|
|
||||||||
Research Paper |
Division of Mycobacterial Research, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK1
Author for correspondence: Elaine O. Davis. Tel: +44 20 8959 3666. Fax: +44 20 8913 8528. e-mail: edavis{at}nimr.mrc.ac.uk
| ABSTRACT |
|---|
|
|
|---|
Keywords: LexA, SOS box, mycobacteria
Abbreviations: RACE, rapid amplification of cDNA ends
a Present address: The University of British Columbia, The Research Centre, Faculty of Medicine, Dept of Paediatrics, 950 West 28th Avenue, Vancouver, BC, Canada V5Z 4H4.
| INTRODUCTION |
|---|
|
|
|---|
The basic principles of this regulatory mechanism are found in many other species of bacteria, although the DNA sequence of the LexA-binding site, or SOS box, varies. For example, in Bacillus subtilis the sequence CGAACRNRYGTTCG (Winterling et al., 1998
) is recognized by the LexA homologue known as DinR. A related motif is used in mycobacteria; originally the motif GAACnnnnGTTC was shown to bind Mycobacterium tuberculosis LexA (Durbach et al., 1997
; Movahedzadeh et al., 1997
), whilst a more recent analysis of the requirements for LexA binding in vivo have revealed that the mycobacterial SOS box has the consensus sequence TCGAACnnnnGTTCGA (Davis et al., 2002
).
The SOS box is generally positioned close to, and often overlaps, the promoter of the gene regulated by LexA binding to it. In E. coli there are examples of genes whose SOS boxes overlap the -35 sequence, are between the -35 and -10 sequences, overlap the -10 sequence or are downstream of the -10 sequence (Schnarr et al., 1991
). Many genes have a single SOS box that is sufficient to confer regulation, and there are even some instances of divergently oriented genes each being regulated by a common SOS box (Courcelle et al., 2001
). However, there are also a few examples of genes which possess two or even three SOS boxes. In E. coli the lexA gene has two SOS boxes separated by just 5 bp, one overlapping the -10 sequence and the other lying just downstream of the transcription start site (Brent & Ptashne, 1981
; Little et al., 1981
). The recN gene of E. coli has three SOS boxes, one overlapping the -35 sequence, a second overlapping the -10 sequence and a third downstream of the transcription start site (Rostas et al., 1987
).
In B. subtilis two motifs with homology to the then defined bacillus SOS box were initially identified upstream of recA, but a functional analysis of these sites revealed that only one of these is actually required for regulation of recA expression (Cheo et al., 1993
). Similarly, there are three sites which bind the LexA homologue DinR upstream of dinR in B. subtilis (Haijema et al., 1996
; Winterling et al., 1998
), one of which overlaps the -35 sequence whilst the other two lie further upstream. However, just the site nearest to the gene is sufficient to confer DNA damage induction by the same factor as seen when all three are present (Haijema et al., 1996
). There are also two SOS boxes upstream of dinC in B. subtilis, one being between the -10 and -35 sequences whilst the other lies a few bases upstream of the -35 site. Although both of these sites bind DinR in vitro (Lovett et al., 1993
; Miller et al., 1996
; Winterling et al., 1998
), their requirement for induction in vivo has not been reported.
Examination of the DNA sequence upstream of the M. tuberculosis lexA gene revealed several motifs with similarity to the mycobacterial SOS box. Here we investigate the roles they each play in regulating expression of lexA and of a divergent ORF, Rv2719c, using transcriptional fusions to a lacZ reporter gene.
| METHODS |
|---|
|
|
|---|
was used for general cloning, whilst E. coli XL1Blue was used for site-directed mutagenesis (Sambrook et al., 1989
Recombinant DNA techniques.
Plasmid DNA was prepared using SNAP miniprep kits (Invitrogen) according to the manufacturers instructions. Site-directed mutagenesis was performed as described in the instructions for the QuickChange Site-Directed Mutagenesis Kit (Stratagene). For other DNA manipulations, standard DNA protocols were followed (Sambrook et al., 1989
). For each clone or mutant made, the sequences of the promoter region and the junctions to the vector were determined on an ABI PRISM 377 DNA sequencer using the ABI PRISM dRhodamine dye terminator cycle sequencing kit (PE Applied Biosystems).
Plasmid construction.
A 587 bp PCR fragment containing the entire intergenic sequence upstream of lexA and extending into the coding sequence of a divergent ORF (Rv2719c) as well as that of lexA itself was generated using the primers GCTCTAGACGGCGCCAGCGAGGTCCATC and GCAAGCTTCGGGGGCGGTTCGGGTCAC. The bases in bold indicate restriction sites for XbaI and HindIII, respectively, which were added to facilitate cloning. Following its digestion with these restriction enzymes, the PCR product was cloned into the mycobacterial promoter-probe vector pEJ414 (Papavinasasundaram et al., 2001
) to form a transcriptional fusion of the lexA promoter with the lacZ reporter gene (pEMD8). Subsequently, a 315 bp PCR fragment was amplified using the primers CGAAGCTTATTGAGCGGATCGGGGGTAT and CGTCTAGAGAGGTGTCGTTGCTGTCGTTCA and similarly cloned into pEJ414 to form a transcriptional fusion of the Rv2719c promoter with the lacZ reporter gene (pEJ544). This fragment included the entire intergenic sequence between the lexA and Rv2719c genes as well as extending into the coding sequence of Rv2719c, but only overlapped the lexA mRNA rather than its coding sequence.
Introduction of clones into mycobacteria, and verification of insertion by PCR and sequencing.
Published protocols were followed for preparing electrocompetent cells of M. smegmatis or M. tuberculosis (Papavinasasundaram et al., 1998
) and for electroporation (Jacobs et al., 1991
). After streaking out the resulting transformants, a preparation of total DNA suitable for PCR was isolated using InstaGene matrix (Bio-Rad) according to the manufacturers instructions, except that we used more bacteria. The insert and junctions of each clone were isolated as a PCR product as described previously (Davis et al., 2002
) and sequenced on an ABI PRISM 377 DNA sequencer using the ABI PRISM dRhodamine dye terminator cycle sequencing kit.
Induction conditions.
To induce DNA damage in M. smegmatis transformants, mitomycin C was added to one aliquot of a culture at an OD600 value of between 0·5 and 0·6 to a final concentration of 0·2 µg ml-1; the culture was then incubated for 5 h. An equal volume of the same culture was also incubated for the same period of time without any addition, to provide an uninduced control. For M. tuberculosis, a similar procedure was followed except that cultures were induced at an OD600 value of between 0·4 and 0·5, and induction was for 24 h. Following incubation in the presence or absence of the inducer, the bacteria were harvested, washed three times in Z buffer (Miller, 1972
) without ß-mercaptoethanol (Z*) and stored as a pellet at -20 °C.
Preparation of cell-free extracts and ß-galactosidase assays.
Cell lysates were prepared, and protein and ß-galactosidase assays were performed as described previously (Davis et al., 2002
). In the case of M. tuberculosis lysates, the supernatants were filtered through a low-binding Durapore 0·22 µM membrane filter (Ultrafree-MC; Millipore) to eliminate any residual intact bacteria prior to assay. The specific activity, in units (mg protein)-1, was calculated using the formula defined by Miller (1972)
.
Gel-shift assays.
Gel-shift assays to analyse LexA binding to individual SOS boxes were performed as described previously (Brooks et al., 2001
). The sequence of the oligonucleotide containing Box 3 was gtagTCactCatgtGTTCGAtatc, in which the bases matching the consensus SOS box sequence are shown in upper case. The complementary oligonucleotide was annealed with the aforementioned sequence and the resulting double-stranded probe was used in the assay. Binding to Box 3 was assayed alongside the other SOS boxes, which acted as controls.
Rapid amplification of cDNA ends (RACE) analysis.
This procedure was carried out using a FirstChoice RLM-RACE kit (Ambion) according to the manufacturers instructions but omitting the steps prior to ligation of the RACE adapter, which only apply to eukaryotic RNA. For RNA isolated from M. tuberculosis, two primers specific for Rv2719c were used for the nested PCR an outer primer, RaceRv2719c (GACATCCCGACCCCGGTGCGGTGGTAGC), and an inner primer, XbaRv2719c (GGTCTAGAATTGAGCGGATCGGGGGTATGC), which included an XbaI site for cloning (shown in bold). For RNA isolated from M. smegmatis containing pEJ544 only the inner primer could be used, as the outer primer bound outside of the fragment cloned in pEJ544, so a semi-nested PCR was performed using XbaRv2719c and the two supplied primers that were complementary to the adapter. The cycle conditions for PCR were 94 °C for 2 min, followed by 35 cycles at 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, with a final step at 72 °C for 7 min. The final PCR product was cloned into pBlusecriptKS- following its digestion with BamHI and XbaI, and individual transformants were sequenced.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
The roles of each of the four SOS boxes in regulating lexA expression
The roles of each of the four SOS boxes in regulating lexA expression were investigated by a mutagenic approach using a fusion of the lexA promoter, which included the upstream region containing all of the SOS boxes, to the reporter gene lacZ in an integrating plasmid (pEMD8). Mutations were made which eliminated LexA binding to each SOS box individually, by changing the core of the sequence to TCCAnnnnTGGA. Box 2 was included in this analysis, even though it had failed to bind LexA in the gel-shift assay, to investigate whether it played a role when in the presence of the other SOS boxes.
The wild-type and mutated constructs were introduced into M. smegmatis mc2155 and expression of the lacZ reporter gene was assessed following growth of the strains in both the absence and presence of the DNA-damaging agent mitomycin C (0·2 µg ml-1). As expected, the wild-type sequence containing the lexA promoter and all four SOS boxes conferred DNA-damage-inducible expression, with an induction ratio of 5·4 (Fig. 2a
). Interestingly, when Box 1 alone was eliminated expression was no longer DNA-damage-inducible, with the induction ratio falling to 0·5 (Fig. 2a
). Normally when a repressor protein is prevented from binding to its regulatory site the result is constitutive expression at around the level seen for the induced wild-type. However, the level of expression seen for this Box 1 mutation was substantially lower than the induced wild-type level; this is presumably because the mutation introduced also has an effect on promoter activity.
|
To confirm that this was also the case in M. tuberculosis itself, the constructs containing the wild-type sequence, the Box 1 mutation and the combined Boxes 2, 3 and 4 mutations were introduced into M. tuberculosis H37Rv and expression was assessed following growth of the recombinant strains in the absence and presence of mitomycin C. The absolute expression levels in these strains were about twofold higher than that seen in M. smegmatis, but the pattern of expression from the mutated constructs was the same. Thus, the mutation in Box 1 eliminated induction, whilst the strain carrying the combined mutations in Boxes 2, 3 and 4 showed expression equivalent to that of the wild-type (Fig. 2b
).
Could the other SOS boxes be regulating expression of a divergent gene?
Upstream from the M. tuberculosis lexA gene there is a divergent gene of unknown function termed Rv2719c (Cole et al., 1998
). All four of the SOS boxes under study here are also upstream of this gene. As Boxes 2, 3 and 4 do not appear to have a role in regulating the expression of lexA, it was conceivable that they might regulate the expression of Rv2719c instead. To investigate this possibility, we first determined whether the expression of Rv2719c was DNA-damage-inducible. A transcriptional lacZ fusion of the Rv2719c promoter and upstream region, containing all four SOS boxes, was made by cloning part of the fragment used above for the lexA reporter construct in the opposite orientation. Assays of lacZ reporter gene expression in M. smegmatis with and without treatment with the DNA-damaging agent mitomycin C (0·2 µg ml-1) revealed that the expression of this ORF was indeed DNA-damage-inducible, with an induction ratio of 4·0 (Fig. 3a
). When the corresponding constructs containing mutations which eliminated LexA binding to each SOS box were examined individually, the greatest reduction in the induction ratio, to 1·4, was seen with the Box 2 mutation, with smaller changes seen with the Box 3 or Box 4 mutations and very little effect seen with the Box 1 mutation. As no single SOS box knockout resulted in constitutive expression, we went on to examine various combinations of mutations. When any two of Boxes 2, 3 and 4 were mutated simultaneously the induction ratio was reduced to ca. 1·3, whilst the triple knockout of Boxes 2, 3 and 4 resulted in completely constitutive expression, with an uninduced level similar to that of the wild-type induced level (Fig. 3a
). Thus, Boxes 2, 3 and 4 are all involved in regulating the expression of Rv2719c.
|
It has previously been reported that some genes in M. tuberculosis are DNA-damage-inducible even though they lack binding sites for LexA (Brooks et al., 2001
), suggesting that an alternative mechanism of induction exists. Nevertheless, mutation of the SOS boxes to prevent LexA binding eliminated DNA damage induction of lexA and Rv2719c, indicating that these genes are regulated by LexA in M. tuberculosis.
The SOS boxes lie in the respective promoter regions of the genes that they regulate
The specific effects of mutating Box 1 on lexA expression and of mutating Boxes 2, 3 and 4 on Rv2719c expression could be explained by the locations of these boxes relative to the promoters for both of these genes. The transcriptional start site of lexA has been determined previously (Movahedzadeh et al., 1997
), and indicates that Box 1 overlaps or lies close to the -35 site of the lexA promoter. We would predict that the promoter elements for Rv2719c would lie around or between Boxes 2, 3 and 4. Such an arrangement would explain why Box 1 regulates expression of lexA only and Boxes 2, 3 and 4 regulate expression of Rv2719c only.
To test the hypothesis that the promoter elements for Rv2719c lie around or between Boxes 2, 3 and 4, we attempted to determine the transcriptional start site of Rv2719c. This was done by RACE using RNA extracted from M. tuberculosis and from M. smegmatis bearing the Rv2719clacZ fusion. The majority of clones analysed were consistent with the transcriptional start site being an A located 36 bp upstream of the predicted initiation codon (Fig. 1
) in M. tuberculosis itself and when the M. tuberculosis promoter was being expressed in M. smegmatis. This A is situated within Box 4, and inspection of the sequence upstream from this point revealed a motif (TACAGT) with similarity to the E. coli
70 -10 consensus sequence positioned between Box 3 and Box 4. A further motif (CGGATA) bearing some resemblance to the corresponding -35 consensus is located upstream of this, with a spacing of 17 bp from the putative -10 motif; this putative -35 motif partially overlaps Box 2. However, the possibility of transcription in M. tuberculosis starting further upstream than this was suggested by a longer product observed in two instances, which would correlate with initiation at a G 97 bp upstream of the coding sequence. This G is located upstream of all three of the SOS boxes that regulate the expression of Rv2719c. In either case, Boxes 2, 3 and 4 are appropriately positioned to regulate Rv2719c whereas Box 1 is not, in accordance with the results described above.
Analogous to our findings for M. tuberculosis, it may be that the two SOS boxes further upstream of dinR in B. subtilis are regulating a divergent ORF. Indeed, a divergent ORF termed yneA is found upstream of dinR. There are good matches to -35 and -10 motifs a similar distance upstream of yneA to those reported for dinR and the central SOS box of the three is located between these motifs, a typical position for a LexA-binding site.
Rv2719c homologues appear to be regulated similarly in other mycobacteria
No homologues of Rv2719c were found by searching the general sequence databases, but homologues of this gene were found in other mycobacterial species for which genomic sequence information is available in a readily searchable form, namely M. leprae, Mycobacterium avium and M. smegmatis (TBLASTN scores of 8x10-34, 1·6x10-39 and 1x10-31, respectively). Thus, this ORF appears to represent a mycobacterial-specific gene. Not only was a homologue present in each of these mycobacterial species but it was also located in the same relative position in the genome, i.e. upstream of lexA and in the opposite orientation to it. Significantly, there are blocks of sequence identity amongst M. tuberculosis, M. leprae, M. avium and M. smegmatis in the intergenic region between lexA and Rv2719c, and all four SOS boxes are conserved in all four species (Fig. 4
). Thus, the regulation of lexA by a single SOS box and of Rv2719c homologues by three SOS boxes is common amongst mycobacteria. It would appear that having multiple copies of the SOS box can compensate for the presence of multiple mismatches in the individual motifs.
|
In conclusion, the results of the present study suggest that some DNA-damage-inducible genes in M. tuberculosis may be regulated by LexA binding to multiple sites with two or more mismatches from the consensus sequence, rather than to a single site with up to one mismatch. This may allow a more graded response, depending on the degree of DNA damage. However, it also complicates the identification of further LexA-regulated genes by motif identification.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Brent, R. & Ptashne, M. (1981). Mechanism of action of the lexA gene product. Proc Natl Acad Sci U S A 78, 4204-4208.
Brooks, P. C., Movahedzadeh, F. & Davis, E. O. (2001). Identification of some DNA damage-inducible genes of Mycobacterium tuberculosis: apparent lack of correlation with LexA binding. J Bacteriol 183, 4459-4467.
Cheo, D. L., Bayles, K. W. & Yasbin, R. E. (1993). Elucidation of regulatory elements that control damage induction and competence induction of the Bacillus subtilis SOS system. J Bacteriol 175, 5907-5915.
Cole, S. T., Brosch, R., Parkhill, J. & 39 other authors (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537544.[Medline]
Cole, S. T., Eiglmeier, K., Parkhill, J. & 41 other authors (2001). Massive gene decay in the leprosy bacillus. Nature 409, 10071011.[Medline]
Courcelle, J., Khodursky, A., Peter, B., Brown, P. O. & Hanawalt, P. C. (2001). Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics 158, 41-64.
Davis, E. O., Dullaghan, E. M. & Rand, L. (2002). Definition of the mycobacterial SOS box and use to identify LexA-regulated genes in Mycobacterium tuberculosis. J Bacteriol 184, 3287-3295.
Durbach, S. I., Andersen, S. J. & Mizrahi, V. (1997). SOS induction in mycobacteria: analysis of the DNA-binding activity of a LexA-like repressor and its role in DNA damage induction of the recA gene from Mycobacterium smegmatis. Mol Microbiol 26, 643-653.[Medline]
Friedberg, E., Walker, G. & Siede, W. (1995). DNA Repair and Mutagenesis. Washington, DC: American Society for Microbiology.
Haijema, B. J., van Sinderen, D., Winterling, K., Kooistra, J., Venema, G. & Hamoen, L. W. (1996). Regulated expression of the dinR and recA genes during competence development and SOS induction in Bacillus subtilis. Mol Microbiol 22, 75-85.[Medline]
Jacobs, W. R.Jr, Kalpana, G. V., Cirillo, J. D., Pascopella, L., Snapper, S. B., Udani, R. A., Jones, W., Barletta, R. G. & Bloom, B. R. (1991). Genetic systems for mycobacteria. Methods Enzymol 204, 537-555.[Medline]
King, R. D., Karwath, A., Clare, A. & Dehaspe, L. (2000). Accurate prediction of protein functional class from sequence in the Mycobacterium tuberculosis and Escherichia coli genomes using data mining. Yeast 17, 283-293.[Medline]
Little, J. W. (1991). Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease. Biochimie 73, 411-421.[Medline]
Little, J. W. & Mount, D. W. (1982). The SOS regulatory system of Escherichia coli. Cell 29, 11-22.[Medline]
Little, J. W., Mount, D. W. & Yanisch-Perron, C. R. (1981). Purified lexA protein is a repressor of the recA and lexA genes. Proc Natl Acad Sci U S A 78, 4199-4203.
Lovett, C. M.Jr, Cho, K. C. & OGara, T. M. (1993). Purification of an SOS repressor from Bacillus subtilis. J Bacteriol 175, 6842-6849.
Mauel, C., Young, M., Monsutti-Grecescu, A., Marriott, S. A. & Karamata, D. (1994). Analysis of Bacillus subtilis tag gene expression using transcriptional fusions. Microbiology 140, 2279-2288.[Abstract]
Miller, J. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Miller, M. C., Resnick, J. B., Smith, B. T. & Lovett, C. M.Jr (1996). The Bacillus subtilis dinR gene codes for the analogue of Escherichia coli LexA. Purification and characterization of the DinR protein. J Biol Chem 271, 33502-33508.
Movahedzadeh, F., Colston, M. J. & Davis, E. O. (1997). Characterization of Mycobacterium tuberculosis LexA: recognition of a Cheo (Bacillus-type SOS) box. Microbiology 143, 929-936.[Abstract]
Papavinasasundaram, K. G., Colston, M. J. & Davis, E. O. (1998). Construction and complementation of a recA deletion mutant of Mycobacterium smegmatis reveals that the intein in Mycobacterium tuberculosis recA does not affect RecA function. Mol Microbiol 30, 525-534.[Medline]
Papavinasasundaram, K. G., Anderson, C., Brooks, P. C., Thomas, N. A., Movahedzadeh, F., Jenner, P. J., Colston, M. J. & Davis, E. O. (2001). Slow induction of RecA by DNA damage in Mycobacterium tuberculosis. Microbiology 147, 3271-3279.
Rostas, K., Morton, S. J., Picksley, S. M. & Lloyd, R. G. (1987). Nucleotide sequence and LexA regulation of the Escherichia coli recN gene. Nucleic Acids Res 15, 5041-5049.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sassanfar, M. & Roberts, J. W. (1990). Nature of the SOS-inducing signal in Escherichia coli. The involvement of DNA replication. J Mol Biol 212, 79-96.[Medline]
Schnarr, M., Oertel-Buchheit, P., Kazmaier, M. & Granger-Schnarr, M. (1991). DNA binding properties of the LexA repressor. Biochimie 73, 423-431.[Medline]
Snapper, S. B., Melton, R. E., Mustafa, S., Kieser, T. & Jacobs, W. R.Jr (1990). Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol Microbiol 4, 1911-1919.[Medline]
Winterling, K. W., Chafin, D., Hayes, J. J., Sun, J., Levine, A. S., Yasbin, R. E. & Woodgate, R. (1998). The Bacillus subtilis DinR binding site: redefinition of the consensus sequence. J Bacteriol 180, 2201-2211.
Received 17 May 2002;
revised 24 June 2002;
accepted 16 August 2002.
This article has been cited by other articles:
![]() |
N. Radde, J. Gebert, and C. V. Forst Systematic component selection for gene-network refinement Bioinformatics, November 1, 2006; 22(21): 2674 - 2680. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Brooks, L. F. Dawson, L. Rand, and E. O. Davis The Mycobacterium-Specific Gene Rv2719c Is DNA Damage Inducible Independently of RecA. J. Bacteriol., August 1, 2006; 188(16): 6034 - 6038. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yellaboina, J. Seshadri, M. S. Kumar, and A. Ranjan PredictRegulon: a web server for the prediction of the regulatory protein binding sites and operons in prokaryote genomes Nucleic Acids Res., July 1, 2004; 32(suppl_2): W318 - W320. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |