Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, G. R.
Right arrow Articles by Clark, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, G. R.
Right arrow Articles by Clark, D. P.
Agricola
Right arrow Articles by Jiang, G. R.
Right arrow Articles by Clark, D. P.
Microbiology (2001), 147, 2437-2446.
© 2001 Society for General Microbiology


Physiology and Growth

Regulation of the ldhA gene, encoding the fermentative lactate dehydrogenase of Escherichia coli

Gene Ruijun Jianga,1, Sonia Nikolova1 and David P. Clark1

Department of Microbiology, Southern Illinois University, Carbondale, IL 62901-6508, USA1

Author for correspondence: David P. Clark. Tel: +1 618 453 3737. Fax: +1 618 453 8036. e-mail: clark{at}micro.siu.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The fermentative lactate dehydrogenase (LDH) of Escherichia coli is induced by low pH under anaerobic conditions. Both translational and transcriptional gene fusions to ldhA, which encodes the fermentative LDH, have now been made. Both types of ldhA–lacZ fusion were induced by low pH, but only in the absence of air. However, the translational fusions were consistently expressed at a five- to tenfold higher level than the transcriptional fusions, perhaps implying some post-transcriptional effect on ldhA expression. Introduction of arcB::Kan decreased expression of both translational and transcriptional ldhA–lacZ fusions by three- to fivefold. Disruption of mlc, which encodes a repressor of several genes of the phosphotransferase system, almost abolished expression of ldhA. Disruption of csrA caused a moderate drop in expression of both operon and protein ldhA fusions, whereas insertional inactivation of csrB or glgA had the opposite effect. These effects are probably indirect, resulting from alterations in sugar accumulation versus storage. Mutations in ptsG, cra, fnr, narL, rpoS, osmZ, appY, ack/pta, aceEF, pfl and ldhA had no effect on expression of the ldhA fusions. ldhA was not induced by the membrane-permeant weak acid benzoate, implying that it does not respond to the internal pH directly. Little pH induction was seen during growth on glycerol plus fumarate, suggesting that products of sugar fermentation are necessary for acid induction. Addition of succinate, acetate or lactate had no effect on ldhA expression. In contrast, pyruvate caused a two- to fourfold increase in expression of ldhA–lacZ. This accords with the idea that increased sugar metabolism indirectly induces ldhA.

Keywords: lactic acid, fermentation, anaerobic growth, CsrAB system, Mlc regulator, ArcAB system

Abbreviations: LDH, lactate dehydrogenase; PTS, phosphoenolpyruvate-dependent sugar phosphotransferase system

a Present address: Valentis, Inc., 863A Mitten Road, Burlingame, CA 94010, USA.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Enteric bacteria, such as Escherichia coli, can grow by respiration or fermentation. Although growth without oxygen can occur by anaerobic respiration, in its natural habitat, the mammalian intestine, E. coli depends largely on fermenting a mixture of sugars and sugar derivatives (Peekhaus & Conway, 1998Down ; Mason & Richardson, 1981Down ). During fermentation, sugars are converted to reduced organic compounds such as ethanol and acetic, lactic, formic and succinic acids (Fig. 1Down) (Böck & Sawers, 1996Down ; Clark, 1989Down ; Ogino et al., 1980Down ). The fermentative lactate dehydrogenase (LDH) is a soluble NAD-linked enzyme that converts pyruvate to D-lactic acid (Tarmy & Kaplan, 1968aDown , bDown ). This reaction consumes one NADH per pyruvate, so recycling the NADH generated during glycolysis. The fermentative LDH is induced approximately tenfold in anaerobically grown cultures at acidic pH (Clark, 1989Down ; Mat-Jan et al., 1989Down ). [There are two other so-called LDHs in E. coli. However, these are membrane-bound flavoproteins, which couple to the respiratory chain and are better described as lactate oxidases. These enzymes, one specific for the D-isomer and the other for the L-isomer, are required for aerobic growth on lactate (Haugaard, 1959Down ; Kline & Mahler, 1965Down ).]



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Fermentation pathways of E. coli. Reactions are represented by the names of the corresponding genes: ldhA, lactate dehydrogenase; pflAB, pyruvate formate lyase; adhE, alcohol dehydrogenase; pta, phosphotransacetylase; ackA, acetate kinase; fdhF, formate dehydrogenase; hyc, hydrogenase; mdh, malate dehydrogenase; fumB/C, fumarate hydratase; frdABCD, fumarate reductase.

 
Fermentation of sugars to lactate is widespread. Mammalian muscle generates L-lactate when in oxygen debt. A variety of bacteria produce lactic acid during anaerobic growth; in some cases, the L-isomer is made, in others D-lactate. Enterobacteria produce the D-isomer of lactic acid along with a variety of other products (Clark, 1989Down ). The fermentative D-LDH of E. coli is allosterically activated by its substrate, pyruvate (Tarmy & Kaplan, 1968bDown ). In contrast, many lactobacilli produce solely, or largely, L-lactic acid by an L-specific LDH that is activated by fructose bisphosphate (Mayr et al., 1982Down ). The sequences of the D- and L-specific types of LDH are unrelated and fall into two distinct families (Taguchi & Ohta, 1991Down ; Bunch et al., 1997Down ).

Our unpublished work has shown that ldhA is not regulated by Fnr, which activates most of the genes involved in anaerobic respiration. Neither is ldhA affected by the AdhR regulator that activates alcohol fermentation in response to the level of reduced NADH (Clark, 1989Down ; Clark & Rod, 1987Down ; Dailly, 1998Down ). Here we show that ldhA is affected by the ArcAB system and by several genes involved in the control of carbohydrate metabolism. In particular, ldhA appears to be under control of both CsrAB (Liu et al., 1997Down ; Romeo, 1998Down ) and Mlc (Kim et al., 1999Down ; Plumbridge, 1999Down ). The CsrAB system oversees the balance between glycolysis and sugar storage as glycogen. In particular, CsrA binds to glgCAP mRNA and prevents translation, hence inhibiting glycogen synthesis (Liu et al., 1997Down ). CsrB is a non-translated RNA molecule that acts as a dock for CsrA. Consequently, mutations inactivating CsrB have opposite effects to those in CsrA (Romeo, 1998Down ). Mlc acts as a repressor for several operons encoding proteins of the phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), including ptsHI, ptsG and manXYZ as well as genes involved in the metabolism of certain non-PTS sugars, such as maltose (Plumbridge, 1998aDown , bDown ).


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains and culture conditions.
All bacteria used were strains of E. coli K-12 and are described in Table 1Down. Rich broth contained (per litre): tryptone (10 g), NaCl (5 g) and yeast extract (1 g). Minimal medium M9 (Miller, 1972Down ) or E (Vogel & Bonner, 1956Down ) was supplemented with carbon sources at 0·4% (w/v) and, where appropriate, with amino acids (50 mg l-1). PPPS medium contained (per litre): Bacto-Peptone (17 g; Difco), Difco Proteose Peptone no. 3 (3 g) and NaCl (5 g). Solid media contained 1·5% (w/v) Difco Bacto-Agar. All anaerobic growth media were supplemented with the trace metals Fe (50 µM), Se (5 µM), Mo (5 µM) and Mn (5 µM) as described previously (Winkelman & Clark, 1986Down ). Growth was followed turbidometrically using a Klett–Summerson colorimeter equipped with a green (540 nm) filter. Anaerobic growth was performed in anaerobic jars (Oxoid) under an atmosphere of H2/CO2 generated by Oxoid gas generating kits. Resazurin indicators were used to ensure anaerobic conditions. Anaerobic liquid cultures were grown without agitation in tubes inside anaerobic jars or in milk dilution bottles filled to the top before sealing. Anaerobic liquid cultures for enzyme assay were heavily buffered to pH 5·5 by 200 mM MES or pH 9·0 by 200 mM AMPSO to counteract acidification due to sugar fermentation. Measurement of the supernatant pH after growth showed a fall in pH of no more than 0·5 unit after 24 h. Longer incubation periods caused more acidification. Transductions using P1vir were performed as described by Miller (1972)Down . Transductants were selected on medium E containing glucose and 0·1% casein hydrolysate. Antibiotic selections were performed using tetracycline at 10 mg l-1, chloramphenicol at 30 mg l-1 and ampicillin at 200 mg l-1. Kanamycin at 30 mg l-1 was used in medium containing succinate instead of glucose.


View this table:
[in this window]
[in a new window]
 
Table 1. Strains of Escherichia coli, bacteriophages and plasmids used

 
Enzyme and protein assays.
Soluble cell extracts were made by breaking the bacteria in a French pressure cell (Aminco) followed by ultracentrifugation (Bunch et al., 1997Down ). Protein was estimated by the Bio-Rad assay according to the manufacturer’s instructions, with {gamma}-globulin as standard. LDH was assayed by following the decrease in absorbance at 340 nm as NADH was oxidized to NAD+ by pyruvate, as previously described (Mat-Jan et al., 1989Down ). ß-Galactosidase was assayed as described previously (Winkelman & Clark, 1986Down ), except that cultures were grown to mid-exponential phase (approx. 5x108 cells ml-1) before assay in a variety of media under both aerobic and anaerobic conditions. ß-Galactosidase activity is given as µmol ONPG hydrolysed per 109 cells per hour at 37 °C. Enzyme assays were performed in duplicate and averaged if within 10% of each other. If the discrepancy was greater, another pair of assays was performed.

DNA procedures.
Chromosomal DNA was isolated and purified as described by Sato & Miura (1963)Down . Lambda DNA was isolated as described by Sambrook et al. (1989)Down . Plasmids were isolated by alkaline lysis followed by ethidium bromide/CsCl density centrifugation (Sambrook et al., 1989Down ). The rapid plasmid isolation technique of Birnboim & Doly (1979)Down was used to screen plasmid constructs. Ligations using T4 DNA ligase and restriction enzyme digests were performed under conditions recommended by the manufacturer (Bethesda Research Laboratories). DNA fragments were separated by electrophoresis on 0·7% agarose gels in TBE (89 mM Tris, 89 mM boric acid and 0·2 mM EDTA) (Sambrook et al., 1989Down ). DNA restriction fragments and PCR products were purified from agarose gels by Gene Clean (Bio 101). Transformation procedures were essentially as described by Hanahan (1983)Down . Both strands of DNA were completely sequenced using the technique of Sanger et al. (1977)Down .

Construction of modified lac-fusion vectors.
The fusion vectors pRS414 and pRS415 are widely used in studies of gene expression (Simons et al., 1987Down ). However, they have only three restriction sites available for cloning, which limits their use. Based on the presence of useful restriction sites in the ldhA upstream region, we designed two complementary 50-mer oligonucleotides containing recognition sequences for eight common restriction enzymes (5'-EcoRI, PstI, SphI, ClaI, MluI, SalI, HindIII, BamHI-3'). The two oligonucleotides were mixed at equal molarity, heated at 76 °C for 10 min to eliminate possible intramolecular base pairing and incubated at 48 °C overnight. The polylinker and pRS414 and pRS415 were digested with EcoRI plus BamHI. DNA fragments were purified by agarose gel electrophoresis and DEAE membrane elution. The polylinker was then ligated into the pRS plasmids and the products transformed into strain JK597. As no selection was available for the presence of the insert, plasmid minipreps were made from 48 ampicillin-resistant colonies and cut with PstI and with SphI plus ScaI. Presence of the polylinker insert was confirmed by sequencing. A derivative of pRS414 with the polylinker was designated pRJ1 and a polylinker-containing derivative of pRS415 was named pRJ2 (Fig. 2Down).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. Construction of modified fusion vectors and ldhA–lacZ fusion plasmids. Plasmid pRJ2 was made by inserting an artificial polylinker into the EcoRI/BamHI site of pRS415. Plasmid pRJ1 was made similarly from pRS414 (not shown). Fragments of various lengths from the ldhA upstream region were generated by PCR and were inserted into pRJ2 to form a series of ldhA–lacZ fusions. The formation of pRJ3 by insertion of the 1170 bp EcoRI/BamHI fragment is shown in the figure.

 
Construction of ldhA–lac fusions.
To analyse those areas of the ldhA upstream region involved in regulation, we constructed a series of ldhA–lacZ operon and protein fusions containing various lengths of the ldhA upstream region (Fig. 2Up). A DNA fragment of 1170 bp spanning from -1170 bp to -1 (relative to the start of translation) was amplified by PCR using chromosomal DNA as template. The forward primer was CCATGCTGAATTCTTCCTGGGCC and the reverse primer was GGCGAGTTTCATAAGCTTTCTCCAGTG. Two artificial restriction sites, for EcoRI at the 5' end and HindIII at the 3' end (underlined), were introduced by PCR to facilitate cloning. In addition, natural recognition sites for SphI, ClaI and MluI are located at -836 bp, -595 bp and -369 bp, respectively. The purified 1170 bp PCR product was digested with HindIII and each of the other four enzymes in turn. The EcoRI/HindIII, SphI/HindIII, ClaI/HindIII and MluI/HindIII fragments were purified by gel electrophoresis. The same pairs of enzymes were used to digest the newly constructed vectors pRJ2 (operon fusion vector) and pRJ1 (protein fusion vector). Since there was more than one site for ClaI and MluI on these vectors, partial digestions were conducted with these enzymes. Linearized vector DNA was ligated to each of the ldhA upstream fragments; the ligation products were transformed into strain XL-1 Blue (Bullock et al., 1987Down ) and ampicillin-resistant colonies were selected. Plasmid minipreps made from these colonies were screened for the correct insert by double digestion. Plasmid-borne ldhA–lacZ fusions were crossed into {lambda}RS45 by in vivo homologous recombination (Simons et al., 1987Down ). The recombinant lambdas were then inserted into the chromosomes of the lac-deletion strains P90C and MC4100 to give derivatives carrying a single copy of the ldhA–lacZ fusion.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Construction of multicopy and single-copy ldhA–lacZ fusions
Both transcriptional and translational fusions between the ldhA upstream region and the lacZ structural gene were constructed by a PCR approach as detailed in Methods. Plasmid-borne fusions were made first and were then crossed onto {lambda}RS45 and inserted into the chromosome at the {lambda}-attachment site to give strains carrying a single copy of the ldhA–lacZ fusions. Constructs carrying both multicopy and single-copy ldhA–lacZ fusions were tested for expression of ldhA by growing anaerobically at both acidic and alkaline pH and assaying ß-galactosidase (Table 2Down). The single-copy fusions showed higher expression at low pH, as seen in previous work in which LDH enzyme activity was assayed (Mat-Jan et al., 1989Down ). However, acid induction was scarcely noticeable in the multicopy fusions. It appeared that the single-copy fusions were responding in the correct physiological manner, whereas the multicopy fusions were not. Therefore, future work on physiological regulation of ldhA was performed with the single-copy fusions. As seen in Table 2Down, the protein fusion gave five- to tenfold higher expression than the operon fusion when present in either multicopy or single copy. In addition, acid induction was about twofold greater for the protein fusion. These differences in expression were seen throughout our work with these two types of ldhA–lacZ fusion.


View this table:
[in this window]
[in a new window]
 
Table 2. Expression of plasmid and prophage-borne ldhA–lacZ fusions

 
Expression of ldhA responds to anaerobiosis and acidity
Previous data showed that LDH levels in E. coli were about tenfold higher anaerobically and at low pH than under aerobic conditions (Mat-Jan et al., 1989Down ). We therefore tested our operon and protein ldhA–lacZ fusions for the effect of aeration and acidity. As seen in Table 2Up, under anaerobic conditions, there was a ninefold induction of the protein fusion by low pH. This is the same level of induction as seen when measuring LDH activity (Mat-Jan et al., 1989Down ). The operon fusion showed only about fourfold induction at low pH. No significant effect of pH was seen under aerobic conditions. In fact, the expression level was actually higher in air at pH 9·0 than anaerobically at the same pH (Table 2Up). We also assayed strain RJ57 (protein fusion) at a range of intermediate pH values under anaerobic conditions, and found the following levels of ß-galactosidase: 48600 at pH 5·5, 44500 at pH 6·0, 22900 at pH 7·0, 19700 at pH 8·0 and 5800 at pH 9·0.

A 369 bp segment of the ldhA upstream is sufficient for expression
As described in Methods, we constructed a series of ldhA–lacZ fusions containing different lengths of the ldhA upstream region, ranging from 1170 to 369 bp. Derivatives of P90C carrying such a series of ldhA–lacZ operon fusions were grown anaerobically on rich broth plus glucose at both pH 5·5 and pH 9·0. The 1170 bp fragment is present in RJ53, whose ß-galactosidase levels are shown in Table 2Up. Almost the same levels of expression were seen in all the other shorter constructs (data not shown). Moreover, the ldhA gene was induced by low pH conditions in all four constructs, as seen in previous work. The identical response of the four constructs implied that the 369 bp MluI/HindIII fragment of the ldhA upstream region was sufficient for normal expression of the ldhA gene.

Effect of temperature on expression of ldhA
It has been suggested that ldhA might correspond to hslI, a poorly characterized heat-shock gene, identified only by restriction site and mapping data (Chuang & Blattner, 1993Down ). We therefore assayed our ldhA–lacZ fusions after shifting from 30 °C to 37 °C, 42 °C and 50 °C. However, we did not see any increased expression of ldhA–lacZ in response to elevated temperature, either aerobically or anaerobically, whether at neutral or acidic pH (data not shown). We also assayed LDH from cultures grown for 12 h at 37 °C and 42 °C and again found no difference.

Effect of anaerobic regulators on expression of ldhA
Several regulatory genes are known that control the response to anaerobiosis, acidity and/or entry into stationary phase. We transduced insertion mutations in fnr, narL, rpoS, osmZ, appY, arcB and arcA into the fusion strains RJ43, RJ47, RJ53 and RJ57. The derivatives were grown aerobically and anaerobically in rich broth plus glucose at both pH 5·5 and pH 9·0 and their levels of ß-galactosidase were assayed and compared to the parental ldhA–lacZ fusion strains. The arcB ::Kan insertion caused a four- to fivefold drop in ldhA expression under all conditions tested in both protein and operon fusion strains (Table 3Down). Insertions in arcA had essentially the same results as those in arcB (data not shown). However, none of the other regulatory defects had any significant effect on ldhA–lacZ expression (data not shown). The ldhA–lacZ fusion strains and their arcB ::Kan derivatives were grown on a range of carbon sources, examples of which are shown in Table 3Down. Expression of the ldhA–lacZ fusions was highest on glucose, lower on other PTS sugars (e.g. mannose), and lowest on glycerol plus fumarate where growth is by anaerobic respiration rather than sugar fermentation. However, the relative drop in expression due to arcB ::Kan was approximately the same on all growth susbstrates. These results suggested that expression of the ldhA gene might be affected by the nature of the carbon source and/or the metabolic products of sugar breakdown.


View this table:
[in this window]
[in a new window]
 
Table 3. Effect of arcB defect on expression of ldhA

 
The rnc gene is needed for processing the mRNA of adhE, encoding the fermentative alcohol dehydrogenase (Aristarkhov et al., 1996Down ). The presence of rnc ::Kan blocks expression of adhE and so prevents anaerobic growth by fermentation. Therefore rnc ::Kan derivatives of the ldhA–lacZ fusion strains could only be grown aerobically. At least under these conditions, no effect of rnc ::Kan on expression of ldhA–lacZ was seen (data not shown).

Effect of metabolites on expression of ldhA
Our previous work showed minor effects on LDH levels of mutations blocking acetate formation (Mat-Jan et al., 1989Down ; Bunch et al., 1997Down ). We therefore tested the possibility that metabolic blocks in pyruvate, lactate or acetate metabolism might affect the expression of ldhA. However, introduction of defects in ack, pta, {Delta}(ack pta), {Delta}aceEF, pfl and ldhA had no effect on the expression of ldhA–lacZ (data not shown). Thus these earlier observations were presumably due to indirect effects of changes in the accumulation of acidic fermentation products in poorly buffered media.

We also measured the effect of adding exogenous fermentation acids on the expression of the ldhA–lacZ fusions. These acids were tested at pH 9 and pH 7 to assess whether they might mimic low pH conditions by increasing the expression of ldhA. However, succinate, acetate, lactate and formate had no significant effect (data not shown). Addition of pyruvate (20 or 40 mM) resulted in a two- to fourfold increase in the expression of the ldhA–lacZ fusions (Table 4Down). Conversely, the pyruvate analogue ketobutyrate had a slight negative effect, of doubtful significance, on the expression of ldhA, although only at pH 7. Oxamate, another pyruvate analogue that inhibits the fermentative LDH of E. coli to a moderate degree, had no significant effect (Table 4Down).


View this table:
[in this window]
[in a new window]
 
Table 4. Effect of acids on induction of ldhA–lacZ fusions

 
Addition of membrane-permeant weak acids, such as benzoate, causes acidification of the cell interior and hence induces those genes that respond to a lowered internal pH (Rosner & Slonczewski, 1994Down ; White et al., 1992Down ). We therefore tested the effect of benzoate against the ldhA–lacZ fusions. Lower concentrations had a negligible effect and 20 mM benzoate actually decreased the expression of ldhA (Table 4Up), especially at pH 7, where more benzoate is uncharged and would enter more readily. This implies that induction of ldhA does not respond directly to the internal pH.

The CsrAB and Mlc regulatory systems affect expression of ldhA
Insertions in regulatory genes csrA and csrB were tested for effects on the anaerobic expression of the ldhA–lacZ fusions. The csrA ::Kan mutation decreased expression of ldhA–lacZ by two- to threefold in both operon and protein fusions at both pH 5·5 and pH 9·0 for cultures grown with several different carbon sources (Table 5Down). The csrB ::Cam mutation had little effect under most conditions; however, it did increase expression by about twofold for cultures grown on maltose (a non-PTS sugar causing only mild catabolite repression). CsrA binds to the mRNA of target genes and CsrB provides an RNA molecule that competes for binding of CsrA (Liu et al., 1997Down ). Consequently, a deficiency of CsrB will result in a higher level of free CsrA and so the effects of defects in CsrA and CsrB will be opposite, as observed.


View this table:
[in this window]
[in a new window]
 
Table 5. Effect of CsrAB system on expression of ldhA

 
Since a major effect of the CsrAB regulatory system is on the accumulation of glycogen we also tested a glgA ::Kan mutation, which abolishes glycogen synthesis. Introduction of glgA ::Kan caused a marked increase in expression of ldhA–lacZ when cells were grown on sugars, but not when glycerol plus fumarate was used (Table 5Up). The increase was two- to threefold at pH 5·5 but five- to tenfold at pH 9, with maltose and glucose respectively. Despite the greater increase at pH 9, the final expression levels for cultures grown on sugars were similar at pH 5·5 and pH 9. This is due to the lower basal level of expression at pH 9. These results suggested that the effect of the CsrAB regulatory system might be indirect and that the availability of fermentable sugar monomers might control the expression of ldhA. This led us to test other regulators affecting carbohydrate metabolism.

We transduced the mlc ::Tet mutation into the ldhA–lacZ fusion strains RJ43, RJ47, RJ53 and RJ57. The mlc ::Tet derivatives were grown at pH 5·5 and pH 9·0, and under both aerobic and anaerobic conditions on rich broth supplemented with glucose, fructose, mannose, maltose, xylose or glycerol plus fumarate. For both the operon and the protein ldhA–lacZ fusions, and under all conditions tested, the presence of mlc ::Tet almost abolished expression of ldhA (representative data are shown in Table 6Down). We also tested the effects of ptsG and cra, which are also involved in the regulation of sugar metabolism. Derivatives of RJ43, RJ47, RJ53 and RJ57 carrying ptsG ::Kan or cra ::Tn10 insertions were tested under the same conditions as the mlc::Tet derivatives. However, neither ptsG::Kan nor cra ::Tn10 had any significant effect on ldhA expression (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 6. Effect of mlc::Tet mutation on expression of ldhA–lacZ

 
Insertional inactivation of mlc showed the largest regulatory effect on expression of ldhA. We therefore tested the response of mlc itself to those conditions that induce ldhA. An mlc–lacZ fusion strain was grown both aerobically and anaerobically at pH 5·5 and pH 9·0 and on a range of carbon sources. Expression of mlc was not significantly affected by pH but was induced from two-to fourfold by anaerobic conditions, depending on the carbon source (data not shown). The Mlc regulator autoregulates transcription of its own gene (Decker et al., 1998Down ). A strain carrying an mlc ::Kan insertion showed an even greater increase in expression of mlc–lacZ under anaerobic conditions (seven- to eightfold for growth on glucose).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The use of ldhA–lacZ fusions has confirmed previous observations that ldhA, encoding the fermentative LDH of E. coli, is expressed most highly at low pH, provided conditions are anaerobic (Mat-Jan et al., 1989Down ). Under aerobic conditions, low pH had a marginal effect on ldhA expression. Both transcriptional and translational ldhA–lacZ fusions were induced most highly under acidic, anaerobic conditions. However, the level of expression of the protein fusion was almost always significantly higher than for the operon fusion, suggesting some post-transcriptional effect.

A survey of regulatory mutations demonstrated that ldhA was affected both by the ArcAB regulatory system and by the CsrAB and Mlc carbohydrate metabolism regulators. Introduction of defects in arcA or arcB lowered expression of ldhA by three- to fourfold both aerobically and anaerobically; both at pH 5·5 and at pH 9·0. Thus, although the ArcAB system promotes expression of ldhA, it is not apparently responsible for the response of ldhA to these environmental conditions. A similar response to defects in the ArcAB system has been seen for cyd (Iuchi et al., 1990Down ). Expression of cyd decreased upon introduction of mutations in arcA or arcB under both aerobic and anaerobic conditions. The cytochrome d complex is induced under micro-oxic conditions where the pO2 is too low for the cytochrome o complex to function yet too high for alcohol dehydrogenase and fumarate reductase (Becker et al., 1997Down ; Tseng et al., 1996Down ). The LDH is also functional under such micro-oxic conditions and, like cyd, is regulated by ArcAB. Unlike cyd, ldhA is not affected by Fnr, perhaps because LDH is also functional under fully anaerobic and fermentative conditions.

Inactivation of the mlc regulatory gene (Kim et al., 1999Down ; Plumbridge, 1999Down ) had by far the greatest effect on the expression of the ldhA–lacZ fusions that we observed. Expression of both protein and operon fusions, under all growth conditions tested, was almost totally abolished by the presence of mlc ::Tet. The Mlc (=DgsA) protein is a repressor of several genes of the phosphotransferase system, including ptsHIcrr, ptsG and manXYZ (Kimata et al., 1998Down ; Plumbridge, 1998aDown , bDown ). The presence of glucose and other sugars derepresses these transport genes. The mechanism involves the sequestration of Mlc by non-phosphorylated PtsG (Lee et al., 2000Down ; Tanaka et al., 2000Down ). In ptsG mutants, Mlc-controlled genes become non-inducible as no PtsG is available to bind Mlc. The presence of PtsG is also required for induction of the glycolytic genes gapA and gapB-pgk (Charpentier et al., 1998Down ) by glucose.

In the present case, Mlc exerts a positive regulatory effect on ldhA. Examination of the DNA upstream of ldhA shows no sequence which agrees with the deduced consensus sequence for Mlc-binding sites (Plumbridge, 2001Down ). Moreover, no binding of Mlc to the ldhA upstream region was detected in vitro, at least under standard conditions (J. Plumbridge, personal communication). Thus the regulatory effect of Mlc on ldhA appears to be indirect. Mlc is known to repress the MalT activator, so perhaps it might activate transcription of an ldhA-specific activator that is yet to be identified. Hence mlc-negative strains would behave as activator minus. Using an mlc–lacZ fusion, we found that mlc itself was expressed at a two- to threefold higher level anaerobically, although no effect of pH was seen. Though small, this effect was consistent and was seen during growth on several different carbon sources. What induces mlc anaerobically remains unknown. Overall, the anaerobic component of ldhA induction may be accounted for, at least in part, by the increased transcription of mlc.

The CsrAB regulatory system controls the balance between carbon storage (as glycogen, which accumulates in stationary phase) and the breakdown of sugars by glycolysis (Liu et al., 1997Down ; Romeo, 1998Down ). The Csr system is unusual in consisting of an RNA-binding protein, CsrA, plus an RNA molecule, CsrB (Liu et al., 1997Down ; Romeo, 1998Down ). CsrA is primarily an activator of glycolysis and a repressor of gluconeogenesis and glycogen synthesis (Romeo et al., 1993Down ). The binding of CsrA promotes decay of glg mRNA (Liu et al., 1995Down ) and in a csrA ::Kan mutant, glycogen is overproduced. Whether CsrB is merely a dock for CsrA or is actively involved in combating the effects of CsrA is still debatable. Although overproduction of CsrB antagonizes the effect of CsrA by sequestration, insertional inactivation of csrB has relatively minor effects (Liu et al., 1997Down ).

In the present case, introduction of csrA ::Kan reduced expression of ldhA approximately fivefold. The csrB ::Cam knockout had a positive though small effect on ldhA expression. However, a glgA ::Kan knockout increased ldhA expression significantly. This suggested that the effect of CsrA on ldhA might be indirect, via its effect on glycogen accumulation. If glycogen synthesis is slow (as in glgA ::Kan strains), more sugar would be available for glycolysis and fermentation. Conversely, if glycogen accumulates rapidly (as with csrA ::Kan), there is less free hexose. If the expression of ldhA responds to the availability of hexoses and/or derived glycolytic intermediates such as pyruvate, this would explain the present results.

Pyruvate builds up in the absence of respiratory metabolism and is the substrate for LDH. The fermentative D-LDH of E. coli is known to be allosterically activated by pyruvate (Tarmy & Kaplan, 1968bDown ). Here we have shown that expression of ldhA was also increased by pyruvate by two- to fourfold. The effect was specific for pyruvate as none of the fermentation acids acetate, formate, lactate or succinate had any effect on ldhA expression. The pyruvate analogue 2-ketobutyrate had an opposite but marginal effect. Benzoate, a weak acid that lowers the internal pH (Rosner et al., 1994Down ; White et al., 1992Down ), did not induce the ldhA–lacZ fusions; in fact, higher concentrations of benzoate decreased expression somewhat. This implies that the response of ldhA to acidity is not due to lowering of the internal pH. We also found that the induction of ldhA by low pH only occurred when sugars were the carbon source. Cultures grown anaerobically on glycerol plus fumarate showed little or no effect of pH. Conceivably, the pH effect on ldhA expression may be due to the internal accumulation of pyruvate.

Unlike the fermentative alcohol dehydrogenase, whose levels respond to the accumulation of reducing equivalents in the form of NADH (Leonardo et al., 1993Down , 1996Down ), LDH levels respond to carbon flow. In view of its regulation by Mlc, one might almost regard LDH as the final step in the PTS. After phosphoenolpyruvate donates its phosphate to the incoming sugar, the pyruvate formed is disposed of by conversion to lactate by LDH, under fermentative conditions.


    ACKNOWLEDGEMENTS
 
This work was supported by a grant to D.C. from the US Department of Energy, Office of Basic Energy Sciences (contract DE-FG02-88ER13941).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Aristarkhov, A., Mikulskis, A., Belasco, J. G. & Lin, E. C. C. (1996). Translation of the adhE transcript to produce ethanol dehydrogenase requires RNase III cleavage in Escherichia coli. J Bacteriol 178, 4327-4332.[Abstract/Free Full Text]

Becker, S., Vlad, D., Schuster, S., Pfeiffer, P. & Unden, G. (1997). Regulatory O2 tensions for the synthesis of fermentation products in Escherichia coli and relation to aerobic respiration. Arch Microbiol 168, 290-296.[Medline]

Birnboim, H. C. & Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7, 1513-1523.[Abstract/Free Full Text]

Böck, A. & Sawers, G. (1996). Fermentation. In Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd edn, pp. 262–282. Edited by F. C. R. Neidhardt and others. Washington, DC: American Society for Microbiology.

Bullock, W. O., Fernandez, J. M. & Short, J. M. (1987). XL1-Blue, a high-efficiency, plasmid-transforming recA Escherichia coli strain with beta-galactosidase selection. Biotechniques 5, 376-380.

Bunch, P. K., Mat-Jan, F., Lee, N. A. & Clark, D. P. (1997). The ldhA gene encoding the fermentative lactate dehydrogenase of Escherichia coli. Microbiology 143, 187-195.[Abstract]

Charpentier, B., Bardey, V., Robas, N. & Branlant, C. (1998). The EIIGlc protein is involved in glucose-mediated activation of Escherichia coli gapA and gapB-pgk transcription. J Bacteriol 180, 6476-6483.[Abstract/Free Full Text]

Chuang, S. E. & Blattner, F. R. (1993). Characterization of twenty-six new heat shock genes of Escherichia coli. J Bacteriol 175, 5242-5252.[Abstract/Free Full Text]

Clark, D. P. (1989). Fermentation pathways of Escherichia coli. FEMS Microbiol Rev 63, 223-234.

Clark, D. P. & Rod, M. L. (1987). Regulatory mutations that allow the growth of Escherichia coli on butanol as a carbon source. J Mol Evol 25, 151-158.[Medline]

Dailly, Y. P. (1998). Molecular cloning and analysis of AdhR, a protein regulating alcohol fermentation in Escherichia coli. Doctoral Dissertation, Southern Illinois University, Carbondale, IL.

Decker, K., Plumbridge, J. & Boos, W. (1998). Negative transcriptional regulation of a positive regulator: the expression of malT, encoding the transcriptional activator of the maltose regulon of Escherichia coli, is negatively controlled by Mlc. Mol Microbiol 27, 381-390.[Medline]

Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557-584.[Medline]

Haugaard, N. (1959). D- and L-lactic acid oxidases of Escherichia coli. Biochim Biophys Acta 31, 66-77.

Iuchi, S., Chepuri, V., Fu, H. A., Gennis, R. B. & Lin, E. C. C. (1990). Requirement for terminal cytochromes in generation of the aerobic signal for the arc regulatory system in Escherichia coli, study utilizing deletions and lac fusions of cyo and cyd. J Bacteriol 172, 6020-6025.[Abstract/Free Full Text]

Kim, S. Y., Nam, T. W., Shin, D., Koo, B. M., Seok, Y. J. & Ryu, S. (1999). Purification of Mlc and analysis of its effects on the pts expression in Escherichia coli. J Biol Chem 274, 25398-25402.[Abstract/Free Full Text]

Kimata, K., Inada, T., Tagami, H. & Aiba, H. (1998). A global repressor (Mlc) is involved in glucose induction of the ptsG gene encoding major glucose transporter in Escherichia coli. Mol Microbiol 29, 1509-1519.[Medline]

Kline, E. S. & Mahler, E. R. (1965). The lactic acid dehydrogenases of Escherichia coli. Ann N Y Acad Sci 119, 905-917.[Medline]

Lee, S. J., Boos, W., Bouche, J. P. & Plumbridge, J. (2000). Signal transduction between a membrane-bound transporter, PtsG, and a soluble transcription factor, Mlc, of Escherichia coli. EMBO J 19, 5353-5361.[Medline]

Leonardo, M. R., Cunningham, P. R. & Clark, D. P. (1993). Anaerobic regulation of the adhE gene, encoding the fermentative alcohol dehydrogenase of Escherichia coli. J Bacteriol 175, 870-878.[Abstract/Free Full Text]

Leonardo, M. R., Dailly, Y. P. & Clark, D. P. (1996). Role of NAD in regulating the adhE gene of Escherichia coli. J Bacteriol 178, 6013-6018.[Abstract/Free Full Text]

Liu, M. Y., Yang, H. & Romeo, T. (1995). The product of the pleiotropic Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA stability. J Bacteriol 177, 2663-2672.[Abstract/Free Full Text]

Liu, M. Y., Gui, G., Wei, B., Preston, J. F.3rd, Oakford, L., Yuksel, U., Giedroc, D. P. & Romeo, T. (1997). The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli. J Biol Chem 272, 17502-17510.[Abstract/Free Full Text]

Mason, T. G. & Richardson, G. (1981). Escherichia coli and the human gut, some ecological considerations. J Appl Bacteriol 51, 1-16.[Medline]

Mat-Jan, F., Alam, K. Y. & Clark, D. P. (1989). Mutants of Escherichia coli deficient in the fermentative lactate dehydrogenase. J Bacteriol 171, 342-348.[Abstract/Free Full Text]

Mayr, U., Hansel, R., Deparade, M., Pauly, H. E., Pfleiderer, G. & Tromer, W. E. (1982). Structure–function relationship in the allosteric L-lactate dehydrogenases from Lactobacillus casei and Lactobacillus curvatus. Eur J Biochem 126, 549-558.[Medline]

Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Ogino, T., Arata, Y. & Fujiwara, S. (1980). Proton correlation nuclear magnetic resonance study of metabolic regulation and pyruvate transport in anaerobic Escherichia coli cells. Biochemistry 19, 3684-3691.[Medline]

Peekhaus, N. & Conway, T. (1998). What’s for dinner? Entner–Doudoroff metabolism in Escherichia coli. J Bacteriol 180, 3495-3502.[Free Full Text]

Plumbridge, J. (1998a). Control of the expression of the manXYZ operon in Escherichia coli, Mlc is a negative regulator of the mannose PTS. Mol Microbiol 27, 369-380.[Medline]

Plumbridge, J. (1998b). Expression of ptsG, the gene for the major glucose PTS transporter in E. coli, is repressed by Mlc and induced by growth on glucose. Mol Microbiol 29, 1053-1063.[Medline]

Plumbridge, J. (1999). Expression of the phosphotransferase system both mediates and is mediated by Mlc regulation in Escherichia coli. Mol Microbiol 33, 260-273.[Medline]

Plumbridge, J. (2001). DNA binding sites for the Mlc and NagC proteins: regulation of nagE, encoding the N-acetylglucosamine-specific transporter in Escherichia coli. Nucleic Acids Res 29, 506-514.[Abstract/Free Full Text]

Romeo, T. (1998). Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol Microbiol 29, 1321-1330.[Medline]

Romeo, T., Gong, M., Liu, M. Y. & Brun-Zinkernagel, A. M. (1993). Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J Bacteriol 175, 4744-4755.[Abstract/Free Full Text]

Rosner, J. L. & Slonczewski, J. L. (1994). Dual regulation of inaA by the multiple antibiotic resistance (Mar) and superoxide (SoxRS) stress response systems of Escherichia coli. J Bacteriol 176, 6262-6269.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467.[Abstract/Free Full Text]

Sato, H. & Miura, K. K. (1963). Preparation of transforming deoxyribonucleic acid by phenol treatment. Biochim Biophys Acta 72, 619-629.[Medline]

Simons, R. W., Howner, F. & Kleckner, N. (1987). Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53, 85-96.[Medline]

Taguchi, H. & Ohta, T. (1991). D-Lactate dehydrogenase is a member of the D-isomer specific 2-hydroxyacid dehydrogenase family. J Biol Chem 266, 12588-12594.[Abstract/Free Full Text]

Tanaka, Y., Kimata, K. & Aiba, H. (2000). A novel regulatory role of glucose transporter of Escherichia coli : membrane sequestration of a global repressor Mlc. EMBO J 19, 5344-5352.[Medline]

Tarmy, E. M. & Kaplan, N. O. (1968a). Chemical characterization of D-lactate dehydrogenase from Escherichia coli B. J Biol Chem 243, 2579-2586.[Abstract/Free Full Text]

Tarmy, E. M. & Kaplan, N. O. (1968b). Kinetics of Escherichia coli B D-lactate dehydrogenase and evidence for pyruvate controlled change in conformation. J Biol Chem 243, 2587-2596.[Abstract/Free Full Text]

Tseng, C. P., Albrecht, J. & Gunsalus, R. P. (1996). Effect of microaerophilic cell growth conditions on expression of the aerobic (cyoABCDE and cydAB) and anaerobic (narGHJI, frdABCD, and dmsABC) respiratory pathway genes in Escherichia coli. J Bacteriol 178, 1094-1098.[Abstract/Free Full Text]

Vogel, H. J. & Bonner, D. M. (1956). Acetylornithinase in Escherichia coli. J Biol Chem 218, 97-103.[Free Full Text]

White, S., Tuttle, F. E., Blankenhorn, D., Dosch, D. C. & Slonczewski, J. L. (1992). pH dependence and gene structure of inaA in Escherichia coli. J Bacteriol 174, 1537-1543.[Abstract/Free Full Text]

Winkelman, J. W. & Clark, D. P. (1986). Anaerobically induced genes of Escherichia coli. J Bacteriol 167, 362-367.[Abstract/Free Full Text]

Received 22 February 2001; revised 16 May 2001; accepted 22 May 2001.


This article has been cited by other articles:


Home page
Microbiol. Mol. Biol. Rev.Home page
M.-J. Han and S. Y. Lee
The Escherichia coli Proteome: Past, Present, and Future Prospects
Microbiol. Mol. Biol. Rev., June 1, 2006; 70(2): 362 - 439.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
W. Chang, D. A. Small, F. Toghrol, and W. E. Bentley
Global Transcriptome Analysis of Staphylococcus aureus Response to Hydrogen Peroxide
J. Bacteriol., February 15, 2006; 188(4): 1648 - 1659.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Zhou, K. T. Shanmugam, and L. O. Ingram
Functional Replacement of the Escherichia coliD-(-)-Lactate Dehydrogenase Gene (ldhA) with the L-(+)-Lactate Dehydrogenase Gene (ldhL) from Pediococcus acidilactici
Appl. Envir. Microbiol., April 1, 2003; 69(4): 2237 - 2244.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
T. Polen, D. Rittmann, V. F. Wendisch, and H. Sahm
DNA Microarray Analyses of the Long-Term Adaptive Response of Escherichia coli to Acetate and Propionate
Appl. Envir. Microbiol., March 1, 2003; 69(3): 1759 - 1774.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, G. R.
Right arrow Articles by Clark, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, G. R.
Right arrow Articles by Clark, D. P.
Agricola
Right arrow Articles by Jiang, G. R.
Right arrow Articles by Clark, D. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2001 Society for General Microbiology.