by the Inc P-1 plasmid RK2 in hybrid plasmids constructed in vitro. J Mol Biol 133, 295-318.[Medline]

Hanson, R. S. & Hanson, T. E. (1996). Methanotrophic bacteria. Microbiol Rev 60, 439-471.[Abstract/Free Full Text]

Harder, W., Attwood, M. M. & Quayle, J. R. (1973). Methanol assimilation by Hyphomicrobium sp. J Gen Microbiol 78, 155-163.

Haugan, K., Karunakaran, P., Tondervik, A. & Valla, S. (1995). The host range of RK2 minimal replicon copy-up mutants is limited by species-specific differences in the maximum tolerable copy number. Plasmid 33, 27-39.[Medline]

Jiang, B. & Howard, S. P. (1992). The Aeromonas hydrophila exeE gene, required both for protein secretion and normal outer membrane biogenesis, is a member of a general secretion pathway. Mol Microbiol 6, 1351-1361.[Medline]

Kalb, V. F. & Bernlohr, R. W. (1977). A new spectrophotometric assay for protein in cell extracts. Anal Biochem 82, 362-371.[Medline]

Kataeva, I. A. & Golovleva, L. A. (1990). Catechol 2,3-dioxygenases from Pseudomonas aeruginosa 2x. Methods Enzymol 188, 115-121.[Medline]

Knauf, V. C. & Nester, E. W. (1982). Wide host range cloning vectors: cosmid clone bank of Agrobacterium Ti plasmids. Plasmid 8, 45-54.[Medline]

Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M.II & Peterson, K. M. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175-176.[Medline]

Lidstrom, M. E. (1991). The aerobic methylotrophic bacteria. In The Prokaryotes II , pp. 431-445. Edited by A. Balows, H. G. Trüper, M. Dworkin, W. Harder & K.-H. Schleifer. New York:Springer.

Lidstrom, M. E. (1992). The genetics and molecular biology of methanol-utilizing bacteria. In Methane and Methanol Utilizers , pp. 183-206. Edited by J. C. Murrell & H. Dalton. New York:Plenum.

Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Morris, C. J. & Lidstrom, M. E. (1992). Cloning of a methanol-inducible moxF promoter and its analysis in moxB mutants in Methylobacterium extorquens AM1rif. J Bacteriol 174, 4444-4449.[Abstract/Free Full Text]

Nunn, D. & Lidstrom, M. E. (1986). Isolation and complementation analysis of 10 methanol oxidation mutant classes and identification of the methanol dehydrogenase structural gene of Methylobacterium sp. Strain AM1. J Bacteriol 166, 581-590.[Abstract/Free Full Text]

Nunn, D., Bergman, S. & Lory, S. (1990). Products of three accessory genes, pilB, pilC, pilD, are required for biogenesis of Pseudomonas aeruginosa pili. J Bacteriol 172, 2911-2919.[Abstract/Free Full Text]

Pansegrau, W., Lanka, E., Barth, P. T. & 7 other authors (1994). Complete nucleotide sequence of Birmingham IncP{alpha} plasmids: compilation and comparative analysis. J Mol Biol 239, 623–663.[Medline]

Peel, D. & Quayle, J. R. (1961). Microbial growth on C1 compounds: 1. Isolation and characterization of Pseudomonas AM 1. Biochem J 81, 465-469.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schmidhauser, T. J. & Helinski, D. R. (1985). Regions of broad-host-range plasmid RK2 involved in replication and stable maintenance in nine species of Gram-negative bacteria. J Bacteriol 164, 446-455.[Abstract/Free Full Text]

Springer, A. L., Auman, A. J. & Lidstrom, M. E. (1998). Sequence and characterization of mxaB, a response regulator involved in regulation of methanol oxidation, and of mxaW, a methanol-regulated gene in Methylobacterium extorquens AM1. FEMS Microbiol Lett 160, 119-124.[Medline]

Tatusov, R. L., Galperin, M. Y., Natale, D. A. & Koonin, E. V. (2000). The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res 28, 33-36.[Abstract/Free Full Text]

Toyama, H., Anthony, C. & Lidstrom, M. E. (1998). Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation. FEMS Microbiol Lett 166, 1-7.[Medline]

Vagner, V., Dervyn, E. & Ehrlich, S. D. (1998). A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144, 3097-3104.[Abstract]

Veira, J. & Messing, J. (1982). The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19, 259-268.[Medline]

Whitaker, J. R. & Granum, P. E. (1980). An absolute method for protein determination based on difference in absorbance at 235 and 280 nm. Anal Biochem 109, 156-159.[Medline]

Windass, J., Worsey, M., Pioli, E. & 7 other authors (1980). Improved conversion of methanol to single-cell protein by Methylophilus methylotrophus. Nature 287, 396–401.

Xu, H. H., Viebahn, M. & Hanson, R. S. (1993). Identification of methanol-regulated promoter sequences from the facultative methylotrophic bacterium Methylobacterium organophilum XX. J Gen Microbiol 139, 743-752.[Medline]

Yanisch-Perron, C., Veira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.[Medline]

Ziegelin, G., Furste, J. P. & Lanka, E. (1989). TraJ protein of plasmid RP4 binds to a 19-base pair invert sequence repetition within the transfer origin. J Biol Chem 264, 11989-11994.[Abstract/Free Full Text]

Zukowski, M. M., Gaffney, D. F., Speck, D., Kauffmann, M., Findeli, A., Wisecup, A. & Lecocq, J.-P. (1983). Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene. Proc Natl Acad Sci USA 80, 1101-1105.[Abstract/Free Full Text]

Received 9 January 2001; revised 10 April 2001; accepted 12 April 2001.


This article has been cited by other articles:


Home page
MicrobiologyHome page
M. Zhang, K. Sun, and L. Sun
Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain
Microbiology, July 1, 2008; 154(7): 2060 - 2069.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
D. Bartosik, M. Putyrski, L. Dziewit, E. Malewska, M. Szymanik, E. Jagiello, J. Lukasik, and J. Baj
Transposable Modules Generated by a Single Copy of Insertion Sequence ISPme1 and Their Influence on Structure and Evolution of Natural Plasmids of Paracoccus methylutens DM12
J. Bacteriol., May 1, 2008; 190(9): 3306 - 3313.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
L. Chistoserdova, G. J. Crowther, J. A. Vorholt, E. Skovran, J.-C. Portais, and M. E. Lidstrom
Identification of a Fourth Formate Dehydrogenase in Methylobacterium extorquens AM1 and Confirmation of the Essential Role of Formate Oxidation in Methylotrophy
J. Bacteriol., December 15, 2007; 189(24): 9076 - 9081.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. J. Strovas, L. M. Sauter, X. Guo, and M. E. Lidstrom
Cell-to-Cell Heterogeneity in Growth Rate and Gene Expression in Methylobacterium extorquens AM1
J. Bacteriol., October 1, 2007; 189(19): 7127 - 7133.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
M. A. Sanchez and B. Gonzalez
Genetic Characterization of 2,4,6-Trichlorophenol Degradation in Cupriavidus necator JMP134
Appl. Envir. Microbiol., May 1, 2007; 73(9): 2769 - 2776.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Klink, B. Elsner, K. Strube, and R. Cramm
Characterization of the Signaling Domain of the NO-Responsive Regulator NorR from Ralstonia eutropha H16 by Site-Directed Mutagenesis
J. Bacteriol., April 1, 2007; 189(7): 2743 - 2749.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
T. Ueki and D. R. Lovley
Heat-shock sigma factor RpoH from Geobacter sulfurreducens
Microbiology, March 1, 2007; 153(3): 838 - 846.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
L. Dziewit, M. Jazurek, L. Drewniak, J. Baj, and D. Bartosik
The SXT Conjugative Element and Linear Prophage N15 Encode Toxin-Antitoxin-Stabilizing Systems Homologous to the tad-ata Module of the Paracoccus aminophilus Plasmid pAMI2
J. Bacteriol., March 1, 2007; 189(5): 1983 - 1997.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
Y. J. Choi, L. Morel, D. Bourque, A. Mullick, B. Massie, and C. B. Miguez
Bestowing Inducibility on the Cloned Methanol Dehydrogenase Promoter (PmxaF) of Methylobacterium extorquens by Applying Regulatory Elements of Pseudomonas putida F1
Appl. Envir. Microbiol., December 1, 2006; 72(12): 7723 - 7729.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. Holscher and H. Gorisch
Knockout and Overexpression of Pyrroloquinoline Quinone Biosynthetic Genes in Gluconobacter oxydans 621H
J. Bacteriol., November 1, 2006; 188(21): 7668 - 7676.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. G. N. Penalver, F. Cantet, D. Morin, D. Haras, and J. A. Vorholt
A Plasmid-Borne Truncated luxI Homolog Controls Quorum-Sensing Systems and Extracellular Carbohydrate Production in Methylobacterium extorquens AM1.
J. Bacteriol., October 1, 2006; 188(20): 7321 - 7324.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Gourion, M. Rossignol, and J. A. Vorholt
A proteomic study of Methylobacterium extorquens reveals a response regulator essential for epiphytic growth
PNAS, August 29, 2006; 103(35): 13186 - 13191.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
T. Mehta, S. E. Childers, R. Glaven, D. R. Lovley, and T. Mester
A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens.
Microbiology, August 1, 2006; 152(Pt 8): 2257 - 2264.
[Abstract] [Fu