|
|
||||||||
Research Paper |
Plant Pathology and Microbiology, Horticulture Research International, Wellesbourne, Warwickshire CV35 9EF, UK1
Entomology and Plant Pathology, Horticulture Research International, East Malling, West Malling, Kent ME19 6BJ, UK2
Author for correspondence: Derek J. Barbara. Tel: +44 1789 470382. Fax: +44 1789 470552. e-mail: Dez.Barbara{at}HRI.AC.UK
| ABSTRACT |
|---|
|
|
|---|
Keywords: serological detection in planta, hostpathogen interactions
Abbreviations: AMP, antigenic membrane protein; AP, apple proliferation; AY, aster yellows; AY-C, chlorante isolate of aster yellows; AY-PY, primula yellows isolate of aster yellows; CP, clover phyllody; E/H/T, export leader, hydrophilic and transmembrane domains, respectively, in the putative AMP; SPWB, sweet potato witches broom phytoplasma; WX, western X phytoplasma
The GenBank accession numbers for the sequences reported in this paper are AF244540 and AF244541 for AY-C and CP, respectively.
| INTRODUCTION |
|---|
|
|
|---|
Despite the fact that they clearly multiply freely in both plant and insect hosts, no phytoplasma has yet been grown in vitro. Many other members of the Mollicutes, notably within the genera Mycoplasma and Spiroplasma, may be grown in vitro, but have been shown to interact very specifically with host-cell membranes in vivo (Razin & Jacobs, 1992
; Yu et al., 2000
). We have proposed (Barbara et al., 1998
) that such interactions with the host are essential, rather than optional, for the growth of phytoplasmas. Serological studies have shown that in many phytoplasmas a single, reasonably abundant surface membrane protein is immunodominant (Clark et al., 1983
, 1989
). In other cases it has been found that several proteins in the membrane preparations are strongly antigenic; e.g. four and three proteins have been found, respectively, for the flavescence dorée and elm yellows phytoplasmas (Seddas et al., 1996
), which are serologically related members of the same subclade (Lee et al., 2000
). These antigenic membranes proteins (AMPs) are known to be serologically variable between phytoplasmas (e.g. Clark et al., 1983
, 1989
) and have been shown, by immunogold-labelling in electron microscopy studies, to be located on the external surface of the cell (Milne et al., 1995
). They are, therefore, good candidates to be at least one of the phytoplasma components involved in hostpathogen interactions. Preliminary evidence for one phytoplasma, the grapevine pathogen flavescence dorée, suggests that some unidentified pathogen-specific material in phytoplasma-enriched preparations will bind to insect cells (Lefol et al., 1993
).
Phytoplasma classification is currently based mainly on 16S rRNA gene sequences (Seemüller et al., 1998
). Aster yellows (AY) and related phytoplasmas form the largest division of the phytoplasmas in cladograms based on such data. Chlorante AY (AY-C) and clover phyllody (CP) are two serologically distinct phytoplasmas (Clark et al., 1983
, 1989
) that have been placed in separate subclades (IB and IC; Lee et al., 2000
) on the basis of 16S rRNA sequence data; this separation is supported by phylogenetic analysis of tuf gene sequences (Marcone et al., 2000
). Both AY-C and CP are known to have single AMPs (Clark et al., 1983
, 1989
).
The long-term aim of our project is to examine whether specific membrane proteins have any role in phytoplasmahost interactions. The first steps, as reported here, were the cloning and sequencing of the amp genes encoding the Amps from AY-C and CP phytoplasmas. Phytoplasma membrane proteins are difficult to purify from infected hosts; hence efficient in vitro expression of the proteins was developed both to allow serological confirmation that the correct genes had been cloned and to provide materials for planned studies into the interactions of these proteins with host components. A polyclonal antiserum raised against expressed CP Amp was tested as a reagent for the detection of this phytoplasma in plants. The AY and CP amp genes were compared with the genes for immunodominant proteins that have been recently cloned from phytoplasmas in other subclades, viz. apple proliferation (AP; Berg et al., 1999
), sweet potato witches broom (SPWB; Yu et al., 1998
) and western X (WX; Blomquist et al., 2001
), and the results are also reported here.
| METHODS |
|---|
|
|
|---|
Protein isolation and sequencing.
For immunoaffinity purification of the AMP of AY-C from crude preparations (Clark et al., 1983
, 1989
), monoclonal antibodies (mAbs) raised against AY-PY (Clark et al., 1989
) were mixed with extracts from infected C. roseus (200 µg mAbs per 2 ml extract, equivalent to 6 g infected tissue) in GM buffer (0·3 M glycine, 0·05 M MgCl2, 0·1 M NaCl, 50 g sucrose l-1; pH 8·0) and held at 4 °C for 2 h. Phytoplasmaantibody complexes were sedimented by centrifugation (60000 g, 30 min) to separate them from unbound antibodies. Pellets were resuspended in GM buffer before mixing with a suspension of magnetic beads coated with goat anti-mouse antibodies. The mixture was further incubated for 2 h at 4 °C, and the beads were then collected magnetically and washed with GM buffer. The phytoplasmaantibody complexes were eluted from the beads with SDS-electrophoresis loading buffer (Laemmli, 1970
). Proteins in the extracts were separated by discontinuous electrophoresis on 1 mm thick, 12% polyacrylamide gels. Gels were stained with Coomassie blue, the AMP band was excised, and the excised gel fragments were transferred to a second 1·5 mm thick 12% gel so that the proteins could again be separated electrophoretically. Chemical cleavage of the AMP was achieved by treating the excised gel fragments containing the protein with 15 mM N-chlorosuccinimide in acetic acid/urea buffer (Lischwe & Ochs, 1982
) before the second electrophoresis step. Enzyme digestion was achieved by overlaying excised gel slices containing the AMP in the wells of the gel used for the second electrophoresis step with a solution of Glu-C protease (Sigma). During electrophoresis the current was switched off for 40 min before the tracking dye reached the stackingseparation gel interface to allow proteolysis to proceed; separation was then resumed as normal (Cleveland et al., 1977
). For amino acid sequencing of the intact AMP or its cleavage products, protein bands were electroblotted onto a PVDF membrane after the second electrophoresis step. All protein sequencing was done by micro-Edman degradation, using a commercial service (Alta BioSciences).
Preparation of DNA and PCR.
DNA was prepared from plants as described by Ahrens & Seemüller (1992)
. All PCR, including inverse PCR (Ochman et al., 1990
), used standard methods.
Cloning and sequencing.
For AY-C, degenerate PCR primers were designed from the amino acid sequences generated as above using the standard genetic code because there is no evidence that the UGG codon is used for tryptophan rather than as a stop codon (as is the case in Mycoplasma, Spiroplasma and some other Mollicutes; Bové et al., 1989
). Where appropriate, allowance was made for the probable low G+C content of the genome when choosing between possible codons. Codon usage was also examined in the limited number of phytoplasma genes already characterized (data not shown). Other primers were based on the sequence initially obtained. For CP, amplification of the amp gene from CP used primers based on the AY-C amp gene sequence; various primer pairs were tested and several resulted in successful amplification. The largest amplicon spanning the amp gene was produced by primers 430 (5'-AAAAACTAGGTTAAAAAACCTAGC-3') and 427 (5'-CTGGCTTTACTTTTGTTTAGAAC-3').
All cloning of the PCR products into non-expression vectors used pMOS-Blue (initially as a T-A system, but later as a blunt-end ligation system; both were used according to the manufacturers instructions; Amersham). Cloning into the expression vector pLEX (Invitrogen) was done by using PCR to introduce appropriate restriction endonuclease sites (and where appropriate stop codons) into amplicons which could then be cloned in-frame (NdeI and XbaI sites in the multiple cloning site for AY-C; NdeI and PstI sites for CP). Termination codons were introduced into the AY-C clones. This strategy added a leucine-glutamine pair to the C-terminus of expressed CP proteins, but not to the AY-C proteins. PCRs intended for producing amplicons to be cloned into the expression vectors used template DNA from infected plants rather than clones in pMOS-Blue.
All sequencing was done by a commercial service (Sequiserve). Except in a few limited cases, it was assumed that the low G+C content of the phytoplasma genome would mean that the PCR primers would not be good sequencing primers. The sequence data presented here were generated using conserved primers based on the plasmids used. Where large amplicons were sequenced, some initial data were obtained using sequencing primers based on the initial sequence obtained from the ends of those amplicons, but all such sequence data were confirmed by sequencing other clones that covered the same regions using conserved primers. All sequences relating directly to amp genes were confirmed by sequencing at least three separate clones (and in the case of CP, amplicons from several isolates).
Sequence assembly and analysis was completed using either GeneJockey II or DNAStar software. Other analyses were done via the EMBL web site (http://www2.ebi.ac.uk).
Protein expression and analysis.
Protein expression from pLEX (Invitrogen) was done according to the suppliers instructions. Bistris/HCl/SDS-PAGE gels were obtained commercially (Novex and Invitrogen) and were used according to the manufacturers instructions with the MES buffer supplied. Staining and Western blot analysis were done by standard procedures (Sambrook et al., 1989
).
Antiserum production.
The preparation of polyclonal antisera and mAbs to CP- and AY-associated antigens extracted from plants has been described previously (Clark et al., 1983
, 1989
). A polyclonal antiserum to CP Amp expressed in Escherichia coli was prepared in a New Zealand White rabbit by four injections at fortnightly intervals. All injections comprised about 500 µg total protein from the fraction pelleted by centrifugation from lysed bacterial cells. For the first injection the cells carried a plasmid expressing the entire ORF, but on the three other occasions a plasmid expressing only the leader sequence and main hydrophilic domain was used (see Results for details of clones).
| RESULTS |
|---|
|
|
|---|
Cloning the AY-C amp gene
Initially, inverse PCR using degenerate primers designed from the 20 aa N-terminal sequence led to the cloning of a potential ORF, but further study suggested that this did not encode the Amp. In a second attempt to clone the amp gene, degenerate primers were designed based on the amino acid sequences of the protein fragments. Since the order of the fragments was not known, primers were designed in both directions for each fragment (except for the primer based on the N-terminal sequence of the intact protein). All possible pairs of primers were used in PCR and several amplicons of various lengths were produced; the longest of these were cloned and sequenced. Non-degenerate primers based on these new sequence data were then used in inverse PCR to extend the original sequence until an approximately 2375 bp contig was constructed. As was expected from the known properties of phytoplasma genomes, the contig had a low G+C content (27·1 mol%), suggesting that the sequence was phytoplasmal, not host-derived.
Analysis using the standard genetic code identified two large ORFs (one complete and one partial) and one possible small incomplete ORF within the contig (Fig. 1
). The two intergenic regions were quite different in length. There was a probable RBS (AAAGGAG) upstream from the translation start site of the complete ORF which would pair with the reported nucleotide sequence two removed from the 3'-terminus of the AY 16S rRNA molecule (ucUUUCCUC) (Kuske & Kirkpatrick, 1992
). Possible transcription signals were located nearby (-35; TTGTTA: -10; TATAAT). Short, slightly imperfect, inverted repeats occurred just downstream of the complete ORF (TTTAAAAAGCT AGGTTTTTTAA) and these may act as a transcription terminator. A shorter sequence (AAGGA) may form an RBS for the small incomplete ORF; however, no convincing transcription signals were found preceding it. Searches of the GenBank, EMBL and Swissprot databases using the sequence of the putative translation product of the large incomplete ORF (316 aa) showed strong matches with the C-terminal portion of chaperonin (GroEL) genes from various organisms, and the ORF probably represents about 60% of the homologous gene. The best matches for the ORF were found with the chaperonins of other members of the Bacillus/Clostridium group of the Firmicutes, particularly Lactobacillus johnsonii (accession no. AF214488) and Listeria monocytogenes (GenBank accession no. AF335323). Equally good matches were found with some members of the Proteobacteria, e.g. Helicobacter pylori (accession no. P42383). Several of these matches showed more than 50% identity with 75% similarity for spans of more than 100 aa with no gapping. Matches with chaperonins from other Mollicutes, such as Mycoplasma genitalium (GI no. 12045254), were clear, but less strong than those detailed above. No significant sequence matches were found for the small incomplete ORF.
|
|
To confirm the sequence, and to determine whether any sequence changes had occurred during culture of the original isolate in C. roseus, the same primers were used to produce the equivalent amplicon using template DNA from two other isolates held in the greenhouse and one from a natural infection in a field-grown strawberry plant with strawberry green petal disease. When sequenced, all three of these amplicons were identical to the original.
As expected from the positions of the primers in the AY-C sequence, the CP-derived sequence (Fig. 1
) had short regions homologous to the two partial ORFs in AY-C. The overall G+C content was 23 mol%. One complete ORF (495 bp; G+C content 35 mol%) encoding a putative 164 aa protein was present. A potential RBS (AAAGGAG) and transcription signals similar to those in AY-C (-35; CTGTTA: -10; TATGAT) were located upstream of the translation start codon. Downstream of the translation terminator were a pair of short inverted repeats (TTAAAAAAGCT AGGTTTTTTAA). The putative translation product from the complete ORF had similar domains to those in the AY-C Amp (Fig. 1
), i.e. a hydrophobic leader sequence at the N-terminus with a predicted cleavage site between residues 32 and 33, a probably extracellular hydrophilic domain (smaller than that in AY-C), a hydrophobic region with predicted transmembrane region (at amino acids 142158) and a short hydrophilic C-terminal region. The computer prediction (PSORT) for the presence of a leader sequence was not as strong for CP Amp (4·41) as for AY-C Amp (6·06). As with AY-C, the putative translation product was rich in valine (15·9 mol%), lysine (11·0 mol%) and alanine (12·2 mol%). The CP sequence had no cysteines.
Sequence comparisons of AY-C and CP. The level of nucleic acid sequence identity between AY-C and CP varied considerably. Sequence identities for the intergenic regions were high (Table 1
), except in short regions immediately following the translation terminator codons for the amp ORFs (TCTTATTTAATCATTA in AY-C and TTAATCCCTAAATTATATTCTTT in CP) which cannot be easily aligned. Immediately following these short sequences were the repeats which may form the transcription stop signals and the short divergent sequences which may represent the 3'-UTR of the mRNAs. Within the amp ORFs, levels of identity also varied greatly. For those regions predicted to encode the large hydrophilic domains identity was low, but identity was high for the other regions (Table 1
). Comparisons at the amino acid level also gave strikingly varied levels of identity. The hydrophobic leader sequence, the transmembrane region and the short hydrophilic C-terminal part were all conserved in both length and sequence between the two phytoplasmas, but the main hydrophilic domain differed greatly in both length and sequence (Fig. 1
; Table 1
). In CP there was no evidence of poorly conserved large repeats similar to those seen with AY-C, but the majority of the hydrophilic domain could be aligned with the second AY-C repeat (but with only about 20% of the amino acids identical).
|
Sequence comparisons of other protein sequences. For both AY-C and CP Amps, simple database searches gave no significant matches for sequence similarities nor did searches for functional motifs (other than the bacterial leader sequence/cleavage point and transmembrane region), with one exception: when AY-C sequence was used to scan RELIBASE (http://www2.ebi.ac.uk), a database of ligand-binding proteins, a clear match was found against a short peptide (C2) from protein G, an IgG Fc-binding protein from a Streptococcus sp. The region of greatest identity (10/13 residues) corresponded with part of the peptide that forms an
-helix, which is closely associated with the site of binding to the IgG molecule (Sauer-Eriksson et al., 1995
). Searching RELIBASE with the CP Amp sequence did not produce a similar match, but both the two repeats in AY-C and the CP sequence showed four or five identical amino acids in the same region.
Comparisons of flanking sequences. No significant similarity was apparent between the putative intergenic regions either side of the Amp ORFs of the AY-C/CP pair, AP, SPWB or WX. Both AY-C and CP have a putative chaperonin as their upstream ORF (about 60% sequenced for AY-C, but only a short sequence from the C-terminus was obtained from CP). The WX immunodominant protein gene (idp) has a probable DNA polymerase gene upstream (Blomquist et al., 2001
). Both AP and SPWB immunodominant membrane protein genes have upstream ORFs of unknown function which share strong similarities (40·7% identical residues with no gaps introduced) (Berg et al., 1999
; Yu et al., 1998
). These unidentified ORFs have no significant similarity to chaperonin genes or to DNA polymerase genes.
Expression of Amps in E. coli and serology
Using the vector pLEX, a series of stable clones expressing various domains of both AY-C and CP were obtained. For AY-C these comprised the entire ORF (E/H/T) or the main hydrophilic domain alone (H). Despite two attempts, no clones of the hydrophilic domain with the leader sequence (E/H) or of the hydrophilic domain with the C-terminal transmembrane region (H/T) could be obtained. For CP all four types of construct (E/H/T, H, E/H, H/T) attempted were produced successfully. Generally good levels of expression were obtained following induction from the six clones used (Fig. 3
), but for both phytoplasmas clones comprising the entire ORF (E/H/T) always produced lower levels of protein than the other clones.
|
|
|
|
-based ELISA (Barbara & Clark, 1982
|
| DISCUSSION |
|---|
|
|
|---|
As might be expected for two phytoplasmas contained within subclades of a single clade, parts of the Amps (the N-terminal leader, second transmembrane and short C-terminal region) were strongly conserved between the two phytoplasmas. However, the main hydrophilic domains differed greatly in size (166 aa for AY-C as opposed to 99 aa for CP) and had low sequence similarity in simple alignments. This high divergence between the hydrophilic regions was emphasized by the high similarity at the nucleotide level between the flanking intergenic regions, which we had expected to be more divergent than the amp coding regions. As members of the same clade, albeit different subclades, AY-C and CP presumably share a common evolutionary origin. There was some suggestion from the AY-C sequence that a large part of its major hydrophilic domain comprised two poorly conserved repeats and that these corresponded to an equivalent part of the CP sequence. The surprisingly large length difference for the two proteins might therefore be explained by sequence duplication in the AY-C gene after this phytoplasmas lineage diverged from that of CP (or by repeat loss in CP). The amp ORF appears to be approximately 10 mol% more G+C-rich than the complete contigs for both phytoplasmas. For CP it may be argued that this results from the ORF being composed of codons, with consequent limitations on the tendency to lower G+C. However, for AY-C a large portion of the contig is the upstream chaperonin gene and this should also limit the reduction in G+C content. The possible significance of the amp ORFs being somewhat more G+C-rich is unclear.
No sequence similarity was seen between either of the amp genes cloned here from the AY clade phytoplasmas and the membrane protein genes cloned from AP, SPWB and WX phytoplasmas (Yu et al., 1998
; Berg et al., 1999
; Blomquist et al., 2001
) which are in the AP, faba bean phyllody and WX clades, respectively (Seemüller et al., 1998
). All five proteins would appear to have major hydrophilic domains on the exterior of the phytoplasma. However, the SPWB and AP proteins are not anchored by a C-terminal transmembrane region, but rather by a non-cleavable N-terminal transmembrane domain. The WX protein is similar to AY-C and CP in having two hydrophobic domains within the primary translation product, but in WX neither would appear to be removed by cleavage (Blomquist et al., 2001
). This protein presumably presents the hydrophilic domain as a loop held between two membrane anchors. Despite these differences in secondary structure these proteins all represent a single immunodominant phytoplasma antigen in extracts from infected plants. However, we have no understanding of the function of any of these proteins and should not assume they are homologues. The variation in both structure and genomic locations would suggest that the sequences of three distinct genes from five phytoplasmas have now been reported: (i) for the immunodominant membrane proteins (Imp) from SPWB and AP (Yu et al., 1998
; Berg et al., 1999
), (ii) for the immunodominant protein (Idp) from WX (Blomquist et al., 2001
) and (iii) for the antigenic membrane proteins (Amp) from AY-C and CP (this study). Why three different proteins should each be immunodominant in the different phytoplasmas is, as yet, unknown.
Phytoplasmas were once thought to be closely related to the genus Mycoplasma, and were referred to as Mycoplasma-like organisms or MLOs. Phytoplasmas and mycoplasmas are both still classified in the order Mollicutes, with their ancestors thought to be similar to members of the Bacillus/Clostridium group of the Firmicutes. However, the relationship between the two is now thought to be less close (Lee et al., 2000
) and this division might appear to be supported by the greater similarity of the phytoplasma chaperonin gene to genes from bacterial members of the Bacillus/Clostridium group than to those from Mycoplasma spp. However, both phytoplasmas and Mycoplasma spp. have very small genomes compared to their supposed bacterial ancestors and the apparent divergence may be due to loss of homologous genes during genome reduction. This explanation is supported by the sequence similarity between the phytoplasma chaperonin gene and (presumably homologous) chaperonin genes from Proteobacteria being as high as that found when comparing chaperonin genes from bacteria of the Bacillus/Clostridium group of bacteria amongst themselves.
ELISAs are effective methods for detecting phytoplasmas in hosts which, although perhaps not as sensitive as PCR and not able to detect as great a range of organisms as when using conserved primers for PCR, are very useful for rapid, cost-effective screening for specific organisms. Polyclonal antisera and mAbs have been raised against many phytoplasmas using plant-derived antigens. However, for reasons which are unclear, for some phytoplasmas no satisfactory antisera have been produced this way. The antiserum raised here to expressed Amp proved better at detecting the phytoplasma in plants than previously available antisera raised against plant-derived antigens. Raising similar antisera would be a useful approach for other phytoplasmas where the immunodominant protein genes can be cloned but where no antisera are yet available. It would also be a cost-effective alternative to mAb production.
Whilst the biochemical functions of the AMPs are still unknown, the high divergence between the exposed hydrophilic domains suggests that they are under strong selective pressure. In the light of our hypothesis that the AMP is associated with hostpathogen interactions at the cellular level, it is tempting to suggest that this variability may be related to host specificity. Although the AY-C AMP clearly does not function by binding IgG in vivo or in ELISAs, its similarity to part of the active site of an IgG-binding peptide from protein G may suggest that the AY-C AMP has some ligand-binding function. The AMP and protein G (accession no. P19909; Olsson et al., 1987
) have similar structures and cellular localization, and both occur in members of the Bacillus/Clostridium group of the Firmicutes. Taken with the sequence identity this may suggest that they are homologous proteins. However, as the evidence for similar sequences being present in the CP AMP is scant, the significance of these identities is as yet unclear.
The predicted properties of the Amps of AY-C and CP phytoplasmas are consistent with their being membrane proteins and the large difference between them, despite their being in the same rRNA clade, suggests they are under relatively strong divergent selective pressure and may, therefore, possibly have important functions. We are currently investigating whether such large differences occur between the main hydrophilic domain of homologues of membrane proteins from phytoplasmas in other clades. We have also begun to study whether direct interactions can occur between the Amps and host cell surface components.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
Barbara, D. J. & Clark, M. F. (1982). A simple indirect ELISA using F(ab')2 fragments of immunoglobulin. J Gen Virol 58, 315-322.
Barbara, D. J., Davis, D. L. & Clark, M. F. (1998). Cloning and sequencing of a major membrane protein from chlorante (AY) phytoplasma. In Proceedings of the 12th International Organisation of Mycoplasmology, Sydney, Australia, p. 183. Sydney: International Organisation of Mycoplasmology.
Berg, M., Davis, D. L., Clark, M. F., Vetten, H. J., Maier, G., Marcone, C. & Seemüller, E. (1999). Isolation of the gene encoding an immunodominant membrane protein of the apple proliferation phytoplasma, and expression and characterization of the gene product. Microbiology 145, 1937-1943.
Blomquist, C. L., Barbara, D. J., Davies, D. L., Clark, M. F. & Kirkpatrick, B. C. (2001). Cloning and characterization of a major membrane protein of the X-disease phytoplasma. Microbiology 147, 571-580.
Bové, J. M., Carle, P., Garnier, M., Laigret, F., Renaudin, J. & Saillard, C. (1989). Molecular and cellular biology of spiroplasmas. In The Mycoplasmas , pp. 243-364. Edited by R. F. Whitcomb & J. G. Tully. San Diego, CA:Academic Press.
Clark, M. F., Barbara, D. J. & Davies, D. L. (1983). Production and characteristics of antisera to Spiroplasma citri and clover phyllody-associated antigens derived from plants. Ann Appl Biol 103, 251-259.
Clark, M. F., Morton, A. & Buss, S. L. (1989). Preparation of mycoplasma immunogens from plants and a comparison of polyclonal and monoclonal antibodies made against primula yellows MLO-associated antigens. Ann Appl Biol 114, 111-124.
Cleveland, D. W., Fischer, S. G., Kirschner, M. W. & Laemmli, U. K. (1977). Peptide mapping by limited proteolysis in sodium dodecyl sulfate analysis by gel electrophoresis. J Biol Chem 252, 1102-1106.
Hofmann, K. & Stoffel, W. (1993). TMbase a database of membrane spanning protein segments. Biol Chem Hoppe-Seyler 374, 166.
Keane, G., Edwards, E. & Clark, M. F. (1996). Differentiation of group 16Sr-IB aster yellows phytoplasmas with monoclonal antibodies. In Diagnostics in Crop Production (BCPC Symposium Series no. 65) , pp. 263-268. Edited by G. Marshall. Farnham, Surrey, UK:The British Crop Protection Council.
Kuske, C. R. & Kirkpatrick, B. C. (1992). Phylogenetic relationships between the western aster yellows mycoplasmalike organism and other prokaryotes established by 16S rRNA gene sequences. Int J Syst Bacteriol 42, 226-233.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Lee, I.-M., Davis, R. E. & Gunderson-Rindal, D. E. (2000). Phytoplasma: phytopathogenic mollicutes. Annu Rev Microbiol 54, 221-255.[Medline]
Lefol, C., Caudwell, A., Lherminier, J. & Larrue, J. (1993). Attachment of the flavescence dorée pathogen (MLO) to leafhopper vectors and other insects. Ann Appl Biol 123, 611-622.
Lischwe, M. A. & Ochs, D. (1982). A new method for partial peptide mapping using N-chlorosuccinimide/urea and peptide silver staining in sodium dodecyl sulphate-polyacrylamide gels. Anal Biochem 127, 453-457.[Medline]
Lorenz, K. H., Schneider, B., Ahrens, U. & Seemüller, E. (1995). Detection of the apple proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopathology 85, 771-776.
Marcone, C., Neimark, H., Ragozzino, A., Lauer, U. & Seemüller, E. (1999). Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathology 89, 805-810.[Medline]
Marcone, C., Lee, I.-M., Davis, R. E., Ragozzino, A. & Seemüller, E. (2000). Classification of aster yellows-group phytoplasmas based on combined analyses of rRNA and tuf gene sequences. Int J Syst Evol Microbiol 50, 1703-1713.[Abstract]
McCoy, R. E., Caudwell, A., Chang, C. J. & 16 other authors (1989). Plant diseases associated with Mycoplasma-like organisms. In The Mycoplasmas, vol. V, pp. 546623. Edited by R. F. Whitcomb & J. G. Tully. San Diego, CA: Academic Press.
Milne, R. G., Ramassso, E., Lenzi, R., Masenga, V., Sarindu, N. & Clark, M. F. (1995). Pre- and post-embedding immunogold labelling and electron microscopy in plant host tissues of three antigenically unrelated MLOs: primula yellows, tomato big bud and bermudagrass white leaf. Eur J Plant Pathol 101, 57-67.
Nakai, K. & Kanehisa, M. (1991). Expert systems for predicting protein localization sites in Gram-negative bacteria. Proteins Struct Funct Genet 11, 95-110.[Medline]
Neimark, H. & Kirkpatrick, B. C. (1993). Isolation and characterization of full-length chromosomes from non-culturable plant-pathogenic Mycoplasma-like organisms. Mol Microbiol 7, 21-28.[Medline]
Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10, 1-6.
Ochman, H., Medhora, M. M., Garza, D. & Hartl, D. L. (1990). Amplification of flanking sequences by inverse PCR. In PCR Protocols: a Guide to Methods and Applications , pp. 219-227. Edited by M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White. San Diego, CA:Academic Press.
Olsson, A., Eliasson, M., Guss, B., Nilsson, B., Hellman, U., Lindberg, M. & Uhlen, M. (1987). Structure and evolution of the repetitive gene encoding streptococcal protein G. Eur J Biochem 168, 319-324.[Medline]
Posnette, A. F. & Ellenberger, C. E. (1963). Further studies of green petal and other leafhopper transmitted viruses infecting strawberry and clover. Ann Appl Biol 51, 69-83.
Razin, S. & Jacobs, E. (1992). Mycoplasma adhesion. J Gen Microbiol 138, 407-422.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sauer-Eriksson, A. E., Kleywegt, G. J., Uhlen, M. & Jones, T. A. (1995). Crystal structure of the C2 fragment of streptococcal protein G in complex with the Fc domain of human IgG. Structure 3, 265-278.[Medline]
Seddas, A., Meignoz, R., Daire, X. & Boudon-Padieu, E. (1996). Generation and characterization of monoclonal antibodies to flavescence dorée phytoplasma: serological relationships and differences in electroblot immunoassay profiles of flavescence dorée and elm yellows phyoplasmas. Eur J Plant Pathol 102, 757-764.
Seemüller, E., Marcone, C., Lauer, U., Ragozzino, A. & Göschl, M. (1998). Current status of molecular classification of the phytoplasmas. J Plant Pathol 80, 3-26.
Vibio, M., Bertaccinin, A., Lee, I.-M., Davis, R. E. & Clark, M. F. (1996). Differentiation and classification of aster yellows and related European phytoplasmas. Phytopathol Mediterr 35, 33-42.[Medline]
von Heijne, G. (1990). The signal peptide. J Membr Biol 115, 195-201.[Medline]
Yu, Y.-L., Yeh, K.-W. & Lin, C.-P. (1998). An antigenic protein gene of a phytoplasma associated with sweet potato witches broom. Microbiology 144, 1257-1262.
Yu, J., Wayadande, A. C. & Fletcher, J. (2000). Spiroplasma citri surface protein P89 implicated in adhesion to cells of the vector Circulifer tenellus. Phytopathology 90, 716-722.[Medline]
Received 2 March 2001;
revised 23 July 2001;
accepted 24 July 2001.
This article has been cited by other articles:
![]() |
L. T. T. Tran-Nguyen, M. Kube, B. Schneider, R. Reinhardt, and K. S. Gibb Comparative Genome Analysis of "Candidatus Phytoplasma australiense" (Subgroup tuf-Australia I; rp-A) and "Ca. Phytoplasma asteris" Strains OY-M and AY-WB J. Bacteriol., June 1, 2008; 190(11): 3979 - 3991. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kakizawa, K. Oshima, H.-Y. Jung, S. Suzuki, H. Nishigawa, R. Arashida, S.-i. Miyata, M. Ugaki, H. Kishino, and S. Namba Positive Selection Acting on a Surface Membrane Protein of the Plant-Pathogenic Phytoplasmas J. Bacteriol., May 1, 2006; 188(9): 3424 - 3428. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Bai, J. Zhang, A. Ewing, S. A. Miller, A. Jancso Radek, D. V. Shevchenko, K. Tsukerman, T. Walunas, A. Lapidus, J. W. Campbell, et al. Living with genome instability: the adaptation of phytoplasmas to diverse environments of their insect and plant hosts. J. Bacteriol., May 1, 2006; 188(10): 3682 - 3696. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Suzuki, K. Oshima, S. Kakizawa, R. Arashida, H.-Y. Jung, Y. Yamaji, H. Nishigawa, M. Ugaki, and S. Namba From the Cover: Interaction between the membrane protein of a pathogen and insect microfilament complex determines insect-vector specificity. PNAS, March 14, 2006; 103(11): 4252 - 4257. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Seemuller and B. Schneider 'Candidatus Phytoplasma mali', 'Candidatus Phytoplasma pyri' and 'Candidatus Phytoplasma prunorum', the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively Int J Syst Evol Microbiol, July 1, 2004; 54(4): 1217 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kakizawa, K. Oshima, H. Nishigawa, H.-Y. Jung, W. Wei, S. Suzuki, M. Tanaka, S.-i. Miyata, M. Ugaki, and S. Namba Secretion of immunodominant membrane protein from onion yellows phytoplasma through the Sec protein-translocation system in Escherichia coli Microbiology, January 1, 2004; 150(1): 135 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Melamed, E. Tanne, R. Ben-Haim, O. Edelbaum, D. Yogev, and I. Sela Identification and Characterization of Phytoplasmal Genes, Employing a Novel Method of Isolating Phytoplasmal Genomic DNA J. Bacteriol., November 15, 2003; 185(22): 6513 - 6521. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Duret, N. Berho, J.-L. Danet, M. Garnier, and J. Renaudin Spiralin Is Not Essential for Helicity, Motility, or Pathogenicity but Is Required for Efficient Transmission of Spiroplasma citri by Its Leafhopper Vector Circulifer haematoceps Appl. Envir. Microbiol., October 1, 2003; 69(10): 6225 - 6234. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Streten and K. S. Gibb Identification of genes in the tomato big bud phytoplasma and comparison to those in sweet potato little leaf-V4 phytoplasma Microbiology, July 1, 2003; 149(7): 1797 - 1805. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |