|
|
||||||||
Research Paper |
Laboratoire de Biologie Microbienne, Université de Lausanne, CH-1015 Lausanne, Switzerland1
Institut für Pflanzenwissenschaften/Phytopathologie, ETH Zürich, CH-8092 Zürich, Switzerland2
IATE-Pédologie, EPFL, CH 1015 Lausanne, Switzerland3
Author for correspondence: Cornelia Reimmann. Tel: +41 21 692 56 32. Fax: +41 21 692 56 35. e-mail: Cornelia.Reimmann{at}lbm.unil.ch
| ABSTRACT |
|---|
|
|
|---|
Keywords: virulence, cellcell signalling, quorum sensing, twitching motility
Abbreviations: AHL, N-acylhomoserine lactone; BHL, N-butyryl-L-homoserine lactone; CTAB, cetyltrimethylammonium bromide; HHL, N-hexanoyl-L-homoserine lactone; OdDHL, N-oxododecanoyl-L-homoserine lactone; OHHL, N-oxohexanoyl-L-homoserine lactone; OOHL, N-oxooctanoyl-L-homoserine lactone
The GenBank accession number for the aiiA nucleotide sequence is AF397400. The GenBank accession numbers for the nucleotide sequences of the 16S rRNA genes of strains A23 and A24 are AF397398 and AF397399.
a Present address: School of Biological Sciences, PO Box 18, Monash University, Clayton, Victoria 3800, Australia.
| INTRODUCTION |
|---|
|
|
|---|
Null mutations in the chromosomal lasI and rhlI genes abolish autoinducer biosynthesis and strongly reduce virulence gene expression in P. aeruginosa (Brint & Ohman, 1995
; Ochsner & Reiser, 1995
; Pearson et al., 1997
, 2000
; Pessi & Haas, 2000
). LasI- and/or RhlI-negative mutants of P. aeruginosa are less virulent than is the wild-type strain in several animal models (reviewed by Rumbaugh et al., 2000
). Interference with quorum-sensing-dependent gene regulation may therefore be a new strategy to control P. aeruginosa infections (Kline et al., 1999
; Leadbetter, 2001
). Several potential target sites in this complex regulatory network can be envisaged. For instance, antagonists of low molecular mass which compete for the autoinducer-binding site on the regulatory proteins may act as quorum sensing blockers. Indeed, the ability of natural and synthetic AHL analogues to interfere with quorum sensing has been well documented in various Gram-negative bacteria (de Nys et al., 1993
; Givskov et al., 1996
; Kuo et al., 1996
; Passador et al., 1996
; McClean et al., 1997
; Pesci et al., 1997
; Zhu et al., 1998
; Kline et al., 1999
; Manefield et al., 2000
). Alternatively, it might be possible to block cellcell signalling by preventing AHL signal biosynthesis (i.e. by targeting the autoinducer synthases). Finally, enzymic signal destruction (Dong et al., 2001
) is another approach, which was chosen in the present work. Here we report on the isolation of a Bacillus gene encoding autoinducer degrading activity and we show that heterologous expression of this gene in P. aeruginosa strongly reduces autoinducer accumulation, virulence gene expression and swarming motility.
| METHODS |
|---|
|
|
|---|
|
Strain identification.
The 16S rRNA genes of isolates A23 and A24 were PCR amplified (3 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 54 °C, 1 min at 72 °C; 7 min at 72 °C) from chromosomal DNA using the universal primers 16SUNI-L (5'-AGAGTTTGATCATGGCTCAG-3') and 16SUNI-R (5'-GTGTGACGGGCGGTGTGTAC-3'). PCR products were separated by agarose gel electrophoresis, purified and used as templates in cycle sequencing as described below.
DNA manipulations and nucleotide sequencing.
Small-scale preparations of plasmid DNA were carried out by the CTAB method (Del Sal et al., 1988
) and large-scale preparations were performed using Qiagen-Tips (Qiagen). Chromosomal DNA was extracted from Bacillus strains A23 and A24 as follows. Bacteria of an overnight culture grown in 100 ml NYB were harvested, washed with 20 ml TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 8) and stored at -80 °C. Frozen cells were ground in liquid nitrogen with mortar and pestle, resuspended in 2 ml TE buffer and 0·25 ml 10% (w/v) SDS, and incubated at 37 °C for 15 min. After addition of 0·5 ml 5 M NaClO4, the solution was extracted several times with equal volumes of phenol/CHCl3 (1:1, v/v) and CHCl3. Nucleic acids were precipitated with 0·1 vol. 3 M sodium acetate (pH 5·2) and 2 vols ethanol, washed with 70% (v/v) ethanol, dried under vacuum and dissolved in 0·3 ml TE buffer containing 0·1 mg DNase-free RNase. Restriction enzyme digestions, ligations and agarose gel electrophoresis were done by standard procedures (Sambrook et al., 1989
). DNA fragments and PCR products were purified from agarose gels using Geneclean II Kit (BIO 101) and High Pure PCR Purification Kit (Roche Molecular Biochemicals). Transformation of E. coli was done by electroporation (Farinha & Kropinski, 1990
). Southern blotting of Bacillus sp. DNA with Hybond-N membranes (Amersham), random-primed DNA labelling of a 0·75 kb XhoIKpnI aiiA fragment from pME6860 with digoxigenin-11-dUTP (Roche Molecular Biochemicals), hybridization and detection were performed according to the protocols of the suppliers. The nucleotide sequence of the aiiA gene carried by pME6860 was determined on both strands with a dye terminator kit (Perkin-Elmer product no. 402080) and an ABI PRISM 373 sequencer. Comparison of nucleotide and deduced amino acid sequences was performed using the Genetics Computer Group (GCG) program GAP. The aiiA nucleotide sequence will appear in the EMBL/GenBank/DDBJ Nucleotide Sequence Data Libraries under the accession number AF397400.
The nucleotide sequences of the 16S rRNA genes from A23 and A24 were determined on both strands with the ABI Prism dRhodamine Terminator Cycle Sequencing Ready Reaction Kit and an AB3100 sequencer. Eight separate PCR reactions (25 cycles of 10 s at 96 °C, 5 s at 50 °C, 4 s at 60 °C) were performed with the following primers: 16SUNI-L; 16SRNAI-S (5'-CTACGGGAGGCAGCAGTGGGG-3') together with 16SRNA1S (5'-CTACGGGAGGCAGCAGTGAGG-3'); 16SRNAII-S (5'-GTGTAGCGGTGAAATGCGTAG-3') together with 16SRNA2-S (5'-GTGTAGGGGTAAAATCCGTAG-3'); 16SRNAV-S (5'-CCCCACTGCTGCCTCCCGTAG-3'); 16SRNAVI-S (5'-CTACGCATTTCACCGCTACAC-3') together with 16SRNA6-S (5'-CTACGGATTTTACCCCTACAC-3'); 16SRNAVIII-S (5'-GCGCTCGTTGCGGGACTTAACC-3') together with 16SRNA8-S (5'-GCGCTCGTTATGGCACTTAAGC-3'); 16SRNAIV-S (5'-GGTTAAGTCCCGCAACGAGCGC-3') together with 16SRNA4-S (5'-GCTTAAGTGCCATAACGAGCGC-3'); and 16SUNI-R. Sequences were analysed using the GCG program FASTA. The nucleotide sequences of the 16S rRNA genes of strains A23 and A24 will appear in the EMBL/GenBank/DDBJ Nucleotide Sequence Data Libraries under the accession numbers AF397398 and AF397399.
Plasmid constructions.
The aiiA gene was PCR amplified (3 min at 95 °C; 21 cycles of 1 min at 95 °C, 1 min at 50 °C, 2 min at 72 °C; 10 min at 72 °C) from chromosomal DNA of Bacillus sp. strain A24 using the primers aiiA-7 (5'-ACGTCTCGAGGATCCATATGACAGTAAAGAAGCTT) and aiiA-8 (5'-GCTGGTACCGTCGACTATATATATTCAGGGAA); the ribosome-binding site is in bold, restriction sites for XhoI and KpnI are underlined, and nucleotides corresponding to the 5' and 3' ends of the aiiA gene from strain 240B1 (Dong et al., 2000
) are in italics. The PCR product was cleaved with XhoI and KpnI and cloned into pUK21 between the XhoI and KpnI sites to give pME6860. In this construct, which is able to replicate in E. coli, aiiA expression is driven from the vectors constitutive lac promoter. To express aiiA in P. aeruginosa, pME6863, a derivative of the broad-host-range vector pME6000, was constructed as follows. First, pME6860 was cleaved with KpnI, polished with T4 DNA polymerase, and cleaved with XhoI to generate a 0·8 kb fragment carrying aiiA. This fragment was ligated, via an EcoRIXhoI linker (5'-GAATTCCCGGGGATCCGGTGATTGATTGAGCAAGCTTATCGATACCGTCGACCTCGAG), with pME6000, which had first been linearized with BamHI, treated with T4 DNA polymerase, and cleaved with EcoRI. The resulting construct pME6863 expresses aiiA from the vectors constitutive lac promoter and the presence of the linker sequence, which carries translation stop signals in all three reading frames (underlined), prevents the formation of a potential LacZ'AiiA fusion protein.
AHL degradation assays.
In vivo degradation assays were performed as follows. Microtitre plates containing 10 µM HHL (Fluka) in NYB were inoculated with the bacteria to be tested (Bacillus sp. or E. coli) and incubated at 30 °C with gentle shaking for 16 h. Aliquots of 2, 5 or 10 µl of the bacterial suspensions were then transferred to a second microtitre plate containing 200 µl solidified NA per well. Bacteria were killed during a 10 min UV irradiation from a transilluminator and the wells were inoculated with 5 µl from an overnight culture of the indicator strain C. violaceum CV026. Violacein formation was monitored after a 24 h incubation at 30 °C. In wells which had been inoculated with test strains having autoinducer-degrading activity, the remaining concentration of HHL was insufficient to induce violacein formation in CV026.
AHLs used for in vitro degradation assays or as standards on TLC plates were purchased from Fluka or synthesized according to Chhabra et al. (1993)
and were kindly provided by Markus Beyeler. In vitro degradation assays were carried out either with cell-free culture supernatants or with crude cell extracts prepared from test strains. Cultures (300 ml) of Bacillus strains A23 and A24 were grown in NYB at 30 °C overnight. Cells were collected by centrifugation, resuspended in 3 ml of a buffer containing 0·1 M potassium phosphate pH 7·0, 10 mM MgCl2, 1 mM DTT and 10% (v/v) glycerol, and broken by sonication. Crude extracts were separated from cell debris by centrifugation. Degradation assays contained 100 µl of crude extract or 100 µl of a cell-free culture supernatant, respectively, and were carried out at 30 °C in 1 ml of the same buffer. AHLs were added at the following final concentrations: 200 µM BHL, 3 µM OdDHL and 2 µM HHL. The quantity of each autoinducer used in these assays was 100200 times higher than the respective detection limit (McClean et al., 1997
; Shaw et al., 1997
). After incubation for 6 h, the reaction mixture was adjusted to pH 5·0 with HCl and extracted with an equal volume of dichloromethane. The extract was dried under vacuum. The presence or absence of autoinducers was tested by TLC as described below.
Autoinducer detection and quantification by TLC.
For detection of AHLs produced by PAO1 carrying pME6000 or pME6863, respectively, 20 ml cell-free supernatants of NYB cultures containing 0·05% Triton X-100 were adjusted to pH 5·0 prior to extraction with 3 vols dichloromethane in a separating funnel. The solvent phase was treated with anhydrous MgSO4 to eliminate H2O and evaporated to dryness using a rotary evaporator. Depending on the optical density of the bacterial culture, the total extract was concentrated as follows: 1000-fold for OD600<0·5, 500-fold for OD600 0·51·4, 100-fold for OD600 1·52·1 and 50-fold for OD600>2·1. Samples from PAO1/pME6863, which contained very low amounts of BHL (and HHL), were concentrated up to 2000-fold. The presence of AHLs in these extracts was tested by C18 reverse-phase TLC, developed with methanol/water (60:40, v/v) and revealed by the indicator strains C. violaceum CV026 (McClean et al., 1997
) and Agrobacterium tumefaciens NT1(pZLR4) (Cha et al., 1998
). The amounts of OdDHL, BHL and HHL were estimated by comparison with three different dilutions of the respective standards.
Assays for exoproducts and ß-galactosidase activity.
HCN production by P. aeruginosa was quantified as described previously (Voisard et al., 1989
). Pyocyanin was extracted with chloroform from cell-free culture supernatants of P. aeruginosa grown in glycerol-alanine medium and assayed spectrophotometrically at 520 nm (Essar et al., 1990
). ß-Galactosidase specific activities were determined by the Miller method (Sambrook et al., 1989
).
Batch adhesion experiments.
Batch adhesion experiments were carried out by adapting a method described by Rijnaarts et al. (1993)
. Glass vials (volume 14 ml) were filled to the top with degassed 0·1 M PBS (containing, per litre, 4·93 g NaCl, 0·29 g KH2PO4 and 1·19 g K2HPO4; pH 7·2) and sealed with rubber stoppers without leaving a head space. The rubber stoppers were pierced by a plastic-coated wire piece to which a PVC patch as the test surface was attached. Bacterial strains were grown at 37 °C to mid-exponential phase, harvested by centrifugation, and washed three times with 0·1 M PBS. Concentrated cell suspensions (100300 µl) were gently injected through the stopper into the vials in order to obtain a final concentration of 4x107 bacteria ml-1. The vials were placed on a slanted rotating wheel (7 r.p.m.; amplitude 10 cm) to avoid sedimentation of bacteria and incubated at room temperature (21±3 °C). After 2 h incubation, the vials were opened and 70 ml 0·1 M PBS was added to each vial using a syringe. The tip of the needle was placed a few millimetres above the bottom of the vial and the flow was applied at a rate of 45 ml min-1. The flow was aimed away from the PVC patch to prevent detachment of bacteria due to shear stress. The excess liquid was allowed to flow out of the vials. This dilution procedure served to avoid the subsequent passage of the PVC patches through an interface between a dense bacterial suspension and air. It has been observed that such a passage can bias adhesion results because it leads to collection of bacteria that have accumulated in the liquidair interface (Schäfer et al., 1998
). The PVC patches were carefully removed from the vials to prevent dewetting as much as possible, placed on a microscope slide and covered immediately with a coverslip. They were observed under a light microscope (magnification x1250; BX-60, Olympus Optical Co.) equipped with a digital camera (SenSys, Photometrics). The numbers of adhered cells were determined for six randomly chosen locations, corresponding to a total area of 3·56x104 µm2. Locations close to the edges of the surfaces were avoided, since they gave erratic results, possibly due to deviating hydraulic conditions during incubation. Each experiment was done in triplicate. Levels of adhesion were given as numbers of cells per square centimetre and calculated by averaging the values of the 18 adhesion locations obtained for the three PVC patches.
| RESULTS |
|---|
|
|
|---|
Cloning and sequence analysis of a gene from strain A24 responsible for autoinducer degradation
While this work was in progress, Dong et al. (2000)
reported on a gene, aiiA, which encodes an AHL- degrading activity in Bacillus sp. 240B1. Based on the available sequence information, a potential aiiA homologue was PCR-amplified from strain A24 using the primers aiiA-7 (which adds a ribosome-binding site to the 5' end of the gene) and aiiA-8 (see Methods), and cloned into the vector pUK21, to give plasmid pME6860. The nucleotide sequence of the pME6860 insert was determined on both strands. To ensure that the DNA sequence analysed was free of mutations potentially introduced during the PCR reaction, the fragment was PCR amplified, cloned and sequenced in two more independent experiments. The nucleotide sequences obtained were identical in all three experiments and found to be highly similar to the coding sequence of the aiiA gene from strain 240B1. The deduced amino acid sequence of the AiiA homologue from strain A24 differed from the sequence of strain 240B1 in the following positions: Val73
Ile; Pro159
Ser; Pro185
Ser; Asn201
Glu; Ser210
Pro; Met225
Ile; Arg241
Lys. Autoinducer-degrading activity encoded by the cloned aiiA gene of strain A24 was confirmed with an in vivo degradation assay. E. coli DH5
expressing aiiA under the control of the constitutive lac promoter on pME6860 was able to degrade HHL whereas a control culture of DH5
was not.
To test whether a single or several aiiA genes were present in isolates A23 and A24, the 0·8 kb insert of pME6860 was used as a probe in a Southern blot against chromosomal DNA of A23 and A24. Hybridization under non-stringent conditions revealed single bands with six different restriction enzymes used. Both isolates gave identical patterns (data not shown). These results indicate that AHL-degrading activity is encoded in both bacterial isolates by a single aiiA gene.
Expression of aiiA in P. aeruginosa PAO1 decreases autoinducer concentrations
To study the effect of aiiA expression on autoinducer accumulation in P. aeruginosa PAO1, the aiiA gene of strain A24 was subcloned into the broad-host-range vector pME6000 under the control of the constitutive lac promoter. The resulting plasmid, pME6863, was mobilized, in parallel with the vector control (pME6000), from the E. coli donor strain S17-1 to P. aeruginosa PAO1. The influence of aiiA expression on the content of the two major autoinducers OdDHL and BHL of strain PAO1 was followed during growth. As illustrated in Fig. 1(a)
, aiiA expression severely reduced the content of OdDHL at high cell densities but had little effect on the low OdDHL concentration during exponential growth. The accumulation of the autoinducer BHL, which is produced later and at higher cell densities than is OdDHL, was completely prevented by aiiA expression (<0·25 µM; Fig. 1b
). Minor products of LasI (OHHL and OOHL) and of RhlI (HHL) were also affected. Whereas at high cell densities the presence of aiiA strongly reduced the content of OHHL and OOHL, aiiA expression completely blocked the accumulation of HHL during the entire growth cycle (data not shown).
|
|
aiiA expression also affected the production of HCN, which has been shown to be important for the virulence of P. aeruginosa towards Caenorhabditis elegans (Gallagher & Manoil, 2001
). The expression of the biosynthetic genes hcnABC requires both quorum sensing systems for maximal activity and is controlled additionally by the anaerobic activator ANR (Pessi & Haas, 2000
). HCN was produced by strain PAO1/pME6863 in only very small amounts (about 10 µM), whereas concentrations of about 100 µM were measured in cultures of PAO1/pME6000 (Fig. 2c
). Thus, HCN production is severely hampered in PAO1 expressing aiiA.
Similar results were also obtained for the production of the blue pigment pyocyanin, which, together with the siderophore ferripyochelin and a reducing agent such as NADH, catalyses hydroxyl radical formation and thus contributes to tissue injury (Britigan, 1993
; Mahajan-Miklos et al., 1999
). The expression of the pyocyanin biosynthetic genes strongly depends on quorum sensing and involves both autoinduction systems (Whiteley et al., 1999
). Pyocyanin formation was followed during growth of PAO1/pME6863 and PAO1/pME6000, respectively. As shown in Fig. 2(d)
, aiiA expression dramatically delayed and reduced the formation of this toxic compound.
Effect of aiiA expression on motility of P. aeruginosa
Expression of aiiA in strain PAO1/pME6863 strongly reduced swarming motility on 0·5% agar medium containing the attractant glucose (Fig. 3
). P. aeruginosa requires flagella, type IV pili and rhamnolipid production for swarming motility (Köhler et al., 2000
). We therefore tested whether aiiA expression would affect surface translocation by swimming, which requires flagella, or twitching motility, which depends on type IV pili (Henrichsen, 1972
; Bradley, 1980
). On 0·3% agar plates, concentric rings with similar diameters (30±1 mm) were formed by PAO1/pME6000 and PAO1/pME6863, indicating that swimming motility was not altered. In a control experiment using the flaC negative mutant MT1508, no swimming motility was observed. Similarly, the zones of subsurface twitching were indistinguishable for both strains (27±6 mm for PAO1/pME6000 and 24±2 mm for PAO1/pME6863) on twitch plates whereas no twitch zone (<1 mm) was formed by the pilus-negative (pilA) mutant PT623 used as a control. From these experiments we conclude that decreased swarming motility in the strain expressing aiiA (PAO1/pME6863) probably results from the strongly diminished rhamnolipid production.
|
| DISCUSSION |
|---|
|
|
|---|
In the present work, we have undertaken an independent search for bacteria which could interfere with the quorum sensing system of P. aeruginosa. Two Bacillus strains, A23 and A24, isolated from a Ghanaian and a Swiss soil, respectively, were able to degrade several AHLs. Despite the fact that the respective enzymic activity was localized in the bacterial cytoplasm, these strains were picked up in our screen. Apparently, effective intracellular degradation of the diffusible signal molecules HHL and BHL (produced by PAO1 in this assay) reduced the local signal concentration to an extent which resulted in a lower pigment production by the indicator strain.
We found that AHL-degrading activity was encoded in strain A24 by a gene whose DNA sequence was very similar to the previously described aiiA sequence (Dong et al., 2000
), and a related gene was shown to be present also in strain A23. The AiiA lactonase is assumed to be a metallohydrolase, whose conserved histidine and aspartate residues in two different sequence motifs are characteristic of zinc-binding enzymes. These residues, which are entirely conserved in the deduced amino acid sequence of the aiiA homologue of strain A24, are crucial for AHL-degrading activity (Dong et al., 2000
). Of the seven amino acid differences observed between strains A24 and 240B1, three changes concern proline residues, which could have an impact on the proteins secondary structure. It will therefore be interesting to compare the substrate specificities of the two proteins.
Heterologous expression of aiiA in P. aeruginosa PAO1 completely prevented the accumulation of the RhlI-generated autoinducers BHL and HHL throughout growth and severely reduced the concentrations of the oxo-AHLs produced by LasI at high cell densities, whereas low levels of OdDHL formed in the exponential-growth phase escaped AiiA action (Fig. 1
). As the two autoinduction circuits form a regulatory cascade in which the Rhl system depends on a functional Las system, degradation of the oxo-AHLs by AiiA will reduce the synthesis of BHL and HHL. Thus, the absence of these two autoinducers throughout growth of strain PAO1 carrying pME6863 probably results from reduced synthesis as well as from AiiA-dependent degradation. However, we cannot exclude the possibility that AiiA might degrade non-oxo-AHLs more efficiently than oxo-AHLs.
Our finding that degradation of cellcell signalling molecules in strain PAO1 expressing the A24 aiiA gene severely affected the expression and production of elastase, rhamnolipids, HCN and pyocyanin (Fig. 2
) is in general agreement with the established fact that both AHLs are crucial for virulence gene expression in P. aeruginosa (Pesci & Iglewski, 1999
). In the same vein, Dong et al. (2000
, 2001
) have shown that expression of aiiA from Bacillus sp. 240B1 in the plant pathogen Erwinia carotovora reduces autoinducer accumulation, decreases extracellular pectolytic enzyme activities and attenuates pathogenicity on several plant species. Our work opens up the possibility to test the impact of signal destruction on the pathogenicity of P. aeruginosa in vivo.
Even though aiiA expression strongly reduced AHL content in strain PAO1, we did not observe any significant effect on twitching motility and on adherence to PVC. This result was somewhat unexpected as twitching motility of P. aeruginosa has been reported to be under quorum sensing control (Glessner et al., 1999
). Twitching motility depends on type IV pili (Bradley, 1980
), which are also required for adhesion of P. aeruginosa to eukaryotic cell surfaces (Ramphal et al., 1984
, 1991
; Sato et al., 1988
; Tang et al., 1995
) and play a role in the early stages of biofilm formation on abiotic surfaces (OToole & Kolter, 1998
). Although pilin mRNA levels were not regulated by quorum sensing in strain PAO1 (Pearson et al., 1997
), surface piliation has been found to be strongly reduced in the BHL-negative (rhlI) mutant PDO100 (Glessner et al., 1999
). We have shown here that twitching motility was not affected when BHL was degraded below the limit of detection in strain PAO1 expressing aiiA on pME6863 (Fig. 2b
). This strongly suggests that a functional quorum sensing system is not required for this type of surface translocation. Twitching defects were recently found to develop spontaneously in lasI and rhlI mutants (Whitchurch et al., 2001
) and it is therefore possible that a spontaneous mutation accounts for the reduced twitching motility in the rhlI mutant PDO100.
As illustrated by this study, enzymic AHL destruction by aiiA expression offers a possibility to examine the role of AHL-dependent quorum sensing without the need for mutant construction. AiiA-dependent signal destruction may therefore be a particularly useful tool to study the impact of quorum sensing in Gram-negative bacteria having multiple AHL regulatory circuits.
| ACKNOWLEDGEMENTS |
|---|
This work was supported by the Swiss National Foundation for Scientific Research (project 31-45896.95), the Bonizzi-Theler Stiftung, the Zyma and Herbette Foundations and the interdisciplinary research program Génie Biomédical.
| REFERENCES |
|---|
|
|
|---|
Bradley, D. E. (1980). A function of Pseudomonas aeruginosa PAO pili: twitching motility. Can J Microbiol 26, 146-154.[Medline]
Brint, J. M. & Ohman, D. E. (1995). Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. J Bacteriol 177, 7155-7163.
Britigan, B. E. (1993). Role of reactive oxygen species in Pseudomonas infection. In Pseudomonas aeruginosa: the Opportunist. Pathogenesis and Disease, pp. 113140. Edited by R. B. Fick, Jr. Boca Raton, FL: CRC Press.
Castric, P. A. (1975). Hydrogen cyanide, a secondary metabolite of Pseudomonas aeruginosa. Can J Microbiol 21, 613-618.[Medline]
Cha, C., Gao, P., Chen, Y.-C., Shaw, P. D. & Farrand, S. K. (1998). Production of acyl-homoserine lactone quorum-sensing signals by Gram-negative plant-associated bacteria. Mol PlantMicrobe Interact 11, 1119-1129.[Medline]
Chhabra, S. R., Stead, P., Bainton, N. J., Salmond, G. P. C., Stewart, G. S. A. B., Williams, P. & Bycroft, B. W. (1993). Autoregulation of carbapenem biosynthesis in Erwinia carotovora by analogues of N-(3-oxohexanoyl)-L-homoserine lactone. J Antibiot 46, 441-454.[Medline]
de Nys, R., Wright, A. D., König, G. M. & Sticher, O. (1993). New halogenated furanones from the marine alga Delisea pulchra. Tetrahedron 49, 11213-11220.
Del Sal, G., Manfioletti, G. & Schneider, C. (1988). A one-tube plasmid DNA mini-preparation suitable for sequencing. Nucleic Acids Res 16, 9878.
Dong, Y.-H., Xu, X.-Z. & Zhang, L.-H. (2000). AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of Erwinia carotovora. Proc Natl Acad Sci USA 97, 3526-3531.
Dong, Y.-H., Wang, L.-H., Xu, J.-L., Zhang, H.-B., Zhang, X.-F. & Zhang, L.-H. (2001). Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine lactonase. Nature 411, 813-817.[Medline]
Essar, D. W., Eberly, L., Hadero, A. & Crawford, I. (1990). Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: interchangeability of the two anthranilate synthases and evolutionary implications. J Bacteriol 172, 884-900.
Farinha, M. A. & Kropinski, A. M. (1990). High efficiency electroporation of Pseudomonas aeruginosa using frozen cell suspensions. FEMS Microbiol Lett 70, 221-226.
Frank, L. H. & DeMoss, R. D. (1959). On the biosynthesis of pyocyanine. J Bacteriol 77, 776-782.
Fuqua, C. & Greenberg, E. P. (1998). Self perception in bacteria: quorum sensing with acylated homoserine lactones. Curr Opin Microbiol 1, 183-189.[Medline]
Gallagher, L. A. & Manoil, C. (2001). Pseudomonas aeruginosa PAO1 kills Caenorhabditis elegans by cyanide poisoning. J Bacteriol 183, 6207-6214.
Givskov, M., de Nys, R., Manefield, M., Gram, L., Maximilien, R., Eberl, L., Molin, S., Steinberg, P. D. & Kjelleberg, S. (1996). Eukaryotic interference with homoserine lactone-mediated prokaryotic signaling. J Bacteriol 178, 6618-6622.
Glessner, A., Smith, R. S., Iglewski, B. H. & Robinson, J. B. (1999). Roles of Pseudomonas aeruginosa las and rhl quorum-sensing system in control of twitching motility. J Bacteriol 181, 1623-1629.
Henrichsen, J. (1972). Bacterial surface translocation: a survey and a classification. Bacteriol Rev 36, 478-503.
Holloway, B. W. (1955). Genetic recombination in Pseudomonas aeruginosa. J Gen Microbiol 13, 572-581.
Johnson, M. K. & Boese-Marrazzo, D. (1980). Production and properties of heat-stable extracellular hemolysin from Pseudomonas aeruginosa. Infect Immun 29, 1028-1033.
Kline, T., Bowman, J., Iglewski, B. H., de Kievit, T., Kakai, Y. & Passador, L. (1999). Novel synthetic analogs of the Pseudomonas autoinducer. Bioorg Med Chem Lett 9, 3447-3452.[Medline]
Koch, A. K., Käppeli, O., Fiechter, A. & Reiser, J. (1989). Hydrocarbon assimilation and biosurfactant production in Pseudomonas aeruginosa mutants. J Bacteriol 173, 4212-4219.
Köhler, T., Curty, L. K., Barja, F., van Delden, C. & Pechère, J.-C. (2000). Swarming of Pseudomonas aeruginosa is dependent on cell-cell signaling and requires flagella and pili. J Bacteriol 182, 5990-5996.
Kuo, A., Callahan, S. M. & Dunlap, P. V. (1996). Modulation of luminescence operon expression by N-octanoyl-L-homoserine lactone in ainS mutants of Vibrio fischeri. J Bacteriol 178, 971-976.
Leadbetter, J. R. (2001). Quieting the raucous crowd. Nature 411, 748-749.[Medline]
Leadbetter, J. R. & Greenberg, E. P. (2000). Metabolism of acyl-homoserine lactone quorum-sensing signals by Variovorax paradoxus. J Bacteriol 182, 6921-6926.
Mahajan-Miklos, S., Tan, M.-W., Rahme, L. G. & Ausubel, F. M. (1999). Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosaCaenorhabditis elegans pathogenesis model. Cell 96, 47-56.[Medline]
Manefield, M., de Nys, R., Kumar, N., Read, R., Givskov, M., Steinberg, P. & Kjelleberg, S. (1999). Evidence that halogenated furanones from Delisea pulchra inhibit acylated homoserine lactone (AHL)-mediated gene expression by displacing the AHL signal from its receptor protein. Microbiology 145, 283-291.
Manefield, M., Harris, L., Rice, S. A., de Nys, R. & Kjelleberg, S. (2000). Inhibition of luminescence and virulence in the tiger prawn (Penaeus monodon) pathogen Vibrio harveyi by intercellular signal antagonists. Appl Environ Microbiol 66, 2079-2084.
Maurhofer, M., Reimmann, C., Schmidli-Sacherer, P., Heeb, S., Haas, D. & Défago, G. (1998). Salicylic acid biosynthetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of systemic resistance in tobacco against tobacco necrosis virus. Phytopathology 88, 687-684.
McClean, K. H., Winson, M. K., Fish, L. & 9 other authors (1997). Quorum sensing and Chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143, 37033711.
Ochsner, U. A. & Reiser, J. (1995). Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 92, 6424-6428.
OToole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295-304.[Medline]
Passador, L., Cook, J. M., Gambello, M. J., Rust, L. & Iglewski, B. H. (1993). Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science 260, 1127-1130.
Passador, L., Tucker, K. D., Guertin, K. R., Journet, M. P., Kende, A. S. & Iglewski, B. H. (1996). Functional analysis of the Pseudomonas aeruginosa autoinducer PAI. J Bacteriol 178, 5995-6000.
Pearson, J. P., Gray, K. M., Passador, L., Tucker, K. D., Eberhard, A., Iglewski, B. H. & Greenberg, E. P. (1994). Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc Natl Acad Sci U S A 91, 197-201.
Pearson, J. P., Pesci, E. C. & Iglewski, B. (1997). Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. J Bacteriol 179, 5756-5767.
Pearson, J. P., Feldman, M., Iglewski, B. H. & Prince, A. (2000). Pseudomonas aeruginosa cell-to-cell signaling is required for virulence in a model of acute pulmonary infection. Infect Immun 68, 4331-4334.
Pesci, E. C. & Iglewski, B. H. (1999). Quorum sensing in Pseudomonas aeruginosa. In CellCell Signaling in Bacteria , pp. 147-155. Edited by G. M. Dunny & S. C. Winans. Washington, DC:American Society for Microbiology.
Pesci, E. C., Pearson, J. P., Seed, P. C. & Iglewsi, B. H. (1997). Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179, 3127-3132.
Pessi, G. & Haas, D. (2000). Transcriptional control of the hydrogen cyanide biosynthetic genes hcnABC by the anaerobic regulator ANR and the quorum-sensing regulators LasR and RhlR in Pseudomonas aeruginosa. J Bacteriol 182, 6940-6949.
Ramphal, R., Sadoff, J. C., Pyle, M. & Silipigni, J. D. (1984). Role of pili in the adherence of Pseudomonas aeruginosa to injured tracheal epithelium. Infect Immun 44, 38-40.
Ramphal, R., Koo, L., Isimoto, K. S., Totten, P., Lara, J. C. & Lory, S. (1991). Adhesion of Pseudomonas aeruginosa pilin-deficient mutants to mucin. Infect Immun 59, 1307-1311.
Rashid, M. H. & Kornberg, A. (2000). Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 97, 4885-4890.
Rijnaarts, H. H. M., Norde, W., Bouwer, E. J., Lyklema, J. & Zehnder, A. J. B. (1993). Bacterial adhesion under static and dynamic conditions. Appl Environ Microbiol 59, 3255-3265.
Rumbaugh, K. R., Griswold, J. A. & Hamood, A. N. (2000). The role of quorum sensing in the in vivo virulence of Pseudomonas aeruginosa. Microbes Infect 2, 1721-1731.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sato, H., Okinaga, K. & Saito, H. (1988). Role of pili in the pathogenesis of Pseudomonas aeruginosa burn infections. Microbiol Immunol 32, 131-139.[Medline]
Schäfer, A., Harms, H. & Zehnder, A. J. B. (1998). Bacterial accumulation at the air-water interface. Environ Sci Technol 32, 3704-3712.
Shaw, P. D., Ping, G., Daly, S. L., Cha, C., Cronan, J. E.Jr, Rinehart, K. L. & Farrand, S. K. (1997). Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography. Proc Natl Acad Sci USA 94, 6036-6041.
Siegmund, I. & Wagner, F. (1991). New method for detecting rhamnolipids excreted by Pseudomonas species during growth on mineral agar. Biotechnol Tech 5, 265-268.
Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range mobilization system for in vitro genetic engineering: transposon mutagenesis in Gram negative bacteria. Biotechnology 1, 784-790.
Stanisich, V. A. & Holloway, B. W. (1972). A mutant sex factor of Pseudomonas aeruginosa. Genet Res 19, 91-108.[Medline]
Swift, S., Williams, P. & Stewart, G. S. A. B. (1999). N-Acylhomoserine lactones and quorum sensing in proteobacteria. In CellCell Signaling In Bacteria , pp. 291-313. Edited by G. M. Dunny & S. C. Winans. Washington, DC:American Society for Microbiology.
Tang, H., Kays, M. & Prince, A. (1995). Role of Pseudomonas aeruginosa pili in acute pulmonary infection. Infect Immun 63, 1278-1285.[Abstract]
Vieira, J. & Messing, J. (1991). New pUC-derived cloning vectors with different selectable markers and DNA replication origins. Gene 100, 189-194.[Medline]
Voisard, C., Keel, C., Haas, D. & Défago, G. (1989). Cyanide production by Pseudomonas fluorescens helps suppress back root rot of tobacco under gnotobiotic conditions. EMBO J 8, 351-358.[Medline]
Whitchurch, C. B., Beatson, S. A. Young, M. D. & 7 other authors (2001). The coordinate regulation of twitching motility and other virulence factors in Pseudomonas aeruginosa. Pseudomonas Meeting 2001, Brussels, Abstract no. 7.
Whiteley, M., Lee, K. M. & Greenberg, E. P. (1999). Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc Natl Acad Sci USA 96, 13904-13909.
Williams, P., Camara, M., Hardman, A. & 7 other authors (2000). Quorum sensing and the population-dependent control of virulence. Philos Trans R Soc Lond Ser B Biol Sci 355, 667680.[Medline]
Winson, M. K., Camara, M., Latifi, A. & 10 other authors (1995). Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. Proc Natl Acad Sci USA 92, 94279431.
Zhu, J., Beaber, J. W., Moré, M. I., Fuqua, C., Eberhard, A. & Winans, A. (1998). Analogs of the autoinducer 3-oxooctanoyl-homoserine lactone strongly inhibit activity of the TraR protein of Agrobacterium tumefaciens. J Bacteriol 180, 5398-5405.
Received 2 October 2001;
revised 17 December 2001;
accepted 19 December 2001.
This article has been cited by other articles:
![]() |
S. Salvetti, F. Celandroni, M. Ceragioli, S. Senesi, and E. Ghelardi Identification of non-flagellar genes involved in swarm cell differentiation using a Bacillus thuringiensis mini-Tn10 mutant library Microbiology, March 1, 2009; 155(3): 912 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schipper, C. Hornung, P. Bijtenhoorn, M. Quitschau, S. Grond, and W. R. Streit Metagenome-Derived Clones Encoding Two Novel Lactonase Family Proteins Involved in Biofilm Inhibition in Pseudomonas aeruginosa Appl. Envir. Microbiol., January 1, 2009; 75(1): 224 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uroz, P. M. Oger, E. Chapelle, M.-T. Adeline, D. Faure, and Y. Dessaux A Rhodococcus qsdA-Encoded Enzyme Defines a Novel Class of Large-Spectrum Quorum-Quenching Lactonases Appl. Envir. Microbiol., March 1, 2008; 74(5): 1357 - 1366. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. B. M. Hussain, H.-B. Zhang, J.-L. Xu, Q. Liu, Z. Jiang, and L.-H. Zhang The Acyl-Homoserine Lactone-Type Quorum-Sensing System Modulates Cell Motility and Virulence of Erwinia chrysanthemi pv. zeae J. Bacteriol., February 1, 2008; 190(3): 1045 - 1053. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Dong, L.-H. Wang, and L.-H. Zhang Quorum-quenching microbial infections: mechanisms and implications Phil Trans R Soc B, July 29, 2007; 362(1483): 1201 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wopperer, S. T. Cardona, B. Huber, C. A. Jacobi, M. A. Valvano, and L. Eberl A Quorum-Quenching Approach To Investigate the Conservation of Quorum-Sensing-Regulated Functions within the Burkholderia cepacia Complex Appl. Envir. Microbiol., February 1, 2006; 72(2): 1579 - 1587. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kim and M. G. Surette Coordinated Regulation of Two Independent Cell-Cell Signaling Systems and Swarmer Differentiation in Salmonella enterica Serovar Typhimurium J. Bacteriol., January 15, 2006; 188(2): 431 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gao, H. Chen, A. Eberhard, M. R. Gronquist, J. B. Robinson, B. G. Rolfe, and W. D. Bauer sinI- and expR-Dependent Quorum Sensing in Sinorhizobium meliloti J. Bacteriol., December 1, 2005; 187(23): 7931 - 7944. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uroz, S. R. Chhabra, M. Camara, P. Williams, P. Oger, and Y. Dessaux N-Acylhomoserine lactone quorum-sensing molecules are modified and degraded by Rhodococcus erythropolis W2 by both amidolytic and novel oxidoreductase activities Microbiology, October 1, 2005; 151(10): 3313 - 3322. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Park, H.-O. Kang, H.-S. Jang, J.-K. Lee, B.-T. Koo, and D.-Y. Yum Identification of Extracellular N-Acylhomoserine Lactone Acylase from a Streptomyces sp. and Its Application to Quorum Quenching Appl. Envir. Microbiol., May 1, 2005; 71(5): 2632 - 2641. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Molina, F. Rezzonico, G. Defago, and B. Duffy Autoinduction in Erwinia amylovora: Evidence of an Acyl-Homoserine Lactone Signal in the Fire Blight Pathogen J. Bacteriol., May 1, 2005; 187(9): 3206 - 3213. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Wang and J. R. Leadbetter Rapid Acyl-Homoserine Lactone Quorum Signal Biodegradation in Diverse Soils Appl. Envir. Microbiol., March 1, 2005; 71(3): 1291 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Ulrich Quorum Quenching: Enzymatic Disruption of N-Acylhomoserine Lactone-Mediated Bacterial Communication in Burkholderia thailandensis Appl. Envir. Microbiol., October 1, 2004; 70(10): 6173 - 6180. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Ulrich, H. B. Hines, N. Parthasarathy, and J. A. Jeddeloh Mutational Analysis and Biochemical Characterization of the Burkholderia thailandensis DW503 Quorum-Sensing Network J. Bacteriol., July 1, 2004; 186(13): 4350 - 4360. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Roche, J. T. Byers, D. S. Smith, F. G. Glansdorp, D. R. Spring, and M. Welch Communications blackout? Do N-acylhomoserine-lactone-degrading enzymes have any role in quorum sensing? Microbiology, July 1, 2004; 150(7): 2023 - 2028. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Heurlier, F. Williams, S. Heeb, C. Dormond, G. Pessi, D. Singer, M. Camara, P. Williams, and D. Haas Positive Control of Swarming, Rhamnolipid Synthesis, and Lipase Production by the Posttranscriptional RsmA/RsmZ System in Pseudomonas aeruginosa PAO1 J. Bacteriol., May 15, 2004; 186(10): 2936 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-H. Wang, L.-X. Weng, Y.-H. Dong, and L.-H. Zhang Specificity and Enzyme Kinetics of the Quorum-quenching N-Acyl Homoserine Lactone Lactonase (AHL-lactonase) J. Biol. Chem., April 2, 2004; 279(14): 13645 - 13651. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Rothfork, S. Dessus-Babus, W. J. B. Van Wamel, A. L. Cheung, and H. D. Gresham Fibrinogen Depletion Attenuates Staphyloccocus aureus Infection by Preventing Density-Dependent Virulence Gene Up-Regulation J. Immunol., November 15, 2003; 171(10): 5389 - 5395. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Huang, J.-I. Han, L.-H. Zhang, and J. R. Leadbetter Utilization of Acyl-Homoserine Lactone Quorum Signals for Growth by a Soil Pseudomonad and Pseudomonas aeruginosa PAO1 Appl. Envir. Microbiol., October 1, 2003; 69(10): 5941 - 5949. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uroz, C. D'Angelo-Picard, A. Carlier, M. Elasri, C. Sicot, A. Petit, P. Oger, D. Faure, and Y. Dessaux Novel bacteria degrading N-acylhomoserine lactones and their use as quenchers of quorum-sensing-regulated functions of plant-pathogenic bacteria Microbiology, August 1, 2003; 149(8): 1981 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Whistler and L. S. Pierson III Repression of Phenazine Antibiotic Production in Pseudomonas aureofaciens Strain 30-84 by RpeA J. Bacteriol., July 1, 2003; 185(13): 3718 - 3725. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Nouwens, S. A. Beatson, C. B. Whitchurch, B. J. Walsh, H. P. Schweizer, J. S. Mattick, and S. J. Cordwell Proteome analysis of extracellular proteins regulated by the las and rhl quorum sensing systems in Pseudomonas aeruginosa PAO1 Microbiology, May 1, 2003; 149(5): 1311 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Flagan, W.-K. Ching, and J. R. Leadbetter Arthrobacter Strain VAI-A Utilizes Acyl-Homoserine Lactone Inactivation Products and Stimulates Quorum Signal Biodegradation by Variovorax paradoxus Appl. Envir. Microbiol., February 1, 2003; 69(2): 909 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aendekerk, B. Ghysels, P. Cornelis, and C. Baysse Characterization of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium Microbiology, August 1, 2002; 148(8): 2371 - 2381. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |