Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 148 (2002), 923-932
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reimmann, C.
Right arrow Articles by Haas, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reimmann, C.
Right arrow Articles by Haas, D.
Agricola
Right arrow Articles by Reimmann, C.
Right arrow Articles by Haas, D.
Microbiology (2002), 148, 923-932.
© 2002 Society for General Microbiology


Research Paper

Genetically programmed autoinducer destruction reduces virulence gene expression and swarming motility in Pseudomonas aeruginosa PAO1

Cornelia Reimmann1, Nathalie Ginet1, Laurent Michel1, Christoph Keel1, Patrick Michaux1, Viji Krishnapillaia,1, Marcello Zala2, Karin Heurlier1, Karine Triandafillu3, Hauke Harms3, Geneviève Défago2 and Dieter Haas1

Laboratoire de Biologie Microbienne, Université de Lausanne, CH-1015 Lausanne, Switzerland1
Institut für Pflanzenwissenschaften/Phytopathologie, ETH Zürich, CH-8092 Zürich, Switzerland2
IATE-Pédologie, EPFL, CH 1015 Lausanne, Switzerland3

Author for correspondence: Cornelia Reimmann. Tel: +41 21 692 56 32. Fax: +41 21 692 56 35. e-mail: Cornelia.Reimmann{at}lbm.unil.ch


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Virulence in the opportunistic human pathogen Pseudomonas aeruginosa is controlled by cell density via diffusible signalling molecules (‘autoinducers’) of the N-acylhomoserine lactone (AHL) type. Two Bacillus sp. isolates (A23 and A24) with AHL-degrading activity were identified among a large collection of rhizosphere bacteria. From isolate A24 a gene was cloned which was similar to the aiiA gene, encoding an AHL lactonase in another Bacillus strain. Expression of the aiiA homologue from isolate A24 in P. aeruginosa PAO1 reduced the amount of the quorum sensing signal N-oxododecanoyl-L-homoserine lactone and completely prevented the accumulation of the second AHL signal, N-butyryl-L-homoserine lactone. This strongly reduced AHL content correlated with a markedly decreased expression and production of several virulence factors and cytotoxic compounds such as elastase, rhamnolipids, hydrogen cyanide and pyocyanin, and strongly reduced swarming. However, no effect was observed on flagellar swimming or on twitching motility, and aiiA expression did not affect bacterial adhesion to a polyvinylchloride surface. In conclusion, introduction of an AHL degradation gene into P. aeruginosa could block cell–cell communication and exoproduct formation, but failed to interfere with surface colonization.

Keywords: virulence, cell–cell signalling, quorum sensing, twitching motility

Abbreviations: AHL, N-acylhomoserine lactone; BHL, N-butyryl-L-homoserine lactone; CTAB, cetyltrimethylammonium bromide; HHL, N-hexanoyl-L-homoserine lactone; OdDHL, N-oxododecanoyl-L-homoserine lactone; OHHL, N-oxohexanoyl-L-homoserine lactone; OOHL, N-oxooctanoyl-L-homoserine lactone

The GenBank accession number for the aiiA nucleotide sequence is AF397400. The GenBank accession numbers for the nucleotide sequences of the 16S rRNA genes of strains A23 and A24 are AF397398 and AF397399.

a Present address: School of Biological Sciences, PO Box 18, Monash University, Clayton, Victoria 3800, Australia.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell–cell communication is crucial for the virulence of the opportunistic human pathogen Pseudomonas aeruginosa, which controls the production of extracellular virulence factors and toxic secondary metabolites via a complex regulatory cascade involving two autoinduction systems (reviewed by Fuqua & Greenberg, 1998Down ; Pesci & Iglewski, 1999Down ; Williams et al., 2000Down ). The autoinducer synthase LasI generates primarily the N-acylhomoserine lactone (AHL) signalling molecule N-oxododecanoyl-L-homoserine lactone (OdDHL), as well as minor amounts of other oxo-AHLs such as N-oxohexanoyl-L-homoserine lactone (OHHL) and N-oxooctanoyl-L-homoserine lactone (OOHL) (Pearson et al., 1994Down ). When OdDHL accumulates in a bacterial population with increasing cell density, it will interact, at a critical threshold level, with the transcriptional regulator LasR. The activated LasR protein stimulates the expression of lasI, generating the first autoinduction loop. LasR also positively controls the expression of rhlR, encoding the transcriptional regulator of the second autoinduction system involving N-butyryl-L-homoserine lactone (BHL). This C4 AHL is made by the RhlI protein, which also generates small amounts of N-hexanoyl-L-homoserine lactone (HHL) (Winson et al., 1995Down ). Above a critical concentration, BHL activates RhlR, which induces the transcription of rhlI, thereby creating the second autoinduction loop. The expression of many virulence genes in P. aeruginosa requires LasR and/or RhlR, activated by their respective autoinducer molecules (Whiteley et al., 1999Down ). Therefore, virulence factors are produced when the density of the bacterial population is sufficiently high; this induction mechanism is known as quorum sensing (Fuqua & Greenberg, 1998Down ; Williams et al., 2000Down ).

Null mutations in the chromosomal lasI and rhlI genes abolish autoinducer biosynthesis and strongly reduce virulence gene expression in P. aeruginosa (Brint & Ohman, 1995Down ; Ochsner & Reiser, 1995Down ; Pearson et al., 1997Down , 2000Down ; Pessi & Haas, 2000Down ). LasI- and/or RhlI-negative mutants of P. aeruginosa are less virulent than is the wild-type strain in several animal models (reviewed by Rumbaugh et al., 2000Down ). Interference with quorum-sensing-dependent gene regulation may therefore be a new strategy to control P. aeruginosa infections (Kline et al., 1999Down ; Leadbetter, 2001Down ). Several potential target sites in this complex regulatory network can be envisaged. For instance, antagonists of low molecular mass which compete for the autoinducer-binding site on the regulatory proteins may act as quorum sensing blockers. Indeed, the ability of natural and synthetic AHL analogues to interfere with quorum sensing has been well documented in various Gram-negative bacteria (de Nys et al., 1993Down ; Givskov et al., 1996Down ; Kuo et al., 1996Down ; Passador et al., 1996Down ; McClean et al., 1997Down ; Pesci et al., 1997Down ; Zhu et al., 1998Down ; Kline et al., 1999Down ; Manefield et al., 2000Down ). Alternatively, it might be possible to block cell–cell signalling by preventing AHL signal biosynthesis (i.e. by targeting the autoinducer synthases). Finally, enzymic signal destruction (Dong et al., 2001Down ) is another approach, which was chosen in the present work. Here we report on the isolation of a Bacillus gene encoding autoinducer degrading activity and we show that heterologous expression of this gene in P. aeruginosa strongly reduces autoinducer accumulation, virulence gene expression and swarming motility.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains, plasmids and culture conditions.
Bacterial strains and plasmids used in this study are listed in Table 1Down. Unless indicated otherwise, P. aeruginosa and Escherichia coli strains were grown at 37 °C with shaking at 180 r.p.m. in nutrient yeast broth (NYB) or on nutrient agar plates (NA) (Stanisich & Holloway, 1972Down ). The incubation temperature for the Bacillus strains A23 and A24 was 30 °C. Antibiotics, when required, were added at the following concentrations: tetracycline, 25 µg ml-1 for E. coli and 125 µg ml-1 for P. aeruginosa; ampicillin, 100 µg ml-1 for E. coli; carbenicillin, 250 µg ml-1 for P. aeruginosa. Liquid cultures of P. aeruginosa containing pME6000 (vector control) or PCR-amplified aiiA gene on pME6863 were grown without tetracycline in experiments designed to measure lasB and rhlA expression or to quantify autoinducers, pyocyanin and hydrogen cyanide (HCN). To counterselect E. coli S17-1 in matings with P. aeruginosa, chloramphenicol was used at 10 µg ml-1. Flagellar swimming was tested on NYB solidified with 0·3% agar (Serva). Plates were dried briefly and inoculated with bacterial overnight cultures grown on NA with tetracycline (if appropriate), using a sterile toothpick. Plates were incubated at 30 °C for 24 h and the diameters of the swimming zones were measured from three parallel experiments. Swarming was tested on plates containing 0·5% (w/v) Bacto agar (Oxoid) with 8 g nutrient broth l-1 (Oxoid) to which 5 g glucose l-1 was added (Rashid & Kornberg, 2000Down ). Swarm plates were dried very briefly and inoculated with 10 µl of bacteria grown overnight in NYB with tetracycline. Incubation was carried out at 37 °C for 16 h. Twitching motility was assayed on Luria broth (LB) medium (Sambrook et al., 1989Down ) solidified with 1% bacto agar (Oxoid). Plates (2–3 mm thick) were stab-inoculated with sterile toothpicks to the bottom of the Petri dish from overnight cultures grown on NA containing, if appropriate, tetracycline. Subsurface twitching was evaluated after a 24 h incubation at 37 °C by measuring diameters of the twitch zones. Experiments were performed in triplicate. Rhamnolipid production was tested on agar plates containing cetyltrimethylammonium bromide (CTAB) and methylene blue (Siegmund & Wagner, 1991Down ). To determine the concentration of pyocyanin, P. aeruginosa strains were grown with aeration in 20 ml glycerol-alanine medium (Frank & DeMoss, 1959Down ). For quantitative HCN determination, cells were grown with oxygen limitation in tightly closed 125 ml bottles containing 20 ml glycine minimal medium (Castric, 1975Down ). To avoid bacterial clumping, Triton X-100 was added to the liquid growth media at a final concentration of 0·05% in experiments designed for autoinducer extraction, and for ß-galactosidase, HCN and pyocyanin measurements.


View this table:
[in this window]
[in a new window]
 
Table 1. Strains and plasmids

 
Bioassay for the detection of soil isolates interfering with AHL-dependent gene regulation.
The biotest which was developed here to screen a large collection of soil isolates is based on the fact that P. aeruginosa PAO1 produces two AHL autoinducers (BHL and HHL) which can restore violacein production to the autoinducer-negative mutant Chromobacterium violaceum CV026 (McClean et al., 1997Down ). Strain CV026 was streaked as a homogeneous line on a low-nutrient medium containing 4 g tryptic soy agar and 17 g agar l-1 (Serva). After incubation at 24 °C for 6 h, 5 µl of an overnight culture of a test strain was deposited at a distance of 6–7 mm from the CV026 line. After further incubation at 24 °C for 18 h, 5 µl of an overnight PAO1 culture was spotted at 10 mm from the test strain and 6–7 mm from the CV026 line. Incubation at 24 °C was continued for another 2 days before purple pigment production was evaluated. Test strains which interfered with AHL-dependent signalling reduced the localized, PAO1-induced production of violacein by CV026.

Strain identification.
The 16S rRNA genes of isolates A23 and A24 were PCR amplified (3 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 54 °C, 1 min at 72 °C; 7 min at 72 °C) from chromosomal DNA using the universal primers 16SUNI-L (5'-AGAGTTTGATCATGGCTCAG-3') and 16SUNI-R (5'-GTGTGACGGGCGGTGTGTAC-3'). PCR products were separated by agarose gel electrophoresis, purified and used as templates in cycle sequencing as described below.

DNA manipulations and nucleotide sequencing.
Small-scale preparations of plasmid DNA were carried out by the CTAB method (Del Sal et al., 1988Down ) and large-scale preparations were performed using Qiagen-Tips (Qiagen). Chromosomal DNA was extracted from Bacillus strains A23 and A24 as follows. Bacteria of an overnight culture grown in 100 ml NYB were harvested, washed with 20 ml TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 8) and stored at -80 °C. Frozen cells were ground in liquid nitrogen with mortar and pestle, resuspended in 2 ml TE buffer and 0·25 ml 10% (w/v) SDS, and incubated at 37 °C for 15 min. After addition of 0·5 ml 5 M NaClO4, the solution was extracted several times with equal volumes of phenol/CHCl3 (1:1, v/v) and CHCl3. Nucleic acids were precipitated with 0·1 vol. 3 M sodium acetate (pH 5·2) and 2 vols ethanol, washed with 70% (v/v) ethanol, dried under vacuum and dissolved in 0·3 ml TE buffer containing 0·1 mg DNase-free RNase. Restriction enzyme digestions, ligations and agarose gel electrophoresis were done by standard procedures (Sambrook et al., 1989Down ). DNA fragments and PCR products were purified from agarose gels using Geneclean II Kit (BIO 101) and High Pure PCR Purification Kit (Roche Molecular Biochemicals). Transformation of E. coli was done by electroporation (Farinha & Kropinski, 1990Down ). Southern blotting of Bacillus sp. DNA with Hybond-N membranes (Amersham), random-primed DNA labelling of a 0·75 kb XhoI–KpnI aiiA fragment from pME6860 with digoxigenin-11-dUTP (Roche Molecular Biochemicals), hybridization and detection were performed according to the protocols of the suppliers. The nucleotide sequence of the aiiA gene carried by pME6860 was determined on both strands with a dye terminator kit (Perkin-Elmer product no. 402080) and an ABI PRISM 373 sequencer. Comparison of nucleotide and deduced amino acid sequences was performed using the Genetics Computer Group (GCG) program GAP. The aiiA nucleotide sequence will appear in the EMBL/GenBank/DDBJ Nucleotide Sequence Data Libraries under the accession number AF397400.

The nucleotide sequences of the 16S rRNA genes from A23 and A24 were determined on both strands with the ABI Prism dRhodamine Terminator Cycle Sequencing Ready Reaction Kit and an AB3100 sequencer. Eight separate PCR reactions (25 cycles of 10 s at 96 °C, 5 s at 50 °C, 4 s at 60 °C) were performed with the following primers: 16SUNI-L; 16SRNAI-S (5'-CTACGGGAGGCAGCAGTGGGG-3') together with 16SRNA1S (5'-CTACGGGAGGCAGCAGTGAGG-3'); 16SRNAII-S (5'-GTGTAGCGGTGAAATGCGTAG-3') together with 16SRNA2-S (5'-GTGTAGGGGTAAAATCCGTAG-3'); 16SRNAV-S (5'-CCCCACTGCTGCCTCCCGTAG-3'); 16SRNAVI-S (5'-CTACGCATTTCACCGCTACAC-3') together with 16SRNA6-S (5'-CTACGGATTTTACCCCTACAC-3'); 16SRNAVIII-S (5'-GCGCTCGTTGCGGGACTTAACC-3') together with 16SRNA8-S (5'-GCGCTCGTTATGGCACTTAAGC-3'); 16SRNAIV-S (5'-GGTTAAGTCCCGCAACGAGCGC-3') together with 16SRNA4-S (5'-GCTTAAGTGCCATAACGAGCGC-3'); and 16SUNI-R. Sequences were analysed using the GCG program FASTA. The nucleotide sequences of the 16S rRNA genes of strains A23 and A24 will appear in the EMBL/GenBank/DDBJ Nucleotide Sequence Data Libraries under the accession numbers AF397398 and AF397399.

Plasmid constructions.
The aiiA gene was PCR amplified (3 min at 95 °C; 21 cycles of 1 min at 95 °C, 1 min at 50 °C, 2 min at 72 °C; 10 min at 72 °C) from chromosomal DNA of Bacillus sp. strain A24 using the primers aiiA-7 (5'-ACGTCTCGAGGATCCATATGACAGTAAAGAAGCTT) and aiiA-8 (5'-GCTGGTACCGTCGACTATATATATTCAGGGAA); the ribosome-binding site is in bold, restriction sites for XhoI and KpnI are underlined, and nucleotides corresponding to the 5' and 3' ends of the aiiA gene from strain 240B1 (Dong et al., 2000Down ) are in italics. The PCR product was cleaved with XhoI and KpnI and cloned into pUK21 between the XhoI and KpnI sites to give pME6860. In this construct, which is able to replicate in E. coli, aiiA expression is driven from the vector’s constitutive lac promoter. To express aiiA in P. aeruginosa, pME6863, a derivative of the broad-host-range vector pME6000, was constructed as follows. First, pME6860 was cleaved with KpnI, polished with T4 DNA polymerase, and cleaved with XhoI to generate a 0·8 kb fragment carrying aiiA. This fragment was ligated, via an EcoRI–XhoI linker (5'-GAATTCCCGGGGATCCGGTGATTGATTGAGCAAGCTTATCGATACCGTCGACCTCGAG), with pME6000, which had first been linearized with BamHI, treated with T4 DNA polymerase, and cleaved with EcoRI. The resulting construct pME6863 expresses aiiA from the vector’s constitutive lac promoter and the presence of the linker sequence, which carries translation stop signals in all three reading frames (underlined), prevents the formation of a potential LacZ'–AiiA fusion protein.

AHL degradation assays.
In vivo degradation assays were performed as follows. Microtitre plates containing 10 µM HHL (Fluka) in NYB were inoculated with the bacteria to be tested (Bacillus sp. or E. coli) and incubated at 30 °C with gentle shaking for 16 h. Aliquots of 2, 5 or 10 µl of the bacterial suspensions were then transferred to a second microtitre plate containing 200 µl solidified NA per well. Bacteria were killed during a 10 min UV irradiation from a transilluminator and the wells were inoculated with 5 µl from an overnight culture of the indicator strain C. violaceum CV026. Violacein formation was monitored after a 24 h incubation at 30 °C. In wells which had been inoculated with test strains having autoinducer-degrading activity, the remaining concentration of HHL was insufficient to induce violacein formation in CV026.

AHLs used for in vitro degradation assays or as standards on TLC plates were purchased from Fluka or synthesized according to Chhabra et al. (1993)Down and were kindly provided by Markus Beyeler. In vitro degradation assays were carried out either with cell-free culture supernatants or with crude cell extracts prepared from test strains. Cultures (300 ml) of Bacillus strains A23 and A24 were grown in NYB at 30 °C overnight. Cells were collected by centrifugation, resuspended in 3 ml of a buffer containing 0·1 M potassium phosphate pH 7·0, 10 mM MgCl2, 1 mM DTT and 10% (v/v) glycerol, and broken by sonication. Crude extracts were separated from cell debris by centrifugation. Degradation assays contained 100 µl of crude extract or 100 µl of a cell-free culture supernatant, respectively, and were carried out at 30 °C in 1 ml of the same buffer. AHLs were added at the following final concentrations: 200 µM BHL, 3 µM OdDHL and 2 µM HHL. The quantity of each autoinducer used in these assays was 100–200 times higher than the respective detection limit (McClean et al., 1997Down ; Shaw et al., 1997Down ). After incubation for 6 h, the reaction mixture was adjusted to pH 5·0 with HCl and extracted with an equal volume of dichloromethane. The extract was dried under vacuum. The presence or absence of autoinducers was tested by TLC as described below.

Autoinducer detection and quantification by TLC.
For detection of AHLs produced by PAO1 carrying pME6000 or pME6863, respectively, 20 ml cell-free supernatants of NYB cultures containing 0·05% Triton X-100 were adjusted to pH 5·0 prior to extraction with 3 vols dichloromethane in a separating funnel. The solvent phase was treated with anhydrous MgSO4 to eliminate H2O and evaporated to dryness using a rotary evaporator. Depending on the optical density of the bacterial culture, the total extract was concentrated as follows: 1000-fold for OD600<0·5, 500-fold for OD600 0·5–1·4, 100-fold for OD600 1·5–2·1 and 50-fold for OD600>2·1. Samples from PAO1/pME6863, which contained very low amounts of BHL (and HHL), were concentrated up to 2000-fold. The presence of AHLs in these extracts was tested by C18 reverse-phase TLC, developed with methanol/water (60:40, v/v) and revealed by the indicator strains C. violaceum CV026 (McClean et al., 1997Down ) and Agrobacterium tumefaciens NT1(pZLR4) (Cha et al., 1998Down ). The amounts of OdDHL, BHL and HHL were estimated by comparison with three different dilutions of the respective standards.

Assays for exoproducts and ß-galactosidase activity.
HCN production by P. aeruginosa was quantified as described previously (Voisard et al., 1989Down ). Pyocyanin was extracted with chloroform from cell-free culture supernatants of P. aeruginosa grown in glycerol-alanine medium and assayed spectrophotometrically at 520 nm (Essar et al., 1990Down ). ß-Galactosidase specific activities were determined by the Miller method (Sambrook et al., 1989Down ).

Batch adhesion experiments.
Batch adhesion experiments were carried out by adapting a method described by Rijnaarts et al. (1993)Down . Glass vials (volume 14 ml) were filled to the top with degassed 0·1 M PBS (containing, per litre, 4·93 g NaCl, 0·29 g KH2PO4 and 1·19 g K2HPO4; pH 7·2) and sealed with rubber stoppers without leaving a head space. The rubber stoppers were pierced by a plastic-coated wire piece to which a PVC patch as the test surface was attached. Bacterial strains were grown at 37 °C to mid-exponential phase, harvested by centrifugation, and washed three times with 0·1 M PBS. Concentrated cell suspensions (100–300 µl) were gently injected through the stopper into the vials in order to obtain a final concentration of 4x107 bacteria ml-1. The vials were placed on a slanted rotating wheel (7 r.p.m.; amplitude 10 cm) to avoid sedimentation of bacteria and incubated at room temperature (21±3 °C). After 2 h incubation, the vials were opened and 70 ml 0·1 M PBS was added to each vial using a syringe. The tip of the needle was placed a few millimetres above the bottom of the vial and the flow was applied at a rate of 45 ml min-1. The flow was aimed away from the PVC patch to prevent detachment of bacteria due to shear stress. The excess liquid was allowed to flow out of the vials. This dilution procedure served to avoid the subsequent passage of the PVC patches through an interface between a dense bacterial suspension and air. It has been observed that such a passage can bias adhesion results because it leads to collection of bacteria that have accumulated in the liquid–air interface (Schäfer et al., 1998Down ). The PVC patches were carefully removed from the vials to prevent dewetting as much as possible, placed on a microscope slide and covered immediately with a coverslip. They were observed under a light microscope (magnification x1250; BX-60, Olympus Optical Co.) equipped with a digital camera (SenSys, Photometrics). The numbers of adhered cells were determined for six randomly chosen locations, corresponding to a total area of 3·56x104 µm2. Locations close to the edges of the surfaces were avoided, since they gave erratic results, possibly due to deviating hydraulic conditions during incubation. Each experiment was done in triplicate. Levels of adhesion were given as numbers of cells per square centimetre and calculated by averaging the values of the 18 adhesion locations obtained for the three PVC patches.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of bacterial rhizosphere isolates with autoinducer-degrading activity
A collection of 1300 bacterial strains obtained from rhizosphere soil of diverse geographical locations worldwide was screened for interference with AHL-dependent gene regulation, using a bioassay described in Methods. Among 16 candidates found, two isolates, A23 (from Ghana) and A24 (from Switzerland), showed BHL degrading activity. These isolates were taxonomically characterized as Bacillus spp. in that their 16S rRNA genes were more than 99% identical with those from members of the Bacillus cereus group. The remaining soil isolates excreted diffusible compounds interfering with violacein production and were not analysed further. Culture supernatants and crude extracts were prepared from strains A23 and A24 and incubated with 200 µM BHL for 6 h. The reaction mixtures were extracted and analysed by TLC for their BHL content. Whereas no degrading activity was detected in culture supernatants, cell extracts of both strains contained an activity degrading BHL to an undetectable level. HHL was also degraded under the same conditions (data not shown). By contrast, when the same experiments were performed with culture supernatants and crude extracts prepared from a Bacillus subtilis strain, no BHL-degrading activity was detected. These initial qualitative experiments show that the soil isolates A23 and A24 are able to degrade at least two different AHLs and that the respective enzymic activity is localized in the bacterial cytoplasm.

Cloning and sequence analysis of a gene from strain A24 responsible for autoinducer degradation
While this work was in progress, Dong et al. (2000)Down reported on a gene, aiiA, which encodes an AHL- degrading activity in Bacillus sp. 240B1. Based on the available sequence information, a potential aiiA homologue was PCR-amplified from strain A24 using the primers aiiA-7 (which adds a ribosome-binding site to the 5' end of the gene) and aiiA-8 (see Methods), and cloned into the vector pUK21, to give plasmid pME6860. The nucleotide sequence of the pME6860 insert was determined on both strands. To ensure that the DNA sequence analysed was free of mutations potentially introduced during the PCR reaction, the fragment was PCR amplified, cloned and sequenced in two more independent experiments. The nucleotide sequences obtained were identical in all three experiments and found to be highly similar to the coding sequence of the aiiA gene from strain 240B1. The deduced amino acid sequence of the AiiA homologue from strain A24 differed from the sequence of strain 240B1 in the following positions: Val73->Ile; Pro159->Ser; Pro185->Ser; Asn201->Glu; Ser210->Pro; Met225->Ile; Arg241->Lys. Autoinducer-degrading activity encoded by the cloned aiiA gene of strain A24 was confirmed with an in vivo degradation assay. E. coli DH5{alpha} expressing aiiA under the control of the constitutive lac promoter on pME6860 was able to degrade HHL whereas a control culture of DH5{alpha} was not.

To test whether a single or several aiiA genes were present in isolates A23 and A24, the 0·8 kb insert of pME6860 was used as a probe in a Southern blot against chromosomal DNA of A23 and A24. Hybridization under non-stringent conditions revealed single bands with six different restriction enzymes used. Both isolates gave identical patterns (data not shown). These results indicate that AHL-degrading activity is encoded in both bacterial isolates by a single aiiA gene.

Expression of aiiA in P. aeruginosa PAO1 decreases autoinducer concentrations
To study the effect of aiiA expression on autoinducer accumulation in P. aeruginosa PAO1, the aiiA gene of strain A24 was subcloned into the broad-host-range vector pME6000 under the control of the constitutive lac promoter. The resulting plasmid, pME6863, was mobilized, in parallel with the vector control (pME6000), from the E. coli donor strain S17-1 to P. aeruginosa PAO1. The influence of aiiA expression on the content of the two major autoinducers OdDHL and BHL of strain PAO1 was followed during growth. As illustrated in Fig. 1(a)Down, aiiA expression severely reduced the content of OdDHL at high cell densities but had little effect on the low OdDHL concentration during exponential growth. The accumulation of the autoinducer BHL, which is produced later and at higher cell densities than is OdDHL, was completely prevented by aiiA expression (<0·25 µM; Fig. 1bDown). Minor products of LasI (OHHL and OOHL) and of RhlI (HHL) were also affected. Whereas at high cell densities the presence of aiiA strongly reduced the content of OHHL and OOHL, aiiA expression completely blocked the accumulation of HHL during the entire growth cycle (data not shown).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. Autoinducer accumulation (circles) during growth (squares) of P. aeruginosa PAO1/pME6000 (open symbols) and PAO1/pME6863 (filled symbols) in parallel batch cultures. At time 0, 50 ml flasks containing 20 ml NYB and Triton X-100 (0·05%) were inoculated 1:100 and incubated at 37 °C with shaking for the time indicated. The OD600 of the cultures was measured and their supernatants were extracted and analysed by TLC for OdDHL (a) and BHL (b). The estimated error of this semiquantitative analysis was 20% (see Methods). The detection limit for BHL in this assay was 0·25 µM.

 
Autoinducer degradation reduces the production of several virulence factors
The effect of aiiA expression on quorum-sensing-dependent gene expression in PAO1 was evaluated. First, we measured the expression of the lasB gene, which encodes elastase, one of the virulence factors of P. aeruginosa (Blackwood et al., 1983Down ). Elastase expression is controlled predominantly by the LasR/OdDHL quorum sensing system (Passador et al., 1993Down ) and, to a lesser extent, also by the RhlR/BHL system (Brint & Ohman, 1995Down ; Pearson et al., 1997Down ). Expression of lasB was followed by monitoring ß-galactosidase activity of a translational lasB'–'lacZ fusion on plasmid pTS400; in a PAO1/pME6863 background, ß-galactosidase activity was significantly reduced compared to the activity measured in strain PAO1/pME6000 (Fig. 2aDown), indicating that aiiA strongly reduces the expression of elastase.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Effect of aiiA expression on quorum-sensing-dependent phenotypes (circles) during growth (squares) of P. aeruginosa PAO1/pME6000 (open symbols) and PAO1/pME6863 (filled symbols). ß-Galactosidase activity (in Miller units, MU) of a translational lasB'–'lacZ fusion carried by pTS400 (a) and of a translational rhlA'–'lacZ fusion carried by pECP60 (b), respectively, were determined from 20 ml NYB+Triton X-100 cultures inoculated 1:100 at time 0 and grown with shaking at 37 °C. For HCN determination (c), tightly capped 125 ml bottles containing 20 ml glycine minimal medium were inoculated to an OD600 of 0·002 and incubated at 37 °C with shaking. Samples (1 ml) were taken from the culture medium with a sterile syringe and assayed for their HCN content. For pyocyanin quantification (d), 50 ml flasks containing 20 ml glycerol-alanine medium were inoculated to an OD600 of 0·01 and incubated at 37 °C with shaking for the time indicated. The OD600 of the cultures was measured and their supernatants were extracted for pyocyanin quantification. The results shown in (a), (b), (c) and (d) represent means and standard deviations from three independent experiments.

 
We next evaluated the effect of aiiA on rhamnolipids, which have both haemolytic and biosurfactant properties (Johnson & Boese-Marrazzo, 1980Down ; Koch et al., 1989Down ). The biosynthesis of rhamnolipids requires the rhlAB-encoded rhamnosyltransferase, whose expression is controlled mainly by the RhlR/BHL autoinduction system and, to a lesser extent, by LasR/OdDHL (Brint & Ohman, 1995Down ; Pearson et al., 1997Down ). Expression of a translational rhlA'–'lacZ fusion carried by plasmid pECP60 was severely reduced in PAO1 expressing aiiA (Fig. 2bUp). These results were confirmed by semiquantitative rhamnolipid assays. Overnight cultures (10 µl) were spotted on agar plates containing CTAB and methylene blue and the radius of each clearing zone was measured after 48 h incubation. Rhamnolipid production in three independent experiments was significantly smaller in PAO1/pME6863 (radius of clearing 2·0±0·1 mm) than in PAO1/pME6000 (radius 3·5±0·1 mm).

aiiA expression also affected the production of HCN, which has been shown to be important for the virulence of P. aeruginosa towards Caenorhabditis elegans (Gallagher & Manoil, 2001Down ). The expression of the biosynthetic genes hcnABC requires both quorum sensing systems for maximal activity and is controlled additionally by the anaerobic activator ANR (Pessi & Haas, 2000Down ). HCN was produced by strain PAO1/pME6863 in only very small amounts (about 10 µM), whereas concentrations of about 100 µM were measured in cultures of PAO1/pME6000 (Fig. 2cUp). Thus, HCN production is severely hampered in PAO1 expressing aiiA.

Similar results were also obtained for the production of the blue pigment pyocyanin, which, together with the siderophore ferripyochelin and a reducing agent such as NADH, catalyses hydroxyl radical formation and thus contributes to tissue injury (Britigan, 1993Down ; Mahajan-Miklos et al., 1999Down ). The expression of the pyocyanin biosynthetic genes strongly depends on quorum sensing and involves both autoinduction systems (Whiteley et al., 1999Down ). Pyocyanin formation was followed during growth of PAO1/pME6863 and PAO1/pME6000, respectively. As shown in Fig. 2(d)Up, aiiA expression dramatically delayed and reduced the formation of this toxic compound.

Effect of aiiA expression on motility of P. aeruginosa
Expression of aiiA in strain PAO1/pME6863 strongly reduced swarming motility on 0·5% agar medium containing the attractant glucose (Fig. 3Down). P. aeruginosa requires flagella, type IV pili and rhamnolipid production for swarming motility (Köhler et al., 2000Down ). We therefore tested whether aiiA expression would affect surface translocation by swimming, which requires flagella, or twitching motility, which depends on type IV pili (Henrichsen, 1972Down ; Bradley, 1980Down ). On 0·3% agar plates, concentric rings with similar diameters (30±1 mm) were formed by PAO1/pME6000 and PAO1/pME6863, indicating that swimming motility was not altered. In a control experiment using the flaC negative mutant MT1508, no swimming motility was observed. Similarly, the zones of subsurface twitching were indistinguishable for both strains (27±6 mm for PAO1/pME6000 and 24±2 mm for PAO1/pME6863) on twitch plates whereas no twitch zone (<1 mm) was formed by the pilus-negative (pilA) mutant PT623 used as a control. From these experiments we conclude that decreased swarming motility in the strain expressing aiiA (PAO1/pME6863) probably results from the strongly diminished rhamnolipid production.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 3. Effect of aiiA expression on swarming motility of P. aeruginosa PAO1. Ten microlitres of overnight cultures of PAO1/pME6000 (left) and PAO1/pME6863 (right), respectively, were deposited on semisolid agar plates (see Methods) and incubated at 37 °C for 24 h.

 
aiiA expression does not reduce adhesion of P. aeruginosa
Flagella and type IV pili also promote bacterial adhesion to abiotic surfaces and, as a consequence, are involved in a first step of biofilm formation (O’Toole & Kolter, 1998Down ). We tested whether aiiA expression affected adhesion of strain PAO1/pME6863 to a polyvinylchloride (PVC) surface (see Methods). Adhesion efficiency of this strain (1·83±0·41x106 cells adhered cm-2; mean±SD) was similar to that measured with PAO1 (1·71±0·19x106 cells cm-2) or PAO1 carrying the vector control pME6000 (1·74±0·34x106 cells cm-2). Adherence of the pilA mutant PT623, by contrast, was strongly reduced in this assay (0·61±0·16x106 cells cm-2).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell–cell signalling molecules of the AHL type are produced by many Gram-negative bacteria, where these small molecules are involved in the regulation of a vast variety of bacterial phenotypes (Swift et al., 1999Down ). Since AHL-producing bacteria are ubiquitously present in natural environments, it can be expected that other organisms have evolved means to interfere with this type of communication, perhaps to defend themselves in their ecological niches. The seaweed Delisea pulchra, for example, produces several halogenated furanones, which are structurally related to AHLs (de Nys et al., 1993Down ). Some furanones have been shown to inhibit AHL-mediated gene expression by displacing the AHL signal from its receptor protein (Givskov et al., 1996Down ; Manefield et al., 1999Down , 2000Down ). Another demonstrated mechanism of interference is signal destruction. AHL degradation was demonstrated first in the Bacillus soil isolate 240B1, from which a gene was cloned (aiiA), encoding an acyl homoserine lactonase (Dong et al., 2000Down , 2001Down ). AHLs are also metabolized by a recently isolated bacterium, Variovorax paradoxus, which hydrolyses the amide bond of these signalling molecules and utilizes them as the sole source of energy and nitrogen (Leadbetter & Greenberg, 2000Down ).

In the present work, we have undertaken an independent search for bacteria which could interfere with the quorum sensing system of P. aeruginosa. Two Bacillus strains, A23 and A24, isolated from a Ghanaian and a Swiss soil, respectively, were able to degrade several AHLs. Despite the fact that the respective enzymic activity was localized in the bacterial cytoplasm, these strains were picked up in our screen. Apparently, effective intracellular degradation of the diffusible signal molecules HHL and BHL (produced by PAO1 in this assay) reduced the local signal concentration to an extent which resulted in a lower pigment production by the indicator strain.

We found that AHL-degrading activity was encoded in strain A24 by a gene whose DNA sequence was very similar to the previously described aiiA sequence (Dong et al., 2000Down ), and a related gene was shown to be present also in strain A23. The AiiA lactonase is assumed to be a metallohydrolase, whose conserved histidine and aspartate residues in two different sequence motifs are characteristic of zinc-binding enzymes. These residues, which are entirely conserved in the deduced amino acid sequence of the aiiA homologue of strain A24, are crucial for AHL-degrading activity (Dong et al., 2000Down ). Of the seven amino acid differences observed between strains A24 and 240B1, three changes concern proline residues, which could have an impact on the protein’s secondary structure. It will therefore be interesting to compare the substrate specificities of the two proteins.

Heterologous expression of aiiA in P. aeruginosa PAO1 completely prevented the accumulation of the RhlI-generated autoinducers BHL and HHL throughout growth and severely reduced the concentrations of the oxo-AHLs produced by LasI at high cell densities, whereas low levels of OdDHL formed in the exponential-growth phase escaped AiiA action (Fig. 1Up). As the two autoinduction circuits form a regulatory cascade in which the Rhl system depends on a functional Las system, degradation of the oxo-AHLs by AiiA will reduce the synthesis of BHL and HHL. Thus, the absence of these two autoinducers throughout growth of strain PAO1 carrying pME6863 probably results from reduced synthesis as well as from AiiA-dependent degradation. However, we cannot exclude the possibility that AiiA might degrade non-oxo-AHLs more efficiently than oxo-AHLs.

Our finding that degradation of cell–cell signalling molecules in strain PAO1 expressing the A24 aiiA gene severely affected the expression and production of elastase, rhamnolipids, HCN and pyocyanin (Fig. 2Up) is in general agreement with the established fact that both AHLs are crucial for virulence gene expression in P. aeruginosa (Pesci & Iglewski, 1999Down ). In the same vein, Dong et al. (2000Down , 2001Down ) have shown that expression of aiiA from Bacillus sp. 240B1 in the plant pathogen Erwinia carotovora reduces autoinducer accumulation, decreases extracellular pectolytic enzyme activities and attenuates pathogenicity on several plant species. Our work opens up the possibility to test the impact of signal destruction on the pathogenicity of P. aeruginosa in vivo.

Even though aiiA expression strongly reduced AHL content in strain PAO1, we did not observe any significant effect on twitching motility and on adherence to PVC. This result was somewhat unexpected as twitching motility of P. aeruginosa has been reported to be under quorum sensing control (Glessner et al., 1999Down ). Twitching motility depends on type IV pili (Bradley, 1980Down ), which are also required for adhesion of P. aeruginosa to eukaryotic cell surfaces (Ramphal et al., 1984Down , 1991Down ; Sato et al., 1988Down ; Tang et al., 1995Down ) and play a role in the early stages of biofilm formation on abiotic surfaces (O’Toole & Kolter, 1998Down ). Although pilin mRNA levels were not regulated by quorum sensing in strain PAO1 (Pearson et al., 1997Down ), surface piliation has been found to be strongly reduced in the BHL-negative (rhlI) mutant PDO100 (Glessner et al., 1999Down ). We have shown here that twitching motility was not affected when BHL was degraded below the limit of detection in strain PAO1 expressing aiiA on pME6863 (Fig. 2bUp). This strongly suggests that a functional quorum sensing system is not required for this type of surface translocation. Twitching defects were recently found to develop spontaneously in lasI and rhlI mutants (Whitchurch et al., 2001Down ) and it is therefore possible that a spontaneous mutation accounts for the reduced twitching motility in the rhlI mutant PDO100.

As illustrated by this study, enzymic AHL destruction by aiiA expression offers a possibility to examine the role of AHL-dependent quorum sensing without the need for mutant construction. AiiA-dependent signal destruction may therefore be a particularly useful tool to study the impact of quorum sensing in Gram-negative bacteria having multiple AHL regulatory circuits.


    ACKNOWLEDGEMENTS
 
We thank Paul Williams, Stephen Farrand, Thilo Köhler and Masataka Tsuda for strains, and SmithKline Beecham for a generous gift of carbenicillin. Joachim Frey and Peter Kuhnert are thanked for 16S rRNA sequencing protocols, and Kirsten Lejbølle, Eric Baehler and Catherine Gaille for strain identifications.

This work was supported by the Swiss National Foundation for Scientific Research (project 31-45896.95), the Bonizzi-Theler Stiftung, the Zyma and Herbette Foundations and the interdisciplinary research program Génie Biomédical.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Blackwood, L. L., Stone, R. M., Iglewski, B. H. & Pennington, J. E. (1983). Evaluation of Pseudomonas aeruginosa exotoxin A and elastase as virulence factors in acute lung infection. Infect Immun 39, 198-201.[Abstract/Free Full Text]

Bradley, D. E. (1980). A function of Pseudomonas aeruginosa PAO pili: twitching motility. Can J Microbiol 26, 146-154.[Medline]

Brint, J. M. & Ohman, D. E. (1995). Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. J Bacteriol 177, 7155-7163.[Abstract/Free Full Text]

Britigan, B. E. (1993). Role of reactive oxygen species in Pseudomonas infection. In Pseudomonas aeruginosa: the Opportunist. Pathogenesis and Disease, pp. 113–140. Edited by R. B. Fick, Jr. Boca Raton, FL: CRC Press.

Castric, P. A. (1975). Hydrogen cyanide, a secondary metabolite of Pseudomonas aeruginosa. Can J Microbiol 21, 613-618.[Medline]

Cha, C., Gao, P., Chen, Y.-C., Shaw, P. D. & Farrand, S. K. (1998). Production of acyl-homoserine lactone quorum-sensing signals by Gram-negative plant-associated bacteria. Mol Plant–Microbe Interact 11, 1119-1129.[Medline]

Chhabra, S. R., Stead, P., Bainton, N. J., Salmond, G. P. C., Stewart, G. S. A. B., Williams, P. & Bycroft, B. W. (1993). Autoregulation of carbapenem biosynthesis in Erwinia carotovora by analogues of N-(3-oxohexanoyl)-L-homoserine lactone. J Antibiot 46, 441-454.[Medline]

de Nys, R., Wright, A. D., König, G. M. & Sticher, O. (1993). New halogenated furanones from the marine alga Delisea pulchra. Tetrahedron 49, 11213-11220.

Del Sal, G., Manfioletti, G. & Schneider, C. (1988). A one-tube plasmid DNA mini-preparation suitable for sequencing. Nucleic Acids Res 16, 9878.[Free Full Text]

Dong, Y.-H., Xu, X.-Z. & Zhang, L.-H. (2000). AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of Erwinia carotovora. Proc Natl Acad Sci USA 97, 3526-3531.[Abstract/Free Full Text]

Dong, Y.-H., Wang, L.-H., Xu, J.-L., Zhang, H.-B., Zhang, X.-F. & Zhang, L.-H. (2001). Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine lactonase. Nature 411, 813-817.[Medline]

Essar, D. W., Eberly, L., Hadero, A. & Crawford, I. (1990). Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: interchangeability of the two anthranilate synthases and evolutionary implications. J Bacteriol 172, 884-900.[Abstract/Free Full Text]

Farinha, M. A. & Kropinski, A. M. (1990). High efficiency electroporation of Pseudomonas aeruginosa using frozen cell suspensions. FEMS Microbiol Lett 70, 221-226.

Frank, L. H. & DeMoss, R. D. (1959). On the biosynthesis of pyocyanine. J Bacteriol 77, 776-782.[Free Full Text]

Fuqua, C. & Greenberg, E. P. (1998). Self perception in bacteria: quorum sensing with acylated homoserine lactones. Curr Opin Microbiol 1, 183-189.[Medline]

Gallagher, L. A. & Manoil, C. (2001). Pseudomonas aeruginosa PAO1 kills Caenorhabditis elegans by cyanide poisoning. J Bacteriol 183, 6207-6214.[Abstract/Free Full Text]

Givskov, M., de Nys, R., Manefield, M., Gram, L., Maximilien, R., Eberl, L., Molin, S., Steinberg, P. D. & Kjelleberg, S. (1996). Eukaryotic interference with homoserine lactone-mediated prokaryotic signaling. J Bacteriol 178, 6618-6622.[Abstract/Free Full Text]

Glessner, A., Smith, R. S., Iglewski, B. H. & Robinson, J. B. (1999). Roles of Pseudomonas aeruginosa las and rhl quorum-sensing system in control of twitching motility. J Bacteriol 181, 1623-1629.[Abstract/Free Full Text]

Henrichsen, J. (1972). Bacterial surface translocation: a survey and a classification. Bacteriol Rev 36, 478-503.[Free Full Text]

Holloway, B. W. (1955). Genetic recombination in Pseudomonas aeruginosa. J Gen Microbiol 13, 572-581.[Abstract/Free Full Text]

Johnson, M. K. & Boese-Marrazzo, D. (1980). Production and properties of heat-stable extracellular hemolysin from Pseudomonas aeruginosa. Infect Immun 29, 1028-1033.[Abstract/Free Full Text]

Kline, T., Bowman, J., Iglewski, B. H., de Kievit, T., Kakai, Y. & Passador, L. (1999). Novel synthetic analogs of the Pseudomonas autoinducer. Bioorg Med Chem Lett 9, 3447-3452.[Medline]

Koch, A. K., Käppeli, O., Fiechter, A. & Reiser, J. (1989). Hydrocarbon assimilation and biosurfactant production in Pseudomonas aeruginosa mutants. J Bacteriol 173, 4212-4219.

Köhler, T., Curty, L. K., Barja, F., van Delden, C. & Pechère, J.-C. (2000). Swarming of Pseudomonas aeruginosa is dependent on cell-cell signaling and requires flagella and pili. J Bacteriol 182, 5990-5996.[Abstract/Free Full Text]

Kuo, A., Callahan, S. M. & Dunlap, P. V. (1996). Modulation of luminescence operon expression by N-octanoyl-L-homoserine lactone in ainS mutants of Vibrio fischeri. J Bacteriol 178, 971-976.[Abstract/Free Full Text]

Leadbetter, J. R. (2001). Quieting the raucous crowd. Nature 411, 748-749.[Medline]

Leadbetter, J. R. & Greenberg, E. P. (2000). Metabolism of acyl-homoserine lactone quorum-sensing signals by Variovorax paradoxus. J Bacteriol 182, 6921-6926.[Abstract/Free Full Text]

Mahajan-Miklos, S., Tan, M.-W., Rahme, L. G. & Ausubel, F. M. (1999). Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa–Caenorhabditis elegans pathogenesis model. Cell 96, 47-56.[Medline]

Manefield, M., de Nys, R., Kumar, N., Read, R., Givskov, M., Steinberg, P. & Kjelleberg, S. (1999). Evidence that halogenated furanones from Delisea pulchra inhibit acylated homoserine lactone (AHL)-mediated gene expression by displacing the AHL signal from its receptor protein. Microbiology 145, 283-291.[Abstract/Free Full Text]

Manefield, M., Harris, L., Rice, S. A., de Nys, R. & Kjelleberg, S. (2000). Inhibition of luminescence and virulence in the tiger prawn (Penaeus monodon) pathogen Vibrio harveyi by intercellular signal antagonists. Appl Environ Microbiol 66, 2079-2084.[Abstract/Free Full Text]

Maurhofer, M., Reimmann, C., Schmidli-Sacherer, P., Heeb, S., Haas, D. & Défago, G. (1998). Salicylic acid biosynthetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of systemic resistance in tobacco against tobacco necrosis virus. Phytopathology 88, 687-684.

McClean, K. H., Winson, M. K., Fish, L. & 9 other authors (1997). Quorum sensing and Chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143, 3703–3711.[Abstract/Free Full Text]

Ochsner, U. A. & Reiser, J. (1995). Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 92, 6424-6428.[Abstract/Free Full Text]

O’Toole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295-304.[Medline]

Passador, L., Cook, J. M., Gambello, M. J., Rust, L. & Iglewski, B. H. (1993). Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science 260, 1127-1130.[Abstract/Free Full Text]

Passador, L., Tucker, K. D., Guertin, K. R., Journet, M. P., Kende, A. S. & Iglewski, B. H. (1996). Functional analysis of the Pseudomonas aeruginosa autoinducer PAI. J Bacteriol 178, 5995-6000.[Abstract/Free Full Text]

Pearson, J. P., Gray, K. M., Passador, L., Tucker, K. D., Eberhard, A., Iglewski, B. H. & Greenberg, E. P. (1994). Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc Natl Acad Sci U S A 91, 197-201.[Abstract/Free Full Text]

Pearson, J. P., Pesci, E. C. & Iglewski, B. (1997). Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. J Bacteriol 179, 5756-5767.[Abstract/Free Full Text]

Pearson, J. P., Feldman, M., Iglewski, B. H. & Prince, A. (2000). Pseudomonas aeruginosa cell-to-cell signaling is required for virulence in a model of acute pulmonary infection. Infect Immun 68, 4331-4334.[Abstract/Free Full Text]

Pesci, E. C. & Iglewski, B. H. (1999). Quorum sensing in Pseudomonas aeruginosa. In Cell–Cell Signaling in Bacteria , pp. 147-155. Edited by G. M. Dunny & S. C. Winans. Washington, DC:American Society for Microbiology.

Pesci, E. C., Pearson, J. P., Seed, P. C. & Iglewsi, B. H. (1997). Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179, 3127-3132.[Abstract/Free Full Text]

Pessi, G. & Haas, D. (2000). Transcriptional control of the hydrogen cyanide biosynthetic genes hcnABC by the anaerobic regulator ANR and the quorum-sensing regulators LasR and RhlR in Pseudomonas aeruginosa. J Bacteriol 182, 6940-6949.[Abstract/Free Full Text]

Ramphal, R., Sadoff, J. C., Pyle, M. & Silipigni, J. D. (1984). Role of pili in the adherence of Pseudomonas aeruginosa to injured tracheal epithelium. Infect Immun 44, 38-40.[Abstract/Free Full Text]

Ramphal, R., Koo, L., Isimoto, K. S., Totten, P., Lara, J. C. & Lory, S. (1991). Adhesion of Pseudomonas aeruginosa pilin-deficient mutants to mucin. Infect Immun 59, 1307-1311.[Abstract/Free Full Text]

Rashid, M. H. & Kornberg, A. (2000). Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 97, 4885-4890.[Abstract/Free Full Text]

Rijnaarts, H. H. M., Norde, W., Bouwer, E. J., Lyklema, J. & Zehnder, A. J. B. (1993). Bacterial adhesion under static and dynamic conditions. Appl Environ Microbiol 59, 3255-3265.[Abstract/Free Full Text]

Rumbaugh, K. R., Griswold, J. A. & Hamood, A. N. (2000). The role of quorum sensing in the in vivo virulence of Pseudomonas aeruginosa. Microbes Infect 2, 1721-1731.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sato, H., Okinaga, K. & Saito, H. (1988). Role of pili in the pathogenesis of Pseudomonas aeruginosa burn infections. Microbiol Immunol 32, 131-139.[Medline]

Schäfer, A., Harms, H. & Zehnder, A. J. B. (1998). Bacterial accumulation at the air-water interface. Environ Sci Technol 32, 3704-3712.

Shaw, P. D., Ping, G., Daly, S. L., Cha, C., Cronan, J. E.Jr, Rinehart, K. L. & Farrand, S. K. (1997). Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography. Proc Natl Acad Sci USA 94, 6036-6041.[Abstract/Free Full Text]

Siegmund, I. & Wagner, F. (1991). New method for detecting rhamnolipids excreted by Pseudomonas species during growth on mineral agar. Biotechnol Tech 5, 265-268.

Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range mobilization system for in vitro genetic engineering: transposon mutagenesis in Gram negative bacteria. Biotechnology 1, 784-790.

Stanisich, V. A. & Holloway, B. W. (1972). A mutant sex factor of Pseudomonas aeruginosa. Genet Res 19, 91-108.[Medline]

Swift, S., Williams, P. & Stewart, G. S. A. B. (1999). N-Acylhomoserine lactones and quorum sensing in proteobacteria. In Cell–Cell Signaling In Bacteria , pp. 291-313. Edited by G. M. Dunny & S. C. Winans. Washington, DC:American Society for Microbiology.

Tang, H., Kays, M. & Prince, A. (1995). Role of Pseudomonas aeruginosa pili in acute pulmonary infection. Infect Immun 63, 1278-1285.[Abstract/Free Full Text]

Vieira, J. & Messing, J. (1991). New pUC-derived cloning vectors with different selectable markers and DNA replication origins. Gene 100, 189-194.[Medline]

Voisard, C., Keel, C., Haas, D. & Défago, G. (1989). Cyanide production by Pseudomonas fluorescens helps suppress back root rot of tobacco under gnotobiotic conditions. EMBO J 8, 351-358.[Medline]

Whitchurch, C. B., Beatson, S. A. Young, M. D. & 7 other authors (2001). The coordinate regulation of twitching motility and other virulence factors in Pseudomonas aeruginosa. Pseudomonas Meeting 2001, Brussels, Abstract no. 7.

Whiteley, M., Lee, K. M. & Greenberg, E. P. (1999). Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc Natl Acad Sci USA 96, 13904-13909.[Abstract/Free Full Text]

Williams, P., Camara, M., Hardman, A. & 7 other authors (2000). Quorum sensing and the population-dependent control of virulence. Philos Trans R Soc Lond Ser B Biol Sci 355, 667–680.[Medline]

Winson, M. K., Camara, M., Latifi, A. & 10 other authors (1995). Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. Proc Natl Acad Sci USA 92, 9427–9431.

Zhu, J., Beaber, J. W., Moré, M. I., Fuqua, C., Eberhard, A. & Winans, A. (1998). Analogs of the autoinducer 3-oxooctanoyl-homoserine lactone strongly inhibit activity of the TraR protein of Agrobacterium tumefaciens. J Bacteriol 180, 5398-5405.[Abstract/Free Full Text]

Received 2 October 2001; revised 17 December 2001; accepted 19 December 2001.


This article has been cited by other articles:


Home page
MicrobiologyHome page
S. Salvetti, F. Celandroni, M. Ceragioli, S. Senesi, and E. Ghelardi
Identification of non-flagellar genes involved in swarm cell differentiation using a Bacillus thuringiensis mini-Tn10 mutant library
Microbiology, March 1, 2009; 155(3): 912 - 921.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
C. Schipper, C. Hornung, P. Bijtenhoorn, M. Quitschau, S. Grond, and W. R. Streit
Metagenome-Derived Clones Encoding Two Novel Lactonase Family Proteins Involved in Biofilm Inhibition in Pseudomonas aeruginosa
Appl. Envir. Microbiol., January 1, 2009; 75(1): 224 - 233.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Uroz, P. M. Oger, E. Chapelle, M.-T. Adeline, D. Faure, and Y. Dessaux
A Rhodococcus qsdA-Encoded Enzyme Defines a Novel Class of Large-Spectrum Quorum-Quenching Lactonases
Appl. Envir. Microbiol., March 1, 2008; 74(5): 1357 - 1366.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. B. B. M. Hussain, H.-B. Zhang, J.-L. Xu, Q. Liu, Z. Jiang, and L.-H. Zhang
The Acyl-Homoserine Lactone-Type Quorum-Sensing System Modulates Cell Motility and Virulence of Erwinia chrysanthemi pv. zeae
J. Bacteriol., February 1, 2008; 190(3): 1045 - 1053.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
Y.-H. Dong, L.-H. Wang, and L.-H. Zhang
Quorum-quenching microbial infections: mechanisms and implications
Phil Trans R Soc B, July 29, 2007; 362(1483): 1201 - 1211.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. Wopperer, S. T. Cardona, B. Huber, C. A. Jacobi, M. A. Valvano, and L. Eberl
A Quorum-Quenching Approach To Investigate the Conservation of Quorum-Sensing-Regulated Functions within the Burkholderia cepacia Complex
Appl. Envir. Microbiol., February 1, 2006; 72(2): 1579 - 1587.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
W. Kim and M. G. Surette
Coordinated Regulation of Two Independent Cell-Cell Signaling Systems and Swarmer Differentiation in Salmonella enterica Serovar Typhimurium
J. Bacteriol., January 15, 2006; 188(2): 431 - 440.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Gao, H. Chen, A. Eberhard, M. R. Gronquist, J. B. Robinson, B. G. Rolfe, and W. D. Bauer
sinI- and expR-Dependent Quorum Sensing in Sinorhizobium meliloti
J. Bacteriol., December 1, 2005; 187(23): 7931 - 7944.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Uroz, S. R. Chhabra, M. Camara, P. Williams, P. Oger, and Y. Dessaux
N-Acylhomoserine lactone quorum-sensing molecules are modified and degraded by Rhodococcus erythropolis W2 by both amidolytic and novel oxidoreductase activities
Microbiology, October 1, 2005; 151(10): 3313 - 3322.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S.-Y. Park, H.-O. Kang, H.-S. Jang, J.-K. Lee, B.-T. Koo, and D.-Y. Yum
Identification of Extracellular N-Acylhomoserine Lactone Acylase from a Streptomyces sp. and Its Application to Quorum Quenching
Appl. Envir. Microbiol., May 1, 2005; 71(5): 2632 - 2641.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
L. Molina, F. Rezzonico, G. Defago, and B. Duffy
Autoinduction in Erwinia amylovora: Evidence of an Acyl-Homoserine Lactone Signal in the Fire Blight Pathogen
J. Bacteriol., May 1, 2005; 187(9): 3206 - 3213.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
Y.-J. Wang and J. R. Leadbetter
Rapid Acyl-Homoserine Lactone Quorum Signal Biodegradation in Diverse Soils
Appl. Envir. Microbiol., March 1, 2005; 71(3): 1291 - 1299.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
R. L. Ulrich
Quorum Quenching: Enzymatic Disruption of N-Acylhomoserine Lactone-Mediated Bacterial Communication in Burkholderia thailandensis
Appl. Envir. Microbiol., October 1, 2004; 70(10): 6173 - 6180.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
R. L. Ulrich, H. B. Hines, N. Parthasarathy, and J. A. Jeddeloh
Mutational Analysis and Biochemical Characterization of the Burkholderia thailandensis DW503 Quorum-Sensing Network
J. Bacteriol., July 1, 2004; 186(13): 4350 - 4360.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
D. M. Roche, J. T. Byers, D. S. Smith, F. G. Glansdorp, D. R. Spring, and M. Welch
Communications blackout? Do N-acylhomoserine-lactone-degrading enzymes have any role in quorum sensing?
Microbiology, July 1, 2004; 150(7): 2023 - 2028.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. Heurlier, F. Williams, S. Heeb, C. Dormond, G. Pessi, D. Singer, M. Camara, P. Williams, and D. Haas
Positive Control of Swarming, Rhamnolipid Synthesis, and Lipase Production by the Posttranscriptional RsmA/RsmZ System in Pseudomonas aeruginosa PAO1
J. Bacteriol., May 15, 2004; 186(10): 2936 - 2945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-H. Wang, L.-X. Weng, Y.-H. Dong, and L.-H. Zhang
Specificity and Enzyme Kinetics of the Quorum-quenching N-Acyl Homoserine Lactone Lactonase (AHL-lactonase)
J. Biol. Chem., April 2, 2004; 279(14): 13645 - 13651.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Rothfork, S. Dessus-Babus, W. J. B. Van Wamel, A. L. Cheung, and H. D. Gresham
Fibrinogen Depletion Attenuates Staphyloccocus aureus Infection by Preventing Density-Dependent Virulence Gene Up-Regulation
J. Immunol., November 15, 2003; 171(10): 5389 - 5395.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. J. Huang, J.-I. Han, L.-H. Zhang, and J. R. Leadbetter
Utilization of Acyl-Homoserine Lactone Quorum Signals for Growth by a Soil Pseudomonad and Pseudomonas aeruginosa PAO1
Appl. Envir. Microbiol., October 1, 2003; 69(10): 5941 - 5949.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Uroz, C. D'Angelo-Picard, A. Carlier, M. Elasri, C. Sicot, A. Petit, P. Oger, D. Faure, and Y. Dessaux
Novel bacteria degrading N-acylhomoserine lactones and their use as quenchers of quorum-sensing-regulated functions of plant-pathogenic bacteria
Microbiology, August 1, 2003; 149(8): 1981 - 1989.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. A. Whistler and L. S. Pierson III
Repression of Phenazine Antibiotic Production in Pseudomonas aureofaciens Strain 30-84 by RpeA
J. Bacteriol., July 1, 2003; 185(13): 3718 - 3725.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
A. S. Nouwens, S. A. Beatson, C. B. Whitchurch, B. J. Walsh, H. P. Schweizer, J. S. Mattick, and S. J. Cordwell
Proteome analysis of extracellular proteins regulated by the las and rhl quorum sensing systems in Pseudomonas aeruginosa PAO1
Microbiology, May 1, 2003; 149(5): 1311 - 1322.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Flagan, W.-K. Ching, and J. R. Leadbetter
Arthrobacter Strain VAI-A Utilizes Acyl-Homoserine Lactone Inactivation Products and Stimulates Quorum Signal Biodegradation by Variovorax paradoxus
Appl. Envir. Microbiol., February 1, 2003; 69(2): 909 - 916.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Aendekerk, B. Ghysels, P. Cornelis, and C. Baysse
Characterization of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium
Microbiology, August 1, 2002; 148(8): 2371 - 2381.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reimmann, C.
Right arrow Articles by Haas, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reimmann, C.
Right arrow Articles by Haas, D.
Agricola
Right arrow Articles by Reimmann, C.
Right arrow Articles by Haas, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2002 Society for General Microbiology.