|
|
||||||||
Research Paper |
Departments of Molecular Genetics and Microbiology, Pharmacology and Cancer Biology, and Medicine, and the Howard Hughes Medical Institute, Duke University Medical Center, Research Drive, Durham, NC 27710, USA1
Author for correspondence: Joseph Heitman. Tel: +1 919 684 2824. Fax: +1 919 684 5458. e-mail: heitm001{at}duke.edu
| ABSTRACT |
|---|
|
|
|---|
Keywords: gene disruption, PCR overlap, Cryptococcus neoformans
Abbreviations: MAP, mitogen-acitvated protein
| INTRODUCTION |
|---|
|
|
|---|
In addition to being an important cause of disease in immunocompromised patients, C. neoformans is an excellent model of fungal pathogenesis. Several well-defined virulence factors include the polysaccharide capsule (which promotes intracellular survival in macrophages), the pigment melanin (which prevents oxidation by macrophages), the production of the enzymes urease and phospholipase B, and the ability to grow at 37 °C (Alspaugh et al., 2000a
; Casadevall & Perfect, 1998
; Chen et al., 2000
; Cox et al., 2000
, 2001
; Cruz et al., 2000
; Fox et al., 2001
; Kwon-Chung & Bennett, 1992
; Odom et al., 1997
). Several animal models have been developed, including a mouse tail-vein injection model, rat and mouse inhalation models, and a rabbit meningitis model (Goldman et al., 1994
; Kwon-Chung et al., 1982
; Perfect et al., 1980
). Importantly, C. neoformans is genetically tractable, with a well-characterized sexual cycle involving mating between two haploid mating types, MATa and MAT
(Alspaugh et al., 2000b
; Kwon-Chung, 1975
, 1976
). Efficient transformation and gene-disruption protocols have been developed along with auxotrophic and dominant selectable markers and overexpression plasmids (Davidson et al., 2000
; Edman & Kwon-Chung, 1990
; Hua et al., 2000
; McDade & Cox, 2001
; Sudarshan et al., 1999
; Toffaletti et al., 1993
). Furthermore, genetic analysis has been facilitated by the recent characterization of a stable diploid state, which allows identification and analysis of essential genes (Sia et al., 2000
). Finally, the entire genome sequence is nearing completion for the serotype D strain JEC21, and a sequencing project has been initiated for the clinical serotype A isolate H99 (Stanford, TIGR, UBC, Duke, Whitehead; reviewed by Heitman et al., 1999
). These advances will allow extensive comparative genomics experimentation between C. neoformans strains and other fungal genomes.
The efficient use of the complete genome sequence will require more rapid gene-function testing, a process that is limited by tedious construction of targeting alleles by cloning. PCR-generated targeting alleles have been employed for Saccharomyces cerevisiae and for the human pathogen Candida albicans, which has overcome the necessity for cloning and has allowed more high-throughput genetic analysis (Baudin et al., 1993
; Eberhardt & Hohmann, 1995
; Lorenz et al., 1995
; Wach, 1996
; Wach et al., 1994
; Wilson et al., 1999
). However, efficient homologous recombination in C. neoformans requires larger regions of homology, which has prevented the application of similar PCR-based strategies.
Here we present a modified application of a technique called PCR overlap to generate targeting alleles with larger regions of homology (Ho et al., 1989
; Horton et al., 1989
). This technique can be used in any system where homologous recombination requires longer regions than those that can be incorporated into synthetic oligonucleotides, and will effectively eliminate the time-consuming process of searching for convenient restriction sites and cloning targeting alleles.
| METHODS |
|---|
|
|
|---|
mutant strain, first the
4·5 kb STE11
locus was amplified from MAT
genomic DNA using primers JOHE5391 (GCTCGTTCTCCCCTGTAC) and JOHE5392 (CTGCCGACGCCGTGTAAT) (R. C. Davidson and others, unpublished). The ste11
::URA5 disruption allele was constructed using PCR overlap (outlined in Fig. 1
gene was amplified with primers JOHE5391 (primer 1) (GCTCGTTCTCCCCTGTAC) and JOHE5306 (primer 3) (GGTCGAGCAACTTCCTCATTTACAGGGCTGTCCTG), the 3' end of the STE11
gene with primers JOHE5307 (primer 4) (CCACCTCCTGGAGGCAAGACAGGGATATCAAAGGCG) and JOHE5392 (primer 6) (CTGCCGACGCCGTGTAAT), and the URA5 gene with primers JOHE5305 (primer 2) (CAGGACAGCCCTGTAAATGAGCGAAGTTGCTCGAAC) and JOHE5308 (primer 5) (CGCCTTTGATATCCCTGTCTTGCCTCCAGGAGGTGG). The bold text represents the fragment of the oligo corresponding to the selectable marker. The amplified products were run on a 0·6% agarose gel and extracted together using the Qiaquik column method (Qiagen). Primers JOHE5391 (no. 1) and JOHE5392 (no. 6) were then used to overlap the three products to yield the 4·2 kb ste11
::URA5 disruption allele. The PCR product was gel-purified, extracted and directly introduced into the serotype D ura5 strain JEC43 by biolistic transformation.
|
::URA5/TOR1 mutant strain was generated by PCR overlap using six primers as outlined (Fig. 1
::URA5 allele. The PCR product was gel-purified, extracted and transformed directly into the C. neoformans serotype D diploid strain RAS008 by biolistic transformation.
The mpk1
::URA5 mutant strain was generated by PCR overlap using six primers as outlined (Fig. 1
). The 5' end of the MPK1 gene was amplified with primers JOHE7288 (no. 1) (ACTAGGCGTGCCATTGTTTAC) and JOHE7418 (no. 3) (GGTCGAGCAACTTCGCTCAGGATTGCGTGCCGGACAGTG), the 3' of MPK1 with primers JOHE7419 (no. 4) (CCACCTCCTGGAGGCAAGCACGATGATTATTAGTCTTGC) and JOHE7289 (no. 6) (GCGGACTGGGCAGGAGAAGC), and the URA5 selectable marker with primers JOHE7417 (no. 2) (CACTGTCCGGCACGCAATCCTGAGCGAAGTTGCTCGACC) and JOHE7420 (no. 5) (GCAAGACTAATAATCATCGTGCTTGCCTCCAGGAGGTGG). The three amplified products were run on a 0·6% agarose gel and extracted together using the Qiaquik column method (Qiagen) and were used as templates for the overlap reaction. Primers JOHE7288 (no. 1) and JOHE7289 (no. 6) were used to overlap the three first-round products to yield the mpk1
::URA5 disruption allele. This amplified product was gel-purified, extracted and directly transformed into the serotype D ura5 strain JEC43 by biolistic transformation.
Overlap primer design.
Overlap oligos were approximately 3540 bp in length. Primers were obtained from Integrated DNA Technology and were not PAGE-purified. In the STE11
and MPK1 deletions, the portion of the oligo corresponding to the selectable marker flanked the C. neoformans URA5 gene. In the TOR1 disruption, the portion of the oligo corresponding to the selectable marker was designed to amplify from a plasmid containing URA5. This was done so that any selectable marker cloned into the vector could be easily inserted into the disruption cassette.
The sequence of primer 3 was designed to be completely complementary to the sequence of primer 2, and the sequence of primer 4 was complementary to the sequence of primer 5 as outlined in Fig. 1
. This strategy generates fragments with approximately 40 bp of overlap for the final PCR reaction. The 3' ends of primer 3 and primer 4 were designed so that the melting temperature of the oligo fragment corresponding to the targeted gene was similar to the melting temperatures of primers 1 and 6, respectively.
Transformations.
Biolistic transformations were performed by the method previously described by Toffaletti & Perfect (1994)
using a Bio-Rad model PDS-1000/He biolistic particle delivery system. Transformants were selected on defined medium (Sherman, 1991
) lacking uracil and containing 1 M sorbitol as an osmotic stabilizer.
PCR amplification.
All PCR amplifications were performed using a Perkin-Elmer Applied Biosystems 9600 thermocycler with Extaq polymerase (Takara). The initial amplification reactions consisted of 35 cycles of 1030 s at 95 °C, 1030 s at 55 °C and 1 min kb1 at 72 °C with an initial denaturation of 2 min at 95 °C and a final extension of 5 min at 72 °C. Importantly, denaturation and annealing times were limited to 1015 s during the final overlap amplification, which reproducibly increases the yield of specific overlap products.
The first-round PCR of the STE11
disruption consisted of an initial denaturation of 2 min at 95 °C, followed by 35 cycles of 15 s at 95 °C, 15 s at 53 °C and 1·5 min at 72 °C, and was completed with a final extension of 5 min at 72 °C. The final round of PCR for the STE11
gene disruption consisted of an initial denaturation of 2 min at 95 °C, followed by 35 cycles of 15 s at 95 °C, 15 s at 53 °C and 4·5 min at 72 °C, and concluded with a final extension of 5 min at 72 °C.
In the final PCR, the three PCR products generated in the first PCR were added in roughly equimolar amounts. The quantity of these products yielding the most efficient overlap in the final PCR varied between constructs, so a gradient of first-round products was added to the reaction (generally 1 ng, 10 ng and 50 ng total template) to obtain the most efficient overlap PCR. The PCR samples were visualized using standard DNA electrophoretic techniques (Sambrook et al., 1989
).
Southern blot analysis.
Genomic DNA was isolated from JEC21 and JEC20 wild-type, ste11
and mpk1 mutant strains by the method of Pitkin et al. (1996)
. Twenty micrograms genomic DNA was digested with the appropriate enzymes and electrophoresed on a 0·8% TBE agarose gel. Transfer, hybridization and autoradiography were performed as described by Sambrook et al. (1989)
. Fragments of the STE11
and MPK1 genomic ORFs were used as probes for Southern blot hybridization, using [
-32P]dCTP (Amersham) and the Prime-It II random primed labelling kit (Stratagene).
| RESULTS |
|---|
|
|
|---|
gene
gene encodes a mating type-specific MEK kinase homologue that is related to the Ste11 kinase of S. cerevisiae, a component of the pheromone-sensing mitogen-acitvated protein (MAP) kinase cascade. The C. neoformans STE11
gene was identified by its location in the MAT
locus adjacent to the first pheromone gene discovered in C. neoformans by Moore & Edman (Clarke et al., 2001
mutant strain by homologous integration of a disruption allele. We used PCR to generate a ste11
::URA5 disruption allele. Six oligonucleotide primers (numbered 16) were directed against the STE11
ORF and the URA5 selectable marker (strategy outlined in Fig. 1
gene, the URA5 selectable marker, and the 3' end of the STE11
gene (Fig. 2a
gene (Fig. 2b
ura5 strain of C. neoformans (JEC43) by biolistic transformation, and Ura+ colonies were selected. Screening by PCR amplification revealed three mutant strains out of 48 independent Ura+ colonies (6·3%) (Table 1
mutant strains exhibited the same level of sterility in a cross with a wild-type MATa strain, and this was consistent with results obtained with mutants lacking other members of the MAP kinase cascade (R. C. Davidson & J. Héitman, unpublished).
|
|
1 kb of TOR1 gene sequence on each side (Fig. 3b
|
::URA5 PCR-generated disruption allele, and Ura+ transformants were selected. Using PCR amplification and digestion with the SalI restriction enzyme, which specifically cleaves the mutant allele but not the wild-type at a pair of recognition sites present in the URA5 gene (Fig. 3c
Targeted disruption of the MPK1 gene
The gene encoding the MAP kinase homologue Mpk1 was identified by comparative genomics using the Stanford C. neoformans genome sequence database (P. R. Kraus and others, unpublished). A complete sequence of the putative gene was assembled using the Stanford sequence as well as that from the TIGR C. neoformans sequencing project. To assess the function of this MAP kinase homologue, we generated an allele for gene disruption using PCR overlap. As described above, primers were directed against the 5' and 3' flanking regions of the MPK1 gene and the URA5 selectable marker, and three products were amplified (Fig. 4a
, b
, lanes 13). These products were overlapped into a single product with the portions of the MPK1 gene flanking URA5 (Fig. 4b
, lane 4). The mpk1
::URA5 PCR-generated disruption allele was transformed into a serotype D ura5 strain of C. neoformans (JEC43), and Ura+ colonies were selected. Two mpk1
::URA5 mutant strains were identified by PCR out of 20 screened (10%) (Table 1
), which was confirmed by a Southern blot (Fig. 4c
).
|
| DISCUSSION |
|---|
|
|
|---|
We describe a modified use of the PCR overlap technique originally described by Ho et al. (1989)
and Horton et al. (1989)
to generate disruption constructs without the need for cloning. This method can be used to generate both partial and complete deletions of the targeted genes ORF. Using this method, we have disrupted three genes, STE11
(encoding a MAP kinase kinase kinase homologue), TOR1 (encoding a Tor kinase homologue) and MPK1 (encoding a MAP kinase homologue), at efficiencies consistent with previous studies (Davidson et al., 2000
). We also report the disruption of 11 other genes using the same method and a variety of recipient strains, including the recently described serotype D diploids (Sia et al., 2000
). Moreover, both the auxotrophic URA5 and dominant NAT1 selectable markers were used, which allows generation of double mutant strains or the use of prototrophic strains. In all cases, the efficiency of targeted integration was in the range 210% or higher, consistent with previous studies using biolistic transformation in C. neoformans (Alspaugh et al., 1997
; Davidson et al., 2000
; Toffaletti et al., 1993
; Wang et al., 2000
). These findings indicate that generation of constructs by two rounds of PCR does not seem to inhibit homologous recombination significantly.
Additional screening tests can make the PCR-disruption method even more efficient. Jennifer Lodge and coworkers recently found that a significant proportion of initial transformants are unstable, in accord with earlier results (Edman & Kwon-Chung, 1990
), and by implementing an initial screening step for stable transformants they found that the efficiency of homologous targeting can be increased (Nelson et al., 2002
). We have confirmed these observations in the background of our PCR-based approach to gene disruption and found that approximately 33% of transformants are stable. In the case of the gno1::NAT1 disruption in strain JEC34, the frequency of homologous integration was increased from 10 to 23%, and, in the case of the gno1::NAT1 disruption in strain H99, from 28 to 77%, by first screening for stable transformants. Thus, implementing this important advance of Lodge and coworkers, together with the PCR overlap approaches described here, should result in even more efficacious gene-disruption frequencies.
Implementation of this PCR-based gene-disruption technique will preclude the generation of mutant strains from being the rate-limiting step in performing genetic analyses. The recently reported RNAi and antisense methods for disrupting gene function and the ability to generate panels of strains containing randomly inserted signature tags should also aid in accelerating the analysis of gene function (Gorlach et al., 2002
; Liu et al., 2002
; Nelson et al., 2001
). However, the PCR-based method proposed here has the potential to be applied to situations in which the ability to alter targeted genomic sequence is necessary. For instance, larger deletions that span multiple genes can be performed using this method. In addition to disruption mutations, this technique can also be applied to the efficient generation of other targeted insertions, including site-directed mutations and the insertion of regulatable promoters or epitope tags.
In conclusion, we show that this PCR-based gene-disruption approach is generally applicable for different genes using a variety of strains and genetic markers, and this should allow more efficient analysis of gene function in cases where the complete sequence is available.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
subunit GPA1 and cAMP. Genes Dev 11, 3206-3217.Alspaugh, J. A., Cavallo, L. M., Perfect, J. R. & Heitman, J. (2000a). RAS1 regulates filamentation, mating and growth at high temperature of Cryptococcus neoformans. Mol Microbiol 36, 352-365.[Medline]
Alspaugh, J. A., Davidson, R. C. & Heitman, J. (2000b). Morphogenesis of Cryptococcus neoformans. In Dimorphism in Human Pathogenic and Apathogenic Yeasts , pp. 217-238. Edited by J. F. Ernst & A. Schmidt. Basel:Karger.
Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F. & Cullin, C. (1993). A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21, 3329-3330.
Casadevall, A. & Perfect, J. R. (1998). Cryptococcus neoformans. Washington: ASM Press.
Chen, S. C., Wright, L. C., Golding, J. C. & Sorrell, T. C. (2000). Purification and characterization of secretory phospholipase B, lysophospholipase and lysophospholipase/transacylase from a virulent strain of the pathogenic fungus Cryptococcus neoformans. Biochem J 347, 431-439.[Medline]
Clarke, D. L., Woodlee, G. L., McClelland, C. M., Seymour, T. S. & Wickes, B. L. (2001). The Cryptococcus neoformans STE11
gene is similar to other fungal mitogen-activated protein kinase kinase kinase (MAPKKK) genes but is mating type specific. Mol Microbiol 40, 200-213.[Medline]
Cox, G. M., Mukherjee, J., Cole, G. T., Casadevall, A. & Perfect, J. R. (2000). Urease as a virulence factor in experimental cryptococcosis. Infect Immun 68, 443-448.
Cox, G. M., McDade, H. C., Chen, S. C. A. & 8 other authors (2001). Extracellular phospholipase activity is a virulence factor for Cryptococcus neoformans. Mol Microbiol 39, 166175.[Medline]
Cruz, M. C., Cavallo, L. M., Görlach, J. M., Cox, G., Perfect, J. R., Cardenas, M. E. & Heitman, J. (1999). Rapamycin antifungal action is mediated via conserved complexes with FKBP12 and TOR kinase homologs in Cryptococcus neoformans. Mol Cell Biol 19, 4101-4112.
Cruz, M. C., Sia, R. A. L., Olson, M., Cox, G. M. & Heitman, J. (2000). Comparison of the roles of calcineurin in physiology and virulence in serotype D and serotype A strains of Cryptococcus neoformans. Infect Immun 68, 982-985.
Davidson, R. C., Cruz, M. C., Sia, R. A. L., Allen, B. M., Alspaugh, J. A. & Heitman, J. (2000). Gene disruption by biolistic transformation in serotype D strains of Cryptococcus neoformans. Fungal Genet Biol 29, 38-48.[Medline]
Eberhardt, I. & Hohmann, S. (1995). Strategy for deletion of complete open reading frames in Saccharomyces cerevisiae. Curr Genet 27, 306-308.[Medline]
Edman, J. C. & Kwon-Chung, K. J. (1990). Isolation of the URA5 gene from Cryptococcus neoformans var. neoformans and its use as a selective marker for transformation. Mol Cell Biol 10, 4538-4544.
Fox, D. S., Cruz, M. C., Sia, R. A. L., Ke, H., Cox, G. M., Cardenas, M. E. & Heitman, J. (2001). Calcineurin regulatory subunit is essential for virulence and mediates interactions with FKBP12-FK506 in Cryptococcus neoformans. Mol Microbiol 39, 835-849.[Medline]
Goldman, D., Lee, S. C. & Casadevall, A. (1994). Pathogenesis of pulmonary Cryptococcus neoformans infection in the rat. Infect Immun 62, 4755-4761.
Gorlach, J. M., McDade, H. C., Perfect, J. R. & Cox, G. M. (2002). Antisense repression in Cryptococcus neoformans as a laboratory tool and potential antifungal strategy. Microbiology 148, 213-219.
Heitman, J., Casadevall, A., Lodge, J. K. & Perfect, J. R. (1999). The Cryptococcus neoformans genome sequencing project. Mycopathologia 148, 1-7.[Medline]
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51-59.[Medline]
Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68.[Medline]
Hua, J., Meyer, J. D. & Lodge, J. K. (2000). Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin Diagn Lab Immunol 7, 125-128.
Kwon-Chung, K. J. (1975). A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67, 1197-1200.
Kwon-Chung, K. J. (1976). Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia 68, 821-833.
Kwon-Chung, K. J. & Bennett, J. E. (1992). Cryptococcosis. In Medical Mycology, pp. 397446. Malvern, PA: Lea & Febiger.
Kwon-Chung, K. J., Polacheck, I. & Popkin, T. J. (1982). Melanin-lacking mutants of Cryptococcus neoformans and their virulence for mice. J Bacteriol 150, 1414-1421.
Liu, H., Cottrell, T. R., Pierini, L. M., Goldman, W. E. & Doering, T. L. (2002). RNA interference in the pathogenic fungus Cryptococcus neoformans. Genetics 160, 463-470.
Lorenz, M. C., Muir, R. S., Lim, E., McElver, J., Weber, S. C. & Heitman, J. (1995). Gene disruption with PCR products in Saccharomyces cerevisiae. Gene 158, 113-117.[Medline]
McDade, H. C. & Cox, G. M. (2001). A new dominant selectable marker for use in Cryptococcus neoformans. Med Mycol 39, 151-154.[Medline]
Mitchell, T. G. & Perfect, J. R. (1995). Cryptococcosis in the era of AIDS 100 years after the discovery of Cryptococcus neoformans. Clin Microbiol Rev 8, 515-548.[Abstract]
Moore, T. D. E. & Edman, J. C. (1993). The
-mating type locus of Cryptococcus neoformans contains a peptide pheromone gene. Mol Cell Biol 13, 1962-1970.
Nelson, R. T., Hua, J., Pryor, B. & Lodge, J. K. (2001). Identification of virulence mutants of the fungal pathogen Cryptococcus neoformans using signature-tagged mutagenesis. Genetics 157, 935-947.
Nelson, R. T., Pryor, B. A. & Lodge, J. K. (2002). Sequence length required for homologous recombination in Cryptococcus neoformans. Fungal Genet Biol (in press).
Odom, A., Muir, S., Lim, E., Toffaletti, D. L., Perfect, J. & Heitman, J. (1997). Calcineurin is required for virulence of Cryptococcus neoformans. EMBO J 16, 2576-2589.[Medline]
Perfect, J. R., Lang, S. D. R. & Durack, D. T. (1980). Chronic cryptococcal meningitis: a new experimental model in rabbits. Am J Pathol 101, 177-194.[Abstract]
Pitkin, J. W., Panaccione, D. G. & Walton, J. D. (1996). A putative cyclic peptide efflux pump encoded by the TOXA gene of the plant-pathogenic fungus Cochliobolus carbonum. Microbiology 142, 1557-1565.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanfelice, F. (1894). Contributo alla morfologia e biologia dei blastomiceti che si sviluppano nei succhi di alcuni frutti. Ann Igien 4, 463-495.
Sherman, F. (1991). Getting started with yeast. Methods Enzymol 194, 3-21.[Medline]
Sia, R. A., Lengeler, K. B. & Heitman, J. (2000). Diploid strains of the pathogenic basidiomycete Cryptococcus neoformans are thermally dimorphic. Fungal Genet Biol 29, 153-163.[Medline]
Sudarshan, S., Davidson, R. C., Heitman, J. & Alspaugh, J. A. (1999). Molecular analysis of the Cryptococcus neoformans ADE2 gene, a selectable marker for transformation and gene disruption. Fungal Genet Biol 27, 36-48.[Medline]
Toffaletti, D. L. & Perfect, J. R. (1994). Biolistic DNA delivery for Cryptococcus neoformans transformation. In Molecular Biology of Pathogenic Fungi: a Laboratory Manual , pp. 303-308. Edited by B. Maresca & G. S. Kobayashi. New York:Telos Press.
Toffaletti, D. L., Rude, T. H., Johnston, S. A., Durack, D. T. & Perfect, J. R. (1993). Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J Bacteriol 175, 1405-1411.
Tong, A. H. Y., Evangelista, M., Parsons, A. B. & 10 other authors (2001). Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294, 23642368.
Wach, A. (1996). PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12, 259-265.[Medline]
Wach, A., Brachat, A., Pohlmann, R. & Philippsen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808.[Medline]
Wang, P., Perfect, J. R. & Heitman, J. (2000). The G-protein ß subunit GPB1 is required for mating and haploid fruiting in Cryptococcus neoformans. Mol Cell Biol 20, 352-362.
Wilson, R. B., Davis, D. & Mitchell, A. P. (1999). Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181, 1868-1874.
Received 27 February 2002;
revised 27 March 2002;
accepted 18 April 2002.
This article has been cited by other articles:
![]() |
J. Chang, F. D. Mast, A. Fagarasanu, D. A. Rachubinski, G. A. Eitzen, J. B. Dacks, and R. A. Rachubinski Pex3 peroxisome biogenesis proteins function in peroxisome inheritance as class V myosin receptors J. Cell Biol., October 19, 2009; 187(2): 233 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H. Jung, G. Hu, W. Kuo, and J. W. Kronstad Role of Ferroxidases in Iron Uptake and Virulence of Cryptococcus neoformans Eukaryot. Cell, October 1, 2009; 8(10): 1511 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Price, C. B. Nichols, and J. A. Alspaugh The Cryptococcus neoformans Rho-GDP Dissociation Inhibitor Mediates Intracellular Survival and Virulence Infect. Immun., December 1, 2008; 76(12): 5729 - 5737. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Gerik, S. R. Bhimireddy, J. S. Ryerse, C. A. Specht, and J. K. Lodge PKC1 Is Essential for Protection against both Oxidative and Nitrosative Stresses, Cell Integrity, and Normal Manifestation of Virulence Factors in the Pathogenic Fungus Cryptococcus neoformans Eukaryot. Cell, October 1, 2008; 7(10): 1685 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kingsbury and J. H. McCusker Threonine biosynthetic genes are essential in Cryptococcus neoformans Microbiology, September 1, 2008; 154(9): 2767 - 2775. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, S. Geunes-Boyer, and J. Heitman Ssk2 Mitogen-Activated Protein Kinase Kinase Kinase Governs Divergent Patterns of the Stress-Activated Hog1 Signaling Pathway in Cryptococcus neoformans Eukaryot. Cell, December 1, 2007; 6(12): 2278 - 2289. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chayakulkeeree, T. H. Rude, D. L. Toffaletti, and J. R. Perfect Fatty Acid Synthesis Is Essential for Survival of Cryptococcus neoformans and a Potential Fungicidal Target Antimicrob. Agents Chemother., October 1, 2007; 51(10): 3537 - 3545. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chang, A. Fagarasanu, and R. A. Rachubinski Peroxisomal Peripheral Membrane Protein YlInp1p Is Required for Peroxisome Inheritance and Influences the Dimorphic Transition in the Yeast Yarrowia lipolytica Eukaryot. Cell, September 1, 2007; 6(9): 1528 - 1537. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-P. Hsueh, C. Xue, and J. Heitman G protein signaling governing cell fate decisions involves opposing G{alpha} subunits in Cryptococcus neoformans Mol. Biol. Cell, September 1, 2007; 18(9): 3237 - 3249. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Segers, X. Zhang, F. Deng, Q. Sun, and D. L. Nuss Evidence that RNA silencing functions as an antiviral defense mechanism in fungi PNAS, July 31, 2007; 104(31): 12902 - 12906. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Hicks and J. Heitman Divergence of Protein Kinase A Catalytic Subunits in Cryptococcus neoformans and Cryptococcus gattii Illustrates Evolutionary Reconfiguration of a Signaling Cascade Eukaryot. Cell, March 1, 2007; 6(3): 413 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Deng, T. D. Allen, and D. L. Nuss Ste12 Transcription Factor Homologue CpST12 Is Down-Regulated by Hypovirus Infection and Required for Virulence and Female Fertility of the Chestnut Blight Fungus Cryphonectria parasitica Eukaryot. Cell, February 1, 2007; 6(2): 235 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Tangen, W. H. Jung, A. P. Sham, T. Lian, and J. W. Kronstad The iron- and cAMP-regulated gene SIT1 influences ferrioxamine B utilization, melanization and cell wall structure in Cryptococcus neoformans Microbiology, January 1, 2007; 153(1): 29 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Klose and J. W. Kronstad The Multifunctional {beta}-Oxidation Enzyme Is Required for Full Symptom Development by the Biotrophic Maize Pathogen Ustilago maydis Eukaryot. Cell, December 1, 2006; 5(12): 2047 - 2061. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Palmer, J. K. Thompson, L. Li, A. Prat, and P. Wang Gib2, A Novel Gbeta-like/RACK1 Homolog, Functions as a Gbeta Subunit in cAMP Signaling and Is Essential in Cryptococcus neoformans J. Biol. Chem., October 27, 2006; 281(43): 32596 - 32605. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Petzold, U. Himmelreich, E. Mylonakis, T. Rude, D. Toffaletti, G. M. Cox, J. L. Miller, and J. R. Perfect Characterization and Regulation of the Trehalose Synthesis Pathway and Its Importance in the Pathogenicity of Cryptococcus neoformans. Infect. Immun., October 1, 2006; 74(10): 5877 - 5887. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Liu, P. Du, G. Heinrich, G. M. Cox, and A. Gelli Cch1 Mediates Calcium Entry in Cryptococcus neoformans and Is Essential in Low-Calcium Environments Eukaryot. Cell, October 1, 2006; 5(10): 1788 - 1796. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Giles, J. E. Stajich, C. Nichols, Q. D. Gerrald, J. A. Alspaugh, F. Dietrich, and J. R. Perfect The Cryptococcus neoformans Catalase Gene Family and Its Role in Antioxidant Defense. Eukaryot. Cell, September 1, 2006; 5(9): 1447 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Boyce, M. Kretschmer, and J. W. Kronstad The vtc4 Gene Influences Polyphosphate Storage, Morphogenesis, and Virulence in the Maize Pathogen Ustilago maydis. Eukaryot. Cell, August 1, 2006; 5(8): 1399 - 1409. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, K. Kojima, G. M. Cox, and J. Heitman A Unique Fungal Two-Component System Regulates Stress Responses, Drug Sensitivity, Sexual Development, and Virulence of Cryptococcus neoformans Mol. Biol. Cell, July 1, 2006; 17(7): 3122 - 3135. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kojima, Y.-S. Bahn, and J. Heitman Calcineurin, Mpk1 and Hog1 MAPK pathways independently control fludioxonil antifungal sensitivity in Cryptococcus neoformans. Microbiology, March 1, 2006; 152(Pt 3): 591 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Missall, M. E. Pusateri, M. J. Donlin, K. T. Chambers, J. A. Corbett, and J. K. Lodge Posttranslational, Translational, and Transcriptional Responses to Nitric Oxide Stress in Cryptococcus neoformans: Implications for Virulence Eukaryot. Cell, March 1, 2006; 5(3): 518 - 529. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xue, Y.-S. Bahn, G. M. Cox, and J. Heitman G Protein-coupled Receptor Gpr4 Senses Amino Acids and Activates the cAMP-PKA Pathway in Cryptococcus neoformans Mol. Biol. Cell, February 1, 2006; 17(2): 667 - 679. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Hicks, Y.-S. Bahn, and J. Heitman Pde1 Phosphodiesterase Modulates Cyclic AMP Levels through a Protein Kinase A-Mediated Negative Feedback Loop in Cryptococcus neoformans Eukaryot. Cell, December 1, 2005; 4(12): 1971 - 1981. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Boyce, H. Chang, C. A. D'Souza, and J. W. Kronstad An Ustilago maydis Septin Is Required for Filamentous Growth in Culture and for Full Symptom Development on Maize Eukaryot. Cell, December 1, 2005; 4(12): 2044 - 2056. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. Banks, C. A. Specht, M. J. Donlin, K. J. Gerik, S. M. Levitz, and J. K. Lodge A Chitin Synthase and Its Regulator Protein Are Critical for Chitosan Production and Growth of the Fungal Pathogen Cryptococcus neoformans Eukaryot. Cell, November 1, 2005; 4(11): 1902 - 1912. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Fox and J. Heitman Calcineurin-Binding Protein Cbp1 Directs the Specificity of Calcineurin-Dependent Hyphal Elongation during Mating in Cryptococcus neoformans Eukaryot. Cell, September 1, 2005; 4(9): 1526 - 1538. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nielsen, G. M. Cox, A. P. Litvintseva, E. Mylonakis, S. D. Malliaris, D. K. Benjamin Jr., S. S. Giles, T. G. Mitchell, A. Casadevall, J. R. Perfect, et al. Cryptococcus neoformans {alpha} Strains Preferentially Disseminate to the Central Nervous System during Coinfection Infect. Immun., August 1, 2005; 73(8): 4922 - 4933. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Missall, J. F. Cherry-Harris, and J. K. Lodge Two glutathione peroxidases in the fungal pathogen Cryptococcus neoformans are expressed in the presence of specific substrates Microbiology, August 1, 2005; 151(8): 2573 - 2581. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fan, P. R. Kraus, M.-J. Boily, and J. Heitman Cryptococcus neoformans Gene Expression during Murine Macrophage Infection Eukaryot. Cell, August 1, 2005; 4(8): 1420 - 1433. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Vallim, C. B. Nichols, L. Fernandes, K. L. Cramer, and J. A. Alspaugh A Rac Homolog Functions Downstream of Ras1 To Control Hyphal Differentiation and High-Temperature Growth in the Pathogenic Fungus Cryptococcus neoformans Eukaryot. Cell, June 1, 2005; 4(6): 1066 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Kraus, C. B. Nichols, and J. Heitman Calcium- and Calcineurin-Independent Roles for Calmodulin in Cryptococcus neoformans Morphogenesis and High-Temperature Growth Eukaryot. Cell, June 1, 2005; 4(6): 1079 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, K. Kojima, G. M. Cox, and J. Heitman Specialization of the HOG Pathway and Its Impact on Differentiation and Virulence of Cryptococcus neoformans Mol. Biol. Cell, May 1, 2005; 16(5): 2285 - 2300. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Hull, M.-J. Boily, and J. Heitman Sex-Specific Homeodomain Proteins Sxi1{alpha} and Sxi2a Coordinately Regulate Sexual Development in Cryptococcus neoformans Eukaryot. Cell, March 1, 2005; 4(3): 526 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Noble and A. D. Johnson Strains and Strategies for Large-Scale Gene Deletion Studies of the Diploid Human Fungal Pathogen Candida albicans Eukaryot. Cell, February 1, 2005; 4(2): 298 - 309. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Fraser, J. C. Huang, R. Pukkila-Worley, J. A. Alspaugh, T. G. Mitchell, and J. Heitman Chromosomal Translocation and Segmental Duplication in Cryptococcus neoformans Eukaryot. Cell, February 1, 2005; 4(2): 401 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Giles, I. Batinic-Haberle, J. R. Perfect, and G. M. Cox Cryptococcus neoformans Mitochondrial Superoxide Dismutase: an Essential Link between Antioxidant Function and High-Temperature Growth Eukaryot. Cell, January 1, 2005; 4(1): 46 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-P. Hsueh and W.-C. Shen A Homolog of Ste6, the a-Factor Transporter in Saccharomyces cerevisiae, Is Required for Mating but Not for Monokaryotic Fruiting in Cryptococcus neoformans Eukaryot. Cell, January 1, 2005; 4(1): 147 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pukkila-Worley, Q. D. Gerrald, P. R. Kraus, M.-J. Boily, M. J. Davis, S. S. Giles, G. M. Cox, J. Heitman, and J. A. Alspaugh Transcriptional Network of Multiple Capsule and Melanin Genes Governed by the Cryptococcus neoformans Cyclic AMP Cascade Eukaryot. Cell, January 1, 2005; 4(1): 190 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Missall, J. M. Moran, J. A. Corbett, and J. K. Lodge Distinct Stress Responses of Two Functional Laccases in Cryptococcus neoformans Are Revealed in the Absence of the Thiol-Specific Antioxidant Tsa1 Eukaryot. Cell, January 1, 2005; 4(1): 202 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Griffith, J. S. Klutts, L. Zhang, S. B. Levery, and T. L. Doering UDP-glucose Dehydrogenase Plays Multiple Roles in the Biology of the Pathogenic Fungus Cryptococcus neoformans J. Biol. Chem., December 3, 2004; 279(49): 51669 - 51676. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, J. K. Hicks, S. S. Giles, G. M. Cox, and J. Heitman Adenylyl Cyclase-Associated Protein Aca1 Regulates Virulence and Differentiation of Cryptococcus neoformans via the Cyclic AMP-Protein Kinase A Cascade Eukaryot. Cell, December 1, 2004; 3(6): 1476 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Kraus, M.-J. Boily, S. S. Giles, J. E. Stajich, A. Allen, G. M. Cox, F. S. Dietrich, J. R. Perfect, and J. Heitman Identification of Cryptococcus neoformans Temperature-Regulated Genes with a Genomic-DNA Microarray Eukaryot. Cell, October 1, 2004; 3(5): 1249 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Nichols, J. A. Fraser, and J. Heitman PAK Kinases Ste20 and Pak1 Govern Cell Polarity at Different Stages of Mating in Cryptococcus neoformans Mol. Biol. Cell, October 1, 2004; 15(10): 4476 - 4489. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Pascon, T. M. Ganous, J. M. Kingsbury, G. M. Cox, and J. H. McCusker Cryptococcus neoformans methionine synthase: expression analysis and requirement for virulence Microbiology, September 1, 2004; 150(9): 3013 - 3023. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Hull, G. M. Cox, and J. Heitman The {alpha}-Specific Cell Identity Factor Sxi1{alpha} Is Not Required for Virulence of Cryptococcus neoformans Infect. Immun., June 1, 2004; 72(6): 3643 - 3645. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Vallim, L. Fernandes, and J. A. Alspaugh The RAM1 gene encoding a protein-farnesyltransferase {beta}-subunit homologue is essential in Cryptococcus neoformans Microbiology, June 1, 2004; 150(6): 1925 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kingsbury, Z. Yang, T. M. Ganous, G. M. Cox, and J. H. McCusker Novel Chimeric Spermidine Synthase-Saccharopine Dehydrogenase Gene (SPE3-LYS9) in the Human Pathogen Cryptococcus neoformans Eukaryot. Cell, June 1, 2004; 3(3): 752 - 763. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kingsbury, Z. Yang, T. M. Ganous, G. M. Cox, and J. H. McCusker Cryptococcus neoformans Ilv2p confers resistance to sulfometuron methyl and is required for survival at 37 {degrees}C and in vivo Microbiology, May 1, 2004; 150(5): 1547 - 1558. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Davidson, J. H. Nett, E. Renfer, H. Li, T. A. Stadheim, B. J. Miller, R. G. Miele, S. R. Hamilton, B.-K. Choi, T. I. Mitchell, et al. Functional analysis of the ALG3 gene encoding the Dol-P-Man: Man5GlcNAc2-PP-Dol mannosyltransferase enzyme of P. pastoris Glycobiology, May 1, 2004; 14(5): 399 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Idnurm, J. L. Reedy, J. C. Nussbaum, and J. Heitman Cryptococcus neoformans Virulence Gene Discovery through Insertional Mutagenesis Eukaryot. Cell, April 1, 2004; 3(2): 420 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Hicks, C. A. D'Souza, G. M. Cox, and J. Heitman Cyclic AMP-Dependent Protein Kinase Catalytic Subunits Have Divergent Roles in Virulence Factor Production in Two Varieties of the Fungal Pathogen Cryptococcus neoformans Eukaryot. Cell, February 1, 2004; 3(1): 14 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Sommer, H. Liu, and T. L. Doering An {alpha}-1,3-Mannosyltransferase of Cryptococcus neoformans J. Biol. Chem., November 28, 2003; 278(48): 47724 - 47730. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Fraser, R. L. Subaran, C. B. Nichols, and J. Heitman Recapitulation of the Sexual Cycle of the Primary Fungal Pathogen Cryptococcus neoformans var. gattii: Implications for an Outbreak on Vancouver Island, Canada Eukaryot. Cell, October 1, 2003; 2(5): 1036 - 1045. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Y. Young, C. M. Hull, and J. Heitman Disruption of Ergosterol Biosynthesis Confers Resistance to Amphotericin B in Candida lusitaniae Antimicrob. Agents Chemother., September 1, 2003; 47(9): 2717 - 2724. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nielsen, G. M. Cox, P. Wang, D. L. Toffaletti, J. R. Perfect, and J. Heitman Sexual Cycle of Cryptococcus neoformans var. grubii and Virulence of Congenic a and {alpha} Isolates Infect. Immun., September 1, 2003; 71(9): 4831 - 4841. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. T. Magee, C. Gale, J. Berman, and D. Davis Molecular Genetic and Genomic Approaches to the Study of Medically Important Fungi Infect. Immun., May 1, 2003; 71(5): 2299 - 2309. [Full Text] [PDF] |
||||
![]() |
C. M. Hull, R. C. Davidson, and J. Heitman Cell identity and sexual development in Cryptococcus neoformans are controlled by the mating-type-specific homeodomain protein Sxi1alpha Genes & Dev., December 1, 2002; 16(23): 3046 - 3060. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |