|
|
||||||||
Research Paper |
Max-Planck-Institute for Terrestrial Microbiology, Group Symbiosis Research, Karl-von-Frisch-Strasse,D-35043 Marburg, Germany1
University of Bremen, Faculty of Biology and Chemistry, Laboratory of General Microbiology, Postfach 330440, D-28334 Bremen, Germany2
Author for correspondence: Barbara Reinhold-Hurek. Tel: +49 421 218 2370. Fax: +49 421 218 4042. e-mail: breinhold{at}uni-bremen.de
| ABSTRACT |
|---|
|
|
|---|
-subgroup of the Proteobacteria. This paper reports a functionally similar NifL-like protein outside this group in Azoarcus sp. strain BH72, a diazotrophic grass endophyte belonging to the ß-subgroup of the Proteobacteria. Its structural genes for nitrogenase (nifHDK) are regulated in response to combined nitrogen and O2 and expressed endophytically inside rice roots. In order to characterize nitrogen-regulatory genes, an Azoarcus sp. BH72 genomic library was used to select cosmids that complemented a nifA mutation in Azotobacter vinelandii. Sequence analysis of the 3·4 kb genomic region complementing nifA showed two ORFs with sequence identities of 44% to NifL and 61% to NifA of Azotobacter vinelandii. According to Northern blot and reverse transcriptase PCR analysis, the nifLA transcript was more abundant at low combined nitrogen and O2 levels, results which were corroborated by GUS (ß-glucuronidase) assays using a transcriptional nifL::gusA fusion. N2 fixation was abolished in a NifLA- and a NifA- mutant, wild-type fixation being restored by nifLA in trans. The NifLA- mutant also failed to activate nifH::gus expression, indicating that NifA is the obligate transcriptional activator for nifHDK. A nifL mutant was diazotrophic and did not show repression of nifH::gusA by ammonium or O2, suggesting that NifL of Azoarcus sp. strain BH72 has a similar role in inactivating NifA in response to O2 and combined nitrogen as NifL in bacteria of the
-Proteobacteria. Keywords: nitrogenase, gene expression, transcriptional activator, NifA, NifL
Abbreviations: GUS, ß-glucuronidase
c The GenBank accession number for the sequence determined in this work is AF518560.
a Present address: Albert-Ludwigs-University Freiburg, Plant Biotechnology, Sonnenstrasse 5, D-79104 Freiburg, Germany.
b Present address: Department of Biochemistry, Biozentrum University of Basel, CH-4056 Basel, Switzerland.
| INTRODUCTION |
|---|
|
|
|---|
54-dependent transcriptional activator NifA in diazotrophic proteobacteria. Its activity is affected by the cellular nitrogen status and the O2 concentration; however, bacteria differ in the mechanisms mediating these responses.
In diazotrophs such as proteobacteria of the
-subgroup or Herbaspirillum seropedicae belonging to the ß-subgroup (Souza et al., 1991
), the NifA proteins are apparently directly responsive to O2. These proteins show a conserved cysteine motif in the central domain, not present in NifA proteins of the
-Proteobacteria, which is probably the site of a redox-sensitive FeS cluster (Dixon, 1998
; Fischer et al., 1988
). Diazotrophs belonging to the
-Proteobacteria such as Azotobacter vinelandii and Klebsiella pneumoniae are characterized by the NifL/NifA two-component regulatory system, with NifL being the sensor inhibiting NifA activity in response to O2 (Dixon, 1998
). Stoichiometric amounts of both proteins are needed to ensure proper transcriptional regulation (Dixon, 1998
; Govantes et al., 1996
). For O2 sensing, the flavoprotein NifL inhibits NifA activity in the oxidized form (Dixon, 1998
; Hill et al., 1996
).
The mechanism by which the cellular nitrogen status is sensed and the signal is transmitted is more complex and may vary considerably in different diazotrophs. One level of control is the transcriptional regulation of nifA itself, which may be nitrogen regulated via the two-component regulatory system NtrBC as in K. pneumoniae (Drummond et al., 1983
) or H. seropedicae (Souza et al., 2000
). At another level, the activity of NifA is modulated, PII-like proteins being central signal-transmitter proteins. Depending on the internal nitrogen status of the cell, a bifunctional uridylyl-transferase/hydrolase covalently modifies or demodifies the PII-like protein. Under conditions of nitrogen deficiency, the PII-like proteins in enteric bacteria occur mainly in the uridylylated form. They act as molecular switches depending on their state of modification (for a review, see Arcondéguy et al., 2001
). Most proteobacteria harbour two paralogous gene copies of PII-like proteins (glnB/glnK) (Ninfa & Atkinson, 2000
). In H. seropedicae and Azospirillum brasilense, GlnB is required to maintain the active form of NifA, either by direct interaction or by involvement of an as yet unkown protein (Arsène et al., 1996
, 1999
; Souza et al., 1999
). In
-Proteobacteria, NifA activity is mediated by NifL in response to combined nitrogen. Under nitrogen-limiting conditions, GlnK is required to relieve the inhibitory effect of NifL on NifA in K. pneumoniae (He et al., 1998
; Jack et al., 1999
). Interaction of PII-like proteins of Escherichia coli with Azotobacter vinelandii NifL was demonstrated in an in vitro system; however, E. coli GlnB (and Azotobacter vinelandii PII) rather than GlnK stimulated the inhibitory function of NifL in the non-uridylylated form (Little et al., 2000
).
Azoarcus sp. strain BH72 is an endophyte of grasses (Hurek et al., 1994b
) which belongs to the ß-Proteobacteria (Reinhold-Hurek et al., 1993b
). N2 fixation and nifHDK transcription occur only under microaerobic and nitrogen-limiting conditions (Egener et al., 1999
; Huwrek et al., 1987
). This diazotroph shows the capacity of endophytic N2 fixation: the structural genes of nitrogenase nifHDK were found to be expressed and translated in the aerenchyma of rice seedlings (Egener et al., 1999
). Under certain culture conditions including very low O2 concentrations, the cells can shift into a state of very high and efficient N2 fixation called hyperinduction (Hurek et al., 1994a
), forming novel intracytoplasmic membrane stacks (diazosomes) with which the iron protein of nitrogenase is associated (Hurek et al., 1995
). Therefore, we are interested in unravelling the signal transduction cascade for nif gene regulation of strain BH72. We report here the occurrence of a functionally similar NifL-like protein outside the
-Proteobacteria.
| METHODS |
|---|
|
|
|---|
|
|
Gas chromatography.
To determine O2 concentrations and ethylene formation, an HRGC-4000A (Konik, Barcelona, Spain) gas chromatograph was used as described previously (Egener et al., 1999
).
Techniques for DNA and RNA manipulation.
DNA and RNA analysis was carried out according to standard procedures (Ausubel et al., 1987
; Hurek et al., 1993
; Reinhold-Hurek et al., 1993a
). Homologous DNA gene probes for Southern and Northern blot analysis were digoxigenin (DIG)-labelled in a PCR reaction using the DIG Labelling and Detection Kit (Boehringer Mannheim). The nifA probe was amplified with T3/T7 primers using a 0·5 kb PstI subclone (pP05) of pTEA24 as template. Primers for nifH were TH25/TH26 (Hurek et al., 1997b
), and for 16S rDNA TH3/TH5 (Hurek et al., 1993
). RNA was isolated from exponentially growing cells, and Northern blot analysis carried out as previously described (Reinhold-Hurek et al., 1993a
). Reverse transcription PCR (RT-PCR) was carried out on RNA extracted by peqGOLD TriFast (peqLab) (Egener et al., 2001
), with 1 µg RNA using primer nifArev3RT (TCGTCCAGGTGCTCGCGGCTG) and Ready-to-go-beads (AmershamPharmacia Biotech) for reverse transcription at 42 °C for 30 min. Amplification of nifA cDNA was carried out using primers nifAfor1RT (ATGAGCGCGGCCGGTCCGATG) and nifArev2RT (CACGGTTTCGTGCCCGGCGCG) for 1828 cycles of 1 min 95 °C, 1 min 65 °C, 1 min 72 °C; samples were taken after different cycle numbers. For RT-PCR amplification of nifLA, primers RTnifLAfor (GAGAACGGCCAGGTCGACGTGGA, positions 17721792) and RTnifArev (GTTGAAGCCGCACTCCTCGTCGAGCA, positions 21942170) were used for 35 cycles of 95 °C for 1 min, 62 °C for 1 min and 72 °C for 1 min. Products were separated on 1·2% agarose gels. RT-PCR of 16S rRNA was carried out from 10 ng RNA with primers 1401rev (CGGTGTGTACAAGACCC) for reverse transcription and 104f (GGCGAACGGGTGMGTAAYGCACTGG) and 1346rev (TAGCGATTCCGACTTCA) for PCR amplification: 1 min 95 °C, 2 min 65 °C, 2 min 72 °C.
For primer extension analysis (Egener et al., 2001
), 15 µg RNA extracted with the peqGOLD TriFast Kit (peqLab) was used as starting template, along with the Cy5 labelled primer (Cy5PEnifLArev: GATCGCCGACTGCTCCACGG). The reaction mix was denatured at 72 °C for 3 min followed by gradual cooling to 42 °C, then the dNTP mix and AMV reverse transcriptase were added and incubated for 30 min. The reaction mix was then extracted with phenol/chloroform followed by ethanol precipitation of the single-stranded cDNA. The product was dissolved in TE (10 mM Tris, 1 mM EDTA) and analysed on an automated sequencer (ALFexpress; AmershamPharmacia Biotech) in parallel with a sequencing reaction carried out with the same primer and plasmid template pS08.
DNA sequencing and computational analysis.
Plasmid DNA was sequenced with Cy5 labelled primers (T3 and T7) using an automated sequencer (ALFexpress, AmershamPharmacia Biotech) as described by Hurek et al. (1997a
). Sequences determined for both strands were aligned using the DNAstar software and compared to databases using BLAST (Altschul et al., 1990
). Domain searches were carried out with the SMART (Schultz et al., 1998
) and Pfam (Sonnhammer et al., 1997
) programs. The sequence of nifLA was submitted to GenBank (accession no. AF518560).
Construction of a cosmid library of Azoarcus sp. BH72 and triparental mating.
Genomic DNA of Azoarcus sp. BH72 was partially digested with Sau3AI and cloned into the BamHI site of the cosmid vector pLAFR3 (Staskawicz et al., 1987
). The ligation mix was packaged into lambda phages using the DNA Packaging Kit (Boehringer Mannheim) and transfected into E. coli DH5
. A total of 1440 colonies were picked and stored as glycerol stocks at -80 °C. Triparental mating in Azotobacter vinelandii was carried out according to Page & Sadoff (1976)
using a helper plasmid [E. coli(pRK2013)] with a donor:helper:reipient ratio of 1:1:100. When the donor carried different inserts (i.e. a library) the ratio was altered to 5:1:100. The selection medium, containing tetracycline (12 µg ml-1), was N-free BS medium (Newton et al., 1953
) for Azotobacter vinelandii UW1. For conjugative plasmid transfer into Azoarcus sp., recipients were grown in liquid VM medium, mixed in a ratio of 1:1:500 and spread as a thin liquid layer on KON agar plates (SM medium supplemented with 5 g yeast extract l-1 and 1 g NaCl l-1). After 57 h incubation at 37 °C, cells were scraped off and plated in serial dilutions on SEL medium (SM medium containing 6 ml ethanol l-1 instead of potassium malate and 1 g KNO3 l-1 as sole nitrogen source) with 12 µg tetracycline ml-1.
Construction of Azoarcus sp. BH72 NifLA mutants and plasmids.
A nifLA knock-out mutant was constructed by interrupting the ORF of nifL by insertion of a Sp/Sm-resistance cartridge excised by SmaI from pHP45
(Prentki & Krisch, 1984
) into the EcoRV site (Fig. 1
) of pTEA24, resulting in pTEA24
. pTEA24
was introduced into Azoarcus sp. BH72 by electroporation, yielding double recombinants that had exchanged the interrupted allele with the wild-type allele. In Southern blot analysis, the wild-type showed hybridization of a 14 kb fragment of KpnI-digested genomic DNA with a probe against nifA, while the nifLA mutant, named BHLAO, showed a shift of 2 kb to 16 kb corresponding to the inserted cassette (data not shown). For a NifA- phenotype, strain BHLAO was complemented with pLAFRL, carrying the nifL gene including upstream sequences. pLAFRL was constructed by excising a 2 kb HindIII/BsrBI fragment from pTEA24, and cloning it into HindIII/EcoRV of pBKSII. From this vector the fragment was excised using HindIII/EcoRI and cloned into pLAFR3, yielding pLAFRL. This plasmid was introduced into Azoarcus BHLAO by triparental mating and the resulting strain named BHLAO(pLAFRL). The nifL mutant (BHNLK) was constructed by insertion of a non-polar Km-resistance (aphII) cartridge from pUC4K (AmershamPharmacia Biotech) into the nifL gene. The cartridge was excised by SalI, the overhanging ends blunted using T4 DNA polymerase, and the fragment inserted into the EcoRV site of nifL on pTEA24, yielding pTE24Km. Integration in the correct orientation was confirmed, and the construct was used for electroporation into Azoarcus sp. BH72. A double recombinant (nifL::aphII) confirmed by Southern hybridization (see above) was named BHNLK. For expression studies of nifLA, gusA was transcriptionally fused to the nifL gene by cloning a 1·3 kb PstI fragment from pP13 into the PstI site of pGusKS. This nifL::gusA fusion was excised by HindIII and partial digestion with BamHI and inserted into pLAFR3, yielding pLGus.
ß-Glucuronidase (GUS) assay.
GUS assays were carried out according to Jefferson et al. (1986)
. Glucuronidase activity was calculated as (A420x1000)/(t (min)xOD600)=Miller units.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
were used as cosmid library (insert size approx. 20 kb). After plasmid transfer by triparental mating into Azotobacter vinelandii mutant strain UW1, Nif+ Tetr colonies were selected on N-free BS medium. Out of 10 colonies tested, two types of cosmids with similar restriction fragments were isolated. The cosmids pTEA1 (16 kb insert) and pTEA2 (11 kb insert) allowed N2 fixation of mutant UW1, as did a subcloned 9 kb EcoRI/HindIII fragment (pLAFR24). Sequence analysis of subclones (Fig. 1
In Azoarcus NifA, the domain putatively interacting with
54 and the DNA-binding domains showed a much higher similarity to other NifA proteins than the N-terminal regulatory (or receiver) domains, which are highly variable, possibly indicating various modes of signal transduction in different bacteria. NifA proteins occurring outside the
-Proteobacteria reveal a characteristic motif of conserved cysteine residues located between the central catalytic domain and the C-terminal DNA-binding domain (Fischer et al., 1988
) which leads to O2 sensitivity of the protein. This motif is absent in the Azoarcus sequence, which further supports the notion that NifA proteins which operate in concert with NifL proteins are not intrinsically O2 sensitive (Dixon, 1998
).
Expression of nifLA is affected by O2 and ammonium
The ORFs of nifL and nifA of strain BH72 were closely adjacent (intergenic region 78 bp) (Fig. 1
). Only upstream of nifL were motifs characteristic of
54-dependent promoters (Fig. 2a
) corresponding well to the consensus (Merrick, 1992
). Primer extension analysis with an RNA preparation of an N2-fixing culture of strain BH72 corroborated the transcriptional start site. Using plasmid pS08 as a template for the parallel sequencing reaction, the transcriptional start was localized at minute 145·16, corresponding to the nucleotide marked by an arrow in Fig. 2(a
, b
) (minute 145·11), which was at position +1 with respect to the -12/-24 motif of the
54 promoter. Further upstream, motifs similar to the consensus of the NtrC-binding site (GCAC-N7-GTGC) and a motif identical to the consensus of the NifA-binding site (TGT-N10-ACA) were found (Fig. 2a
). However, data on nifLA expression in a NifLA mutant (see below) suggest that NifA is not involved in the transcriptional control.
|
insertional mutant BHLAO (see below), transcription of nifA was no longer detectable by RT-PCR (Fig. 2e
-Proteobacteria such as Azospirillum (Liang et al., 1991
The nifLA transcript was detectable in aerobically grown cells on combined nitrogen, but was more abundant during N2 fixation (Fig. 2c
). This differential expression was confirmed by RT-PCR. RT-PCR amplification products of nifA were more abundant in RNA extracts from N2-fixing cells than in extracts from ammonium-grown cells (Fig. 2e
). The use of equal amounts of RNA in both extracts was confirmed by RT-PCR using primers for 16S rRNA (Fig. 2e
).
To quantify the expression of the nifLA operon, a transcriptional nifL::gusA fusion was constructed on the broad-host-range vector pLAFR3 (pLGus) which was conjugated into Azoarcus strains. GUS activity of this fusion was tested in the wild-type background as well as the NifLA- background of BHLAO (see below) under various growth conditions 2, 4, 6, 8 and 16 h after incubation (data not shown). Maximum GUS activity was observed at 6 h. During aerobic incubation in both complex (VM) and minimal (SM) medium containing combined nitrogen (including 0·05% NH4Cl) the nifLA operon was expressed (Fig. 3
, bars 1 and 2), in accordance with the observed expression of nifLA in the presence of combined nitrogen in Northern blot experiments. O2 limitation increased the expression threefold (Fig. 3
, bar 3), while nitrogen limitation (absence of combined nitrogen in N-free SM medium) led to a fivefold increase (Fig. 3
, bar 4). Under culture conditions favourable for N2 fixation (1% O2, no combined nitrogen), a six- to sevenfold increase was measured (Fig. 3
, bar 5). The expression level (except for N2-fixing conditions) was equal for both genetic backgrounds, suggesting that autoregulation of nifLA does not occur in Azoarcus sp. BH72. Surprisingly, under N2-fixing conditions the nifLA mutant BHLAO reached lower expression levels than the wild-type, which might in part be due to severe growth limitations (the mutant stopped growing after 23 h of incubation and is not able to grow on N2 at all; see below).
|
54-dependent promoter is repressed by nitrogen but not by O2 (Souza et al., 2000
The nifA gene product is essential for N2 fixation of Azoarcus sp. strain BH72
To confirm the function of NifLA, a nifL::
strain (BHLAO) was constructed by marker-exchange mutagenesis, carrying a polar mutation in the nifL gene by insertion of a Sp/Sm-cartridge which also abolished nifA transcription (see above). While growth rates under aerobic conditions in both full (VM) and minimal (SM) medium were not affected in the mutant (not shown), BHLAO was not able to grow on N2 in the absence of combined nitrogen under microaerobic conditions (Fig. 4
). This inability to fix N2 was restored when pTEA2 provided the nifLA operon in trans in the mutant BHLAO(pTEA2). Growth of the complemented mutant was comparable to that of the wild-type and a control strain carrying a pLAFR3 vector devoid of insert (Fig. 4
). This suggested that a product of the nifLA operon was essential for N2 fixation in Azoarcus sp. strain BH72. A transcriptional fusion of Azoarcus sp. nifH with gusA (pEGN3.1; Egener et al., 1999
) was integrated into the chromosome of mutant BHLAO by single recombination, resulting in strain BHLAONG. In comparison to the wild-type BHNG3.1 (Egener et al., 1999
), transcriptional activation of the nifH::gusA fusion under conditions for N2 fixation was not observed in BHLAONG (745±69 or 20±9 Miller units, respectively), implying that the nifLA operon encodes the transcriptional activator of nifHDK genes in Azoarcus sp. BH72. To obtain a NifA- phenotype, the double mutant BHLAO was complemented with a 2 kb HindIII/BsrI fragment of pTEA24 carrying only nifL including upstream regions (plasmid pLAFRL). This strain BHLAO(pLAFRL) was not capable of N2 fixation (data not shown), similar to mutant BHLAO, indicating that NifA and not NifL was essential for diazotrophy as a transcriptional activator. These results also confirmed that nifLA are cotranscribed in strain BH72.
|
|
-Proteobacteria (He et al., 1998
Concluding remarks
Our results have demonstrated that with respect to the function of NifA in signal transduction, Azoarcus sp. strain BH72 is more similar to diazotrophs of the
-subgroup than to the closer relative H. seropedicae, both genera being members of the ß-subgroup. As in bacteria of the
-subgroup, in H. seropedicae NifA activity is self-modulated: NifA ativity is sensitive to combined nitrogen and O2 (Souza et al., 1999
). In contrast, in Azoarcus sp. BH72 NifA by itself was not able to modulate nifH transcription in response to ammonium or O2 when nifL was inactivated. This suggests that O2 signalling or sensing occurs through the NifL protein as described for diazotrophs of the
-subgroup (Dixon, 1998
), reflecting the phylogenetic relationship of the ß- and
-subgroups according to 16S rDNA analysis. Interestingly, in H. seropedicae also the iron protein of nitrogenase is located in a clade of
-proteobacterial proteins according to phylogenetic analysis, leading to the speculation that the structural nif genes in H. seropedicae might have been gained by lateral gene transfer (Hurek et al., 1997a
). The similarities of details of transcriptional regulation of nif genes to
-subgroup diazotrophs support the view that the entire N2-fixing apparatus in this bacterium might have been gained by lateral gene transfer.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arcondéguy, T., Jack, R. & Merrick, M. (2001). PII signal transduction proteins, pivotal players in microbial nitrogen control. Microbiol Mol Biol Rev 65, 80-105.
Arsène, F., Kaminski, P. A. & Elmerich, C. (1996). Modulation of NifA activity by PII in Azospirillum brasilense: evidence for a regulatory role of the NifA N-terminal domain. J Bacteriol 178, 4830-4838.
Arsène, F., Kaminski, P. A. & Elmerich, C. (1999). Control of Azospirillum brasilense NifA activity by PII: effect of replacing Tyr residues of the NifA N-terminal domain on NifA activity. FEMS Microbiol Lett 179, 339-343.[Medline]
Austin, S., Buck, M., Cannon, W., Eydmann, T. & Dixon, R. (1994). Purification and in vitro activities of the native nitrogen fixation control proteins NifA and NifL. J Bacteriol 176, 3460-3465.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (editors) (1987). Current Protocols in Molecular Biology. New York: Wiley.
Blanco, G., Drummond, M., Woodley, P. & Kennedy, C. (1993). Sequence and molecular analysis of the nifL gene of Azotobacter vinelandii. Mol Microbiol 9, 869-879.[Medline]
Dixon, R. (1998). The oxygen-responsive NifLNifA complex: a novel two-component regulatory system controlling nitrogenase synthesis in
-Proteobacteria. Arch Microbiol 169, 371-380.[Medline]
Dixon, R. A., Henderson, N. C. & Austin, S. (1988). DNA supercoiling and aerobic regulation of transcription from the Klebsiella pneumoniae nifLA promoter. Nucleic Acids Res 16, 9933-9946.
Drummond, M., Clements, J., Merrick, M. & Dixon, R. (1983). Positive control and autogenous regulation of the nifLA promoter in Klebsiella pneumoniae. Nature 301, 302-307.[Medline]
Egener, T., Hurek, T. & Reinhold-Hurek, B. (1999). Endophytic expression of nif genes of Azoarcus sp. strain BH72 in rice roots. Mol PlantMicrobe Interact 12, 813-819.
Egener, T., Martin, D. E., Sarkar, A. & Reinhold-Hurek, B. (2001). Role of a ferrodoxin gene cotranscribed with the nifHDK operon in N2 fixation and nitrogenase switch off of Azoarcus sp. strain BH72. J Bacteriol 183, 3752-3760.
Fischer, H. M., Bruderer, T. & Hennecke, H. (1988). Essential and non-essential domains in the Bradyrhizobium japonicum NifA protein: identification of indispensable cysteine residues potentially involved in redox reactivity and/or metal binding. Nucleic Acids Res 16, 2207-2224.
Govantes, F., Molina-Lopez, J. A. & Santero, E. (1996). Mechanism of coordinated synthesis of the antagonistic regulatory proteins NifL and NifA of Klebsiella pneumoniae. J Bacteriol 178, 6817-6823.
Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557-580.[Medline]
He, L., Soupene, E., Ninfa, A. & Kustu, S. (1998). Physiological role for the GlnK protein of enteric bacteria: relief of NifL inhibition under nitrogen-limiting conditions. J Bacteriol 180, 6661-6667.
Hill, S., Austin, S., Eydmann, T., Jones, T. & Dixon, R. (1996). Azotobacter vinelandii NifL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation genes via a redox-sensitive switch. Proc Natl Acad Sci USA 93, 2143-2148.
Hu, B., Zhu, J., Shen, S. C. & Yu, G. Q. (2000). A promoter region binding protein and DNA gyrase regulate anaerobic transcription of nifLA in Enterobacter cloacae. J Bacteriol 182, 3920-3923.
Hurek, T., Reinhold, B., Fendrik, I. & Niemann, E. G. (1987). Root-zone-specific oxygen tolerance of Azospirillum spp. and diazotrophic rods closely associated with Kallar grass. Appl Environ Microbiol 53, 163-169.
Hurek, T., Burggraf, S., Woese, C. R. & Reinhold-Hurek, B. (1993). 16S rRNA-targeted polymerase chain reaction and oligonucleotide hybridization to screen for Azoarcus spp., grass-associated diazotrophs. Appl Environ Microbiol 59, 3816-3824.
Hurek, T., Reinhold-Hurek, B., Turner, G. L. & Bergersen, F. J. (1994a). Augmented rates of respiration and efficient nitrogen fixation at nanomolar concentrations of dissolved O2 in hyperinduced Azoarcus sp. strain BH72. J Bacteriol 176, 4726-4733.
Hurek, T., Reinhold-Hurek, B., Van Montagu, M. & Kellenberger, E. (1994b). Root colonization and systemic spreading of Azoarcus sp. strain BH72 in grasses. J Bacteriol 176, 1913-1923.
Hurek, T., Van Montagu, M., Kellenberger, E. & Reinhold-Hurek, B. (1995). Induction of complex intracytoplasmic membranes related to nitrogen fixation in Azoarcus sp. BH72. Mol Microbiol 18, 225-236.[Medline]
Hurek, T., Wagner, B. & Reinhold-Hurek, B. (1997a). Identification of N2-fixing plant- and fungus-associated Azoarcus species by PCR-based genomic fingerprints. Appl Environ Microbiol 63, 4331-4339.[Abstract]
Hurek, T., Egener, T. & Reinhold-Hurek, B. (1997b). Divergence in nitrogenases of Azoarcus spp., Proteobacteria of the ß-subclass. J Bacteriol 179, 4172-4178.
Jack, R., De Zamaroczy, M. & Merrick, M. (1999). The signal transduction protein GlnK is required for NifL-dependent nitrogen control of nif gene expression in Klebsiella pneumoniae. J Bacteriol 181, 1156-1162.
Jefferson, R. A., Burgess, S. M. & Hirsh, D. (1986). ß-Glucuronidase from Escherichia coli as a gene-fusion marker. Proc Natl Acad Sci USA 83, 8447-8451.
Karg, T. & Reinhold-Hurek, B. (1996). Global changes in protein composition of N2-fixing Azoarcus sp. strain BH72 upon diazosome formation. J Bacteriol 178, 5748-5754.
Liang, Y. Y., Kaminski, P. A. & Elmerich, C. (1991). Identification of a nifA-like regulatory gene of Azospirillum brasilense Sp7 expressed under conditions of nitrogen fixation and in the presence of air and ammonia. Mol Microbiol 5, 2735-2744.[Medline]
Little, R., Reyes-Ramirez, F., Zhang, Y., van Heeswijk, W. C. & Dixon, R. (2000). Signal transduction to the Azotobacter vinelandii NifLNifA regulatory system is influenced directly by interaction with 2-oxoglutarate and the PII regulatory protein. EMBO J 19, 6041-6050.[Medline]
Martin, D., Hurek, T. & Reinhold-Hurek, B. (2000). Occurrence of three PII-like signal transmitter proteins in the diazotroph Azoarcus sp. BH72. Mol Microbiol 38, 276-288.[Medline]
Merrick, M. (1992). Regulation of nitrogen fixation genes in free-living and symbiotic bacteria. In Biological Nitrogen Fixation , pp. 835-876. Edited by G. Stacey, R. Burris & H. Evans. New York:Chapman & Hall.
Minchin, S. D., Austin, S. & Dixon, R. A. (1988). The role of activator binding sites in transcriptional control of the divergently transcribed nifF and nifLA promoters from Klebsiella pneumoniae. Mol Microbiol 2, 433-442.[Medline]
Newton, J. W., Wilson, P. W. & Burris, R. H. (1953). Direct demonstration of ammonia as an intermediate in nitrogen fixation by Azotobacter. J Biol Chem 204, 445-451.
Ninfa, A. J. & Atkinson, M. R. (2000). PII signal transduction proteins. Trends Microbiol 8, 172-189.[Medline]
Page, W. J. & Sadoff, H. L. (1976). Physiological factors affecting transformation of Azotobacter vinelandii. J Bacteriol 125, 1080-1087.
Parkinson, J. S. & Kofoid, E. C. (1992). Communication modules in bacterial signaling modules. Annu Rev Genet 26, 71-112.[Medline]
Prentki, P. & Krisch, H. M. (1984). In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29, 303-314.[Medline]
Reinhold, B., Hurek, T. & Fendrik, I. (1985). Strain-specific chemotaxis of Azospirillum spp. J Bacteriol 162, 190-195.
Reinhold, B., Hurek, T., Niemann, E.-G. & Fendrik, I. (1986). Close association of Azospirillum and diazotrophic rods with different root zones of Kallar grass. Appl Environ Microbiol 52, 520-526.
Reinhold-Hurek, B., Hurek, T., Claeyssens, M. & Van, M. M. (1993a). Cloning, expression in Escherichia coli, and characterization of cellulolytic enzymes of Azoarcus sp., a root-invading diazotroph. J Bacteriol 175, 7056-7065.
Reinhold-Hurek, B., Hurek, T., Gillis, M., Hoste, B., Vancanneyt, M., Kersters, K. & De Ley, J. (1993b). Azoarcus gen. nov., nitrogen-fixing proteobacteria associated with roots of Kallar grass (Leptochloa fusca (L.) Kunth.) and description of two species Azoarcus indigens sp. nov. and Azoarcus communis sp. nov. Int J Syst Bacteriol 43, 574-584.
Schultz, J., Milpetz, F., Bork, P. & Ponting, C. P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci USA 95, 5857-5864.
Shah, V. K., Davis, I. C., Gordon, J. K., Orme-Johnson, W. H. & Brill, W. J. (1973). Nitrogenaseless mutants of Azotobacter vinelandii: activities, cross-reactions and EPR spectra. Biochim Biophys Acta 292, 246-255.[Medline]
Siddavattam, D., Steibl, H.-D., Kreutzer, R. & Klingmüller, W. (1995). Regulation of nif gene expression in Enterobacter agglomerans: nucleotide sequence of the nifLA operon and influence of temperature and ammonium on its transcription. Mol Gen Genet 249, 629-636.[Medline]
Sonnhammer, E. L., Eddy, S. R. & Durbin, R. (1997). Pfam: a comprehensive database of protein domain families based on seed alignments. Proteins 28, 405-420.[Medline]
Souza, E. M., Funayama, S., Rigo, L. U., Yates, M. G. & Pedrosa, F. O. (1991). Sequence and structural organization of a nifA-like gene and part of a nifB-like gene of Herbaspirillum seropedicae strain Z78. J Gen Microbiol 137, 1511-1522.
Souza, E. M., Pedrosa, F. O., Drummond, M., Rigo, L. U. & Yates, M. G. (1999). Control of Herbaspirillum seropedicae NifA activity by ammonium ions and oxygen. J Bacteriol 181, 681-684.
Souza, E. M., Pedrosa, F. O., Rigo, L. U., Machado, H. B. & Yates, M. G. (2000). Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element. Microbiology 146, 1407-1418.
Staskawicz, B., Dahlbeck, D., Keen, N. & Napoli, C. (1987). Molecular characterisation of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J Bacteriol 169, 5789-5794.
Woodley, P. & Drummond, M. (1994). Redundancy of the conserved His residue in Azotobacter vinelandii NifL, a histidine autokinase homologue which regulates transcription of nitrogen fixation genes. Mol Microbiol 13, 619-626.[Medline]
Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.[Medline]
Zhulin, I. B., Taylor, B. L. & Dixon, R. (1997). PAS domain S-boxes in archaea, bacteria and sensors for oxygen and redox. Trends Biochem Sci 22, 331-333.[Medline]
Received 3 January 2002;
revised 14 June 2002;
accepted 20 June 2002.
This article has been cited by other articles:
![]() |
X. Zou, Y. Zhu, E. L. Pohlmann, J. Li, Y. Zhang, and G. P. Roberts Identification and functional characterization of NifA variants that are independent of GlnB activation in the photosynthetic bacterium Rhodospirillum rubrum Microbiology, September 1, 2008; 154(9): 2689 - 2699. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Thummer, O. Klimmek, and R. A. Schmitz Biochemical Studies of Klebsiella pneumoniae NifL Reduction Using Reconstituted Partial Anaerobic Respiratory Chains of Wolinella succinogenes J. Biol. Chem., April 27, 2007; 282(17): 12517 - 12526. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xie, Y. Dou, S. Ping, M. Chen, G. Wang, C. Elmerich, and M. Lin Interaction between NifL and NifA in the nitrogen-fixing Pseudomonas stutzeri A1501 Microbiology, December 1, 2006; 152(12): 3535 - 3542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Raymond, J. L. Siefert, C. R. Staples, and R. E. Blankenship The Natural History of Nitrogen Fixation Mol. Biol. Evol., March 1, 2004; 21(3): 541 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Martinez-Argudo, R. Little, N. Shearer, P. Johnson, and R. Dixon The NifL-NifA System: a Multidomain Transcriptional Regulatory Complex That Integrates Environmental Signals J. Bacteriol., February 1, 2004; 186(3): 601 - 610. [Full Text] [PDF] |
||||
![]() |
N. Desnoues, M. Lin, X. Guo, L. Ma, R. Carreno-Lopez, and C. Elmerich Nitrogen fixation genetics and regulation in a Pseudomonas stutzeri strain associated with rice Microbiology, August 1, 2003; 149(8): 2251 - 2262. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |