|
|
||||||||
Research Paper |
Institute of Dental Research, Centre for Oral Health, Westmead Hospital, PO Box 533, Wentworthville, NSW 2145, Australia1
Author for correspondence: Nicholas A. Jacques. Tel: +61 2 9845 8763. Fax: +61 2 9845 7599. e-mail: njacques{at}dental.wsahs.nsw.gov.au
| ABSTRACT |
|---|
|
|
|---|
-linked glucose residues of dextran and the 1,3-
-linked glucose residues of mutan, indicating that a protein consisting of nothing but 3·8 YG repeats could attach to either substrate. Secondary structure predictions of the primary amino acid sequence suggested that 37% of the amino acids were capable of forming a structure such that five regions of ß-sheet were separated by regions capable of forming ß-turns and random coils. CD spectral analysis showed that the purified 3·8 YG protein possessed an unordered secondary structure with some evidence of possible ß-sheet formation and that the protein maintained this relatively unordered structure on binding to dextran. Keywords: Streptococcus, protein structure, circular dichroism
Abbreviations: CD, circular dichroism; Gtf, glucosyltransferase; Gtf-I, water-insoluble glucosyltransferase; Gtf-S, water-soluble glucosyltransferase; GBD, glucan-binding domain; GST, glutathione S-transferase
a Present address: Agriculture Victoria Rutherglen, RMB 1145, Chiltern Valley Road, Rutherglen, Victoria 2685, Australia.
| INTRODUCTION |
|---|
|
|
|---|
-D-glucans (Hamada & Slade, 1980
-linked glucans, called mutans (Walker, 1978
-linked glucans containing 1,6-
-branch points and/or up to 50% 1,6-
-linked glucose residues have been described (Walker, 1978
-linked dextrans, which may or may not possess 1,3-
-branch points (Walker, 1978
The mechanism of glucan-chain-elongation is also poorly understood. Evidence exists to support models for the addition of glucose at the reducing end of the growing polymer, while other data suggest that the addition of glucose occurs at the non-reducing end (Monchois et al., 1999b
).
An example of a primer-dependent Gtf-I-type enzyme is the GtfJ secreted by Streptococcus salivarius. This enzyme synthesizes chains of 1,3-
-linked glucosyl residues onto a 1,6-
-linked dextran primer. The resulting mixed linkage mutan is insoluble and co-precipitates with its enzyme in vitro, thus inactivating the enzyme (Simpson et al., 1995a
). Consistent with the predicted primary structures of all other streptococcal Gtfs, GtfJ possesses four domains: a signal sequence of 35 aa, a 144 aa variable domain, an 861 aa catalytic domain containing key catalytic amino acids, and a 478 aa C-terminal glucan-binding domain (GBD) (Giffard et al., 1991
; Monchois et al., 1999b
). As their name implies, the GBDs of Gtfs are able to bind to glucans of the dextran variety (Ferretti et al., 1987
; Mooser & Wong, 1988
; Kobayashi et al., 1989
; Abo et al., 1991
). This has led to the assumption that where Gtfs adhere to mutan, binding occurs by way of the 1,6-
-linked glucosyl residues present within the predominantly 1,3-
-linked mutan (Haas & Banas, 2000
). The recent observation that the glucan-binding protein GbpA does not bind to pseudonigeran, a polymer containing only 1,3-
-linked glucosyl residues, has been taken as evidence to support this conclusion (Haas & Banas, 2000
).
The sequence identity and conservation across the C-terminal GBD regions of various Gtfs have been shown to vary considerably by multiple sequence alignment algorithms, even when gaps have been inserted within individual amino acid sequences. The C termini of these proteins, however, contain a number of amino acid repeat sequences, variously named A, B, C and D, that possess intra-repeat homology ranging from 40 to 100% (Ferretti et al., 1987
; Shiroza et al., 1987
; Giffard et al., 1991
; Giffard & Jacques, 1994
). While different Gtfs possess different combinations of these repeats (Monchois et al., 1999b
), all GBDs have been shown to contain a characteristic pattern of amino acids that is also found in the GbpA protein of Streptococcus mutans (Haas et al., 1998
; Haas & Banas, 2000
), the dextranase inhibitor from Streptococcus sobrinus (Sun et al., 1994
) and the repeat regions of virulence proteins from other Gram-positive bacteria (Wren, 1991
; Wren et al., 1991
; von Eichel-Streiber et al., 1992
; Haas & Banas, 2000
). This pattern of amino acids, i.e. the 21 aa YG repeat, transcends and extends beyond the N-terminal boundaries of all other repeat sequences found in the GBDs of the Gtfs (Giffard & Jacques, 1994
). These YG repeats appear to have arisen as a consequence of a series of duplications and rearrangements that may be part of an ongoing process (Giffard & Jacques, 1994
; Simpson et al., 1995b
). The role of various lengths of YG motif in glucan binding by Gtfs has not been evaluated, whereas the need for specific numbers of higher order A, B and C repeats within the GBDs of Gtfs for both binding to glucans and for catalytic activity has been assessed (Ferretti et al., 1987
; Kato & Kuramitsu, 1990
; Abo et al., 1991
; Lis et al., 1995
; Vickerman et al., 1996
; Monchois et al., 1998
). In this study we confirm the generally accepted role of the GBD in the catalysis of Gtfs by examining its function in the GtfJ of S. salivarius, while also further examining the ability of purified stretches of contiguous YG repeats to bind to dextran and to mutan.
| METHODS |
|---|
|
|
|---|
Detection of Gtf activity.
Hydrolysis of sucrose by GtfJ, or one of its mutated forms, was detected using a qualitative microtitre reducing sugar test for liberated fructose (Giffard et al., 1991
). Polymerizing activity was quantified with [U-14C]glucosyl-labelled sucrose (Jacques, 1983
), for which one unit of glucan-forming activity (U) was defined as the amount of Gtf or its mutated form that catalysed the incorporation of 1 µmol of the glucose moiety of sucrose into water-insoluble polysaccharide min-1. The specific activity in U (mg dry wt E. coli host)-1 was used throughout the study.
Phagemids, plasmids, bacteriophage and bacterial strains.
Table 1
lists the various E. coli strains and vectors used in this study. E. coli cells harbouring appropriate vectors were grown with shaking (150 r.p.m.) at 37 °C in conical flasks containing LuriaBertani medium (Miller, 1972
) supplemented with antibiotics where appropriate.
|
|
1·000 and harvested by centrifugation (10000 g, 10 min, 4 °C). The cell pellet was washed in 20 mM potassium phosphate buffer (pH 6·0) containing 1 mM PMSF before being resuspended in the same buffer to a final volume of 5 ml. The cells were immediately disrupted by sonication at 4 °C (Branson Sonicator; 4x50 W for 30 s with 30 s cooling periods). Following centrifugation (25000 g, 30 min, 4 °C), the supernatant was used to assay enzyme activity.
Expression of contiguous YG repeats.
A DraI restriction site, 3843 bp into the ORF of the gtfJ gene, occurs at the beginning of the coding region for the eighth YG repeat of the GBD of GtfJ (Giffard et al., 1991
). Three proteins containing 3·8 YG repeats (Lys-1282 to Phe-1364), 7·2 YG repeats (Glu-1363 to Asn-1518) or 11·0 YG repeats (Lys-1282 to Asn-1518) of molecular masses 9215, 17030 and 26000 Da, respectively, (Fig. 2
) were expressed as GST fusion proteins using the GST Gene Fusion System. The first of these constructs was made by cloning the DraIEcoRI 244 bp fragment of the gtfJ gene into SmaIEcoRI-restricted pGEX-3X to form pGSG108 (Table 1
). To construct the other two fusion proteins, DNA was first obtained by PCR amplification of pGSG101 from the EcoRI site to the end of the gtfJ gene using the forward primer TGACTAACGAATTCTTCACAACT, homologous to the DNA sequence from 4079 to 4101 bp within the coding region of the gtfJ gene, and the reverse primer CACATTAATAATAGATTAGAATTCTGTCATAAA, complementary to the DNA sequence 5890 bp downstream of the stop codon of the ORF of the gtfJ gene except for the two altered nucleotides shown in bold italic (Giffard et al., 1991
). The primers were designed so that the resulting PCR products could be restricted at both ends with EcoRI (italic). pGSG109 (Table 1
) expressing the GST::7·2 YG protein was obtained by cloning this EcoRI-restricted PCR product into EcoRI-restricted pGEX-5X-1 and determining the correct orientation of the insert by sequencing across the EcoRI site. In a similar manner, pGSG110 encoding the GST::11·0 YG protein was obtained by cloning the EcoRI-restricted PCR product into EcoRI-restricted pGSG108, which already contained the DraIEcoRI 244 bp fragment of the gtfJ gene (Table 1
).
|
Formation of mutan.
Given sufficient time, primer-dependent Gtf-I-type enzymes produce an insoluble 1,3-
-linked mutan at high sucrose concentrations in the absence of primer (Hare et al., 1978
; Walker, 1978
). A water-insoluble glucan was therefore synthesized by incubating GtfJ with 5% (w/v) sucrose for 5 d in the absence of dextran T-10 primer (Simpson et al., 1995a
). 13C-NMR analysis of the water-insoluble glucan formed under these conditions confirmed that it was a mutan possessing >99·9% 1,3-
-linked glucosyl residues.
Detection of glucan binding.
The binding of GtfJ, mutated enzymes and variously expressed contiguous YG repeats to dextran or mutan were assessed by their ability to attach either to a Sepharose/dextran T-10 matrix prepared as described by Mooser & Wong (1988)
, or to the mutan synthesized by GtfJ in the absence of dextran primer. 13C-NMR analysis showed that dextran T-10 possessed
95% 1,6-
-linked glucosyl residues (Simpson et al., 1995a
), whereas the mutan possessed >99·9% 1,3-
-linked glucosyl residues (see above). To determine the degree of binding, 400 ng of the appropriate protein or 100 µl E. coli lysate was incubated for 30 min at 37 °C, with occasional mixing with 500 µg mutan or 30 µg Sepharose/dextran T-10 in 100 µl 20 mM potassium phosphate buffer (pH 6·5). If dextran inhibition of protein binding to mutan was to be determined, 10 µg dextran T-10 was also added to the mutan slurry. Following incubation, the mixture was centrifuged (13000 g, 5 min, 20 °C) and the supernatant removed. The pellet was washed six times by resuspending with vigorous vortexing for 30 s in 200 µl 10 mM potassium phosphate buffer (pH 6·5) and recentrifuging (13000 g, 5 min, 20 °C) before subjecting the slurry to SDS-PAGE. Studies involving whole-enzyme-binding utilized 15% Tris/glycine gels (Russell, 1978
), whereas those investigating YG binding motifs used 16% Tris/tricine gels (Schägger & von Jagow, 1987
; Lesse et al., 1990
). After electrophoresis, any proteins that had remained bound to the glucan polymers were detected with Coomassie blue staining. The various proteins did not bind to Sepharose alone, while GtfJ and the mutated enzymes were concentrated out of the E. coli lysate by binding to mutan, leaving <5% contaminating E. coli proteins after the subsequent washes (as determined by SDS-PAGE analysis).
Circular dichroism (CD) spectra.
For CD spectral analysis, the 3·8 YG protein obtained from the glutathione/Sepharose 4B column was extensively dialysed against 18 M
H2O to remove any contaminating ions, and further purified by HPLC (LKB Bromma 2248) using a Vydac C18 reverse-phase HPLC column. The protein was eluted from the column using a 585% CH3CN gradient and extensively dialysed against 18 M
H2O. Mass spectral analysis of purified protein samples was undertaken by the Australian Government Analytical Laboratories. CD spectra were subsequently accumulated at 22 °C in 18 M
H2O within the range of 250 nm to 190 nm at 1·0 nm decrements, with a scan speed of 20 nm min-1 and a 1 nm bandwidth using a JASCO J-710/720 Spectropolarimeter with a 1 mm light path. Five scans were averaged to improve the signal to noise ratio. To determine any conformational change following binding of the 3·8 YG protein to dextran, dextran T-10 was added to give a final concentration of 100 µM. A baseline was taken with 18 M
H2O, or 18 M
H2O containing dextran, under the same conditions used for the sample and subtracted from each protein spectrum.
Secondary structure prediction of YG repeats.
The method of Garnier was used to predict the secondary structure of the primary amino acid sequence of contiguous YG repeats (Pearson & Lipman, 1988
). The program is considered to have a 75% prediction accuracy and was accessed through Entigen (http://www.bionavigator.com).
| RESULTS |
|---|
|
|
|---|
-linked glucans). Consequently, the binding of GtfJ to Sepharose/dextran T-10 was not unexpected (Table 2
). GtfJ also bound to insoluble mutan containing >99·9% 1,3-
-linked glucose residues, indicating that it was not simply 1,6-
-linked glucosyl residues to which this primer-dependent enzyme adhered (Table 2
).
|
).
These observations implied that the position at which truncation within the C-terminal GBD prevented further glucan synthesis could be confined to a region of 43 aa. However, both mutated proteins, C1J and C2J, retained the ability to attach to Sepharose/dextran T-10 and mutan (Table 2
), indicating that the removal of up to ten of the 18 C-terminal GBD YG repeats was insufficient to prevent attachment to either glucan. This observation did not preclude the possibility that the mutated Gtfs were so altered in their binding to dextran that this influenced the acceptor/activation function of the proteins (Monchois et al., 1999a
, b
).
The role of YG repeats of the GBD in the binding of GtfJ to dextran and mutan
The 18 YG repeats within the GBD of GtfJ possess the consensus sequence IGGXXYYFGANGXQ(A,V)(T,K)GXXVI, suggesting that it is unlikely that specific YG repeats or sequences of repeats play a unique role in glucan binding. However, to determine whether different lengths of YG repeats were necessary for binding to dextran or mutan, three proteins derived from the GBD region deleted from mutated proteins C1J and C2J were constructed and expressed in E. coli. These three proteins, containing either 3·8, 7·2 or 11·0 YG repeats, were expressed by pGSG108, pGSG109 and pGSG110, respectively (Table 1
), and formed a contiguous set of proteins with molecular masses of 9215, 17030 and 26000 Da, respectively (Fig. 2
). In a series of at least three repeat experiments, each of the three proteins was observed to bind to dextran and mutan, indicating that a protein consisting of 3·8 YG repeats could attach to either substrate (Fig. 3
). All three YG proteins were partially eluted from excess insoluble mutan by a fiftieth the amount of dextran T-10 (Fig. 3
, lane 6). Higher ratios of dextran to mutan released more of each of the proteins (data not shown).
|
-helix:ß-sheet:ß-turn:random coil was 16:37:29:18, compared with that of 16:39:24:21 for the complete 478 aa GBD of GtfJ. The predicted
-helix structure of the 3·8 YG protein related to two contiguous regions of four and nine amino acids, the latter being at the C terminus of the 3·8 YG protein (Fig. 4
|
The final protocol used resulted in a low mean yield of 700 µg purified soluble 3·8 YG protein (l culture)-1 that appeared as a single band following SDS-PAGE analysis (data not shown). Mass spectral analysis, however, indicated that there were two proteins present with molecular masses of 9913 and 9332 Da. Both of these proteins differed from the predicted mass of the cleaved GST::3·8 YG protein expressed by pGSG108. The differences could be accounted for by the removal of either the initial G, or the sequence GIPGKGK from the N terminus of the expressed protein. In the latter instance only the sequence KGK formed part of the original S. salivarius 3·8 YG protein (the remaining amino acids being derived from the C terminus of the GST protein following cleavage with factor Xa). This loss of N-terminal amino acids was not considered significant since the mixture readily bound to mutan and dextran (data not shown). This anomaly was therefore ignored and the mixture of the two forms of the 3·8 YG protein was used for CD spectral analysis.
The CD spectrum of the 3·8 YG expressed proteins revealed a single positive broad band centred at 230 nm and a negative band at 200 nm, with a broad shoulder between 203 and 216 nm (Fig. 5
). The negative ellipticity in the far-UV spectrum below 220 nm was consistent with the CD spectrum theoretically predicted for, and obtained with, proteins and peptides possessing a high level of unordered secondary structure (Woody, 1974
; Venyaminov & Vassilenko, 1994
). The CD spectrum in this region differed from that obtained with the 406 aa GBD of GbpA where a positive band was observed at 202 nm, effectively confirming that the GBD of GbpA was composed of a high percentage of ß-sheets (Haas et al., 1998
). However, the broad shoulder between 203 and 216 nm was consistent with the presence of some ß-sheet structures within the 3·8 YG protein (Venyaminov & Vassilenko, 1994
). The presence of seven (8·4%) tyrosine, five (6·0%) phenylalanine and one (1·2%) tryptophan residues in the 3·8 YG protein may have obscured the secondary structure of the 3·8 YG protein (Woody, 1978
; Manning & Woody, 1989
; Fasman, 1996
). This possibility has been commented on before, since the broad positive band centred at 230 nm in the CD spectrum of the 3·8 YG expressed proteins is also apparent in the CD spectrum of the GBD of GbpA. The positive broad band centred at 230 nm is most likely due to the high percentage of aromatic amino acids, especially tyrosine, within the 3·8 YG expressed proteins (Haas et al., 1998
) rather than to the folding of the polypeptide backbone.
|
| DISCUSSION |
|---|
|
|
|---|
Given sufficient time, the primer-dependent GtfJ produces an insoluble 1,3-
-linked mutan at high sucrose concentrations in the absence of primer. As far as we are aware, the fact that the 3·8, 7·2 or 11·0 YG proteins were able to bind to this insoluble mutan represents the first report of portions of the GBD of a Gtf being able to bind to 1,3-
-linked glucosyl residues of mutan, rather than the generally held assumption that Gtfs bind to stretches of 1,6-
-linked glucosyl residues present in a mixed-linkage mutan (Haas & Banas, 2000
). The observation that YG proteins partially dissociated from mutan in the presence of a fiftieth the amount of added dextran T-10 (Fig. 3
) is consistent with a related finding that GbpA, with its 16 C-terminal YG repeats, has a greater affinity for dextran than for an insoluble mixed-linkage mutan (Haas & Banas, 2000
). In vitro, primer-dependent Gtfs, such as GtfJ, are inactivated by binding to, and precipitating out of solution with, their insoluble mutan product (Simpson et al., 1995a
). In dental plaque, it can be envisaged that soluble dextrans, synthesized by Gtf-S-type enzymes, would not only act as acceptors, but also as releasing agents for Gtf-I-type enzymes bound to mutan on the tooth surface, thus allowing a further round of mutan synthesis. This would result in insoluble and adhesive mutan polymers being formed with a high concentration of mixed 1,3-
- and 1,6-
-linkages while preventing pure 1,3-
-linked mutans from coalescing into insoluble ribbon-like structures that would be readily swallowed along with the soluble dextran products of the Gtf-S-type enzymes (Hare et al., 1978
; Walker, 1978
; Jacques, 1994
).
What is evident from our results is that arrays of contiguous YG repeats are able to bind to glucans with different three-dimensional structures, implying that a high degree of flexibility is most likely conferred by contiguous YG repeats. While it was not possible to determine the CD spectrum of the 3·8 YG protein binding to mutan containing only 1,3-
-linked glucosyl residues, due to the insolubility of the mutan, it was clear from the CD spectrum in the presence of dextran T-10 that the relatively unordered conformation was maintained on binding to dextran T-10. Binding by way of the clustered aromatic residues, tyrosine, tryptophan and phenylalanine, present in the YG repeats, would be expected to initially stabilize the proteinglucan complex, while the polar amino acids lysine, serine, threonine, asparagine and glutamine and the acidic amino acids, aspartic acid and glutamic acid, prevalent in the YG repeats, would allow the creation of hydrogen bonds with hydroxyl residues of the sugar (Quiocho, 1986
). The presence of high concentrations of glycine in the YG consensus sequence IGGXXYYFGANGXQ(A,V)(T,K)GXXVI of the GBD of GtfJ would be expected to confer flexibility to the GBD allowing it to adjust to, and bind to, different glucan structures. While secondary structure predictions confirmed this (Fig. 4
), it remains to be determined whether the 18 YG repeats present in the GBD would retain this unordered structure when associated with the larger catalytic domain in the native GtfJ protein. The flexibility of YG repeats, however, is perhaps best exemplified by the fact that contiguous YG repeats are not limited just to the GBDs of the Gtfs (Giffard & Jacques, 1994
). They are also found in other Gram-positive bacterial proteins that bind to alternative substrates. For example, the binding domain containing YG repeats in the pneumococcal surface protein A of Streptococcus pneumoniae binds to choline residues in lipoteichoic acid (Yother & Briles, 1992
), a non-sugar residue, whereas toxin A from Clostridium difficile binds to the Type 2 polysaccharide core, Galß1-4GalNAc, present in epithelial glycoproteins (Wren et al., 1991
). While the structure of this latter disaccharide is significantly different to 1,6-
- and 1,3-
-glucans, it has been shown that antibodies raised against the YG repeats of toxin A react with GbpA from S. mutans (Wren et al., 1991
). With such a requirement for flexibility it is perhaps not surprising that the CD spectrum of the 3·8 YG protein shows a high degree of unordered structure.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Dotto, G. P. & Zinder, N. D. (1984). Reduction of the minimal sequence for initiation of DNA synthesis by qualitative or quantitative changes of an initiator protein. Nature 311, 279-280.[Medline]
von Eichel-Streiber, C., Sauerborn, M. & Kuramitsu, H. K. (1992). Evidence for a modular structure of the homologous repetitive C-terminal carbohydrate-binding sites of Clostridium difficile toxins and Streptococcus mutans glucosyltransferases. J Bacteriol 174, 6707-6710.
Fasman, G. D. (1996). Circular Dichroism and the Conformational Analysis of Biomolecules. New York: Plenum.
Ferretti, J. J., Gilpin, M. L. & Russell, R. R. B. (1987). Nucleotide sequence of a glucosyltransferase gene from Streptococcus sobrinus Mfe28. J Bacteriol 169, 4271-4278.
Giffard, P. M. & Jacques, N. A. (1994). Definition of a fundamental repeating unit in streptococcal glucosyltransferase glucan-binding regions and related sequences. J Dent Res 73, 1133-1141.
Giffard, P. M., Simpson, C. L., Milward, C. P. & Jacques, N. A. (1991). Molecular characterization of a cluster of at least two glucosyltransferase genes in Streptococcus salivarius ATCC 25975. J Gen Microbiol 137, 2577-2593.
Gough, P. M. & Murray, N. L. (1983). Sequence diversity among related genes for recognition of specific targets in DNA molecules. J Mol Biol 166, 1-19.[Medline]
Haas, W. & Banas, J. A. (2000). Ligand-binding properties of the carboxyl-terminal repeat domain of Streptococcus mutans glucan-binding protein A. J Bacteriol 182, 728-733.
Haas, W., MacColl, R. & Banas, J. A. (1998). Circular dichroism analysis of the glucan binding domain of Streptococcus mutans glucan binding protein-A. Biochim Biophys Acta 1384, 112-120.[Medline]
Hamada, S. & Slade, H. D. (1980). Biology, immunology, and cariogenicity of Streptococcus mutans. Biol Rev 44, 331-384.
Hare, M. D., Svensson, S. & Walker, G. J. (1978). Characterization of the extracellular, water-insoluble
-D-glucans of oral streptococci by methylation analysis, and by enzyme synthesis and degradation. Carbohydr Res 66, 254-264.
Jacques, N. A. (1983). Membrane perturbation by cerulenin modulates glucosyltransferase secretion and acetate uptake by Streptococcus salivarius. J Gen Microbiol 129, 3293-3302.
Jacques, N. A. (1994). The glucosyltransferases of Streptococcus salivarius. Aust Dent J 39, 111-114.[Medline]
Jacques, N. A. (1995). Extracellular sucrose metabolism by Streptococcus salivarius. In Genetics of Streptococci, Enterococci and Lactococci. Edited by J. J. Ferretti, M. S. Gilmore, T. R. Klaenhammer & F. Brown. Dev Biol Stand 85, 315-322.[Medline]
Kato, C. & Kuramitsu, H. K. (1990). Carboxy-terminal deletion analysis of the Streptococcus mutans glucosyltransferase-I enzyme. FEMS Microbiol Lett 72, 299-302.
Kobayashi, S., Koga, K., Hayashida, O., Nakano, Y. & Hasegawa, Y. (1989). Glucan-binding domain of a glucosyltransferase from Streptococcus sobrinus: isolation of a 55-kilodalton peptide trypsin digest of glucosyltransferase prebound to insoluble glucan. Infect Immun 57, 2210-2213.
Konishi, N., Torii, Y., Yamamoto, T. & 8 other authors (1999). Structure and enzymatic properties of genetically truncated forms of the water-insoluble glucan-synthesizing glucosyltransferase from Streptococcus sobrinus. J Biochem 126, 287295.
Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol 154, 367-382.[Medline]
Lesse, A. J., Campagnari, A. A., Bittner, W. E. & Apicella, M. A. (1990). Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulphate-polyacryamide gel electrophoresis. J Immunol Methods 126, 109-117.[Medline]
Lis, M., Shiroza, T. & Kuramitsu, H. K. (1995). Role of the C-terminal direct repeating units of the Streptococcus mutans glucosyltransferase-S in glucan binding. Appl Environ Microbiol 61, 2040-2042.[Abstract]
Loesche, W. L. (1986). Role of Streptococcus mutans in human dental decay. Microbiol Rev 50, 353-380.
Manning, M. C. & Woody, R. W. (1989). Theoretical study of the contribution of aromatic side chains to the circular dichroism of basic bovine pancreatic trypsin inhibitor. Biochemistry 28, 8609-8613.[Medline]
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Monchois, V., Reverte, A., Remaud-Simeon, H., Monsan, P. & Willemot, R. M. (1998). Effect of Leuconostoc mesenteroides NRRL B-512F dextransucrase carboxy-terminal deletions on dextran and oligosaccharide synthesis. Appl Environ Microbiol 64, 1644-1649.
Monchois, V., Arguello-Morales, M. & Russell, R. R. B. (1999a). Isolation of an active catalytic core of Streptococcus downei Mfe28 GTF-I glucosyltransferase. J Bacteriol 181, 2290-2292.
Monchois, V., Willemot, R.-M. & Monsan, P. (1999b). Glucansucrases: mechanism of action and structurefunction relationships. FEMS Microbiol Rev 23, 131-151.[Medline]
Mooser, G. & Wong, C. (1988). Isolation of glucan-binding domain of glucosyltransferase (1,6-
-glucan synthase) from Streptococcus sobrinus. Infect Immun 56, 880-884.
Murray, N. E., Brammar, W. H. & Murray, K. (1977). Lambdoid phages that simplify the recovery of in vitro recombinants. Mol Gen Genet 150, 53-61.[Medline]
Nakano, Y. J. & Kuramitsu, H. K. (1992). Mechanism of Streptococcus mutans glucosyltransferases: hybrid-enzyme analysis. J Bacteriol 174, 5639-5646.
Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence analysis. Proc Natl Acad Sci USA 85, 2444-2448.
Quiocho, F. A. (1986). Carbohydrate-binding proteins: tertiary structures and proteinsugar interactions. Annu Rev Biochem 55, 287-315.[Medline]
Russell, R. R. B. (1978). Glycosyltransferases of Streptococcus mutans strain Ingbritt. Microbios 23, 135-146.
Sanger, F., Nicklen, S. & Coulsen, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467.
Schägger, H. & von Jagow, G. (1987). Tricine-sodium dodecyl sulphate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 166, 368-379.[Medline]
Shiroza, T., Ueda, S. & Kuramitsu, H. K. (1987). Sequence analysis of the gtfB gene from Streptococcus mutans. J Bacteriol 169, 4263-4270.
Simpson, C. L., Cheetham, N. W. H., Giffard, P. M. & Jacques, N. A. (1995a). Four glucosyltransferases, GtfJ, GtfK, GtfL and GtfM, from Streptococcus salivarius ATCC 25975. Microbiology 141, 1451-1460.
Simpson, C. L., Giffard, P. M. & Jacques, N. A. (1995b). Streptococcus salivarius ATCC 25975 possesses at least two genes coding for primer-independent glucosyltransferases. Infect Immun 63, 609-621.[Abstract]
Song, D. D. & Jacques, N. A. (1997). Cell disruption of Escherichia coli by glass bead stirring for the recovery of recombinant proteins. Anal Biochem 248, 300-301.[Medline]
Studier, F. W. & Moffat, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189, 113-130.[Medline]
Sun, J. W., Wanda, S. Y., Camilli, A. & Curtiss, R. (1994). Cloning and DNA sequencing of the dextranase inhibitor gene (dei) from Streptococcus sobrinus. J Bacteriol 176, 7213-7222.
Thain, A., Gaston, K., Jenkins, O. & Clarke, A. R. (1996). A method for the separation of GST fusion proteins from co-purifying GroEL. Trends Genet 12, 209-210.[Medline]
Venyaminov, S. Y. & Vassilenko, K. S. (1994). Determination of protein tertiary structure class from circular dichroism spectra. Anal Biochem 222, 176-184.[Medline]
Vickerman, M. M., Sulavik, M. C., Minick, P. E. & Clewell, D. B. (1996). Changes in the carboxy-terminal repeat region affect extracellular activity and glucan products of Streptococcus gordonii glucosyltransferase. Infect Immun 64, 5117-5128.[Abstract]
Walker, G. J. (1978). Dextrans. Int Rev Biochem 16, 75-126.
Woody, R. W. (1974). Studies of theoretical circular dichroism of polypeptides: contributions of beta-turns. In Peptides, Polypeptides and Proteins , pp. 338-350. Edited by E. R. Blout, F. A. Bovey, N. Lotan & M. Goodman. New York:Wiley.
Woody, R. W. (1978). Aromatic side-chain contributions to the far ultraviolet circular dichroism of peptides and proteins. Biopolymers 17, 1451-1467.
Wren, B. W. (1991). A family of clostridial and streptococcal ligand-binding proteins with conserved C-terminal repeat sequences. Mol Microbiol 5, 797-803.[Medline]
Wren, B. W., Russell, R. R. B. & Tabaqchali, S. (1991). Antigenic cross-reactivity and functional inhibition by antibodies to Clostridium difficile toxin A, Streptococcus mutans glucan-binding protein, and a synthetic peptide. Infect Immun 59, 3151-3155.
Yother, J. & Briles, D. E. (1992). Structural properties and evolutionary relationships of PspA, a surface protein of Streptococcus pneumoniae, as revealed by sequence analysis. J Bacteriol 174, 601-609.
Received 28 June 2001;
revised 6 September 2001;
accepted 8 October 2001.
This article has been cited by other articles:
![]() |
S. A. F. T. van Hijum, S. Kralj, L. K. Ozimek, L. Dijkhuizen, and I. G. H. van Geel-Schutten Structure-Function Relationships of Glucansucrase and Fructansucrase Enzymes from Lactic Acid Bacteria Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 157 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. H. Shah, G. Joucla, M. Remaud-Simeon, and R. R. B. Russell Conserved Repeat Motifs and Glucan Binding by Glucansucrases of Oral Streptococci and Leuconostoc mesenteroides J. Bacteriol., December 15, 2004; 186(24): 8301 - 8308. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.A. Banas and M.M. Vickerman GLUCAN-BINDING PROTEINS OF THE ORAL STREPTOCOCCI Critical Reviews in Oral Biology & Medicine, March 1, 2003; 14(2): 89 - 99. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |