Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 149 (2003), 29-36; DOI  10.1099/mic.0.25936-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Agricola
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Microbiology 149 (2003), 29-36; DOI  10.1099/mic.0.25936-0
© 2003 Society for General Microbiology

Transcriptional regulation of the nos genes for nitrous oxide reductase in Pseudomonas aeruginosa

Hiroyuki Arai, Masayuki Mizutani and Yasuo Igarashi

Department of Biotechnology, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan

Correspondence
Hiroyuki Arai
aharai{at}mail.ecc.u-tokyo.ac.jp


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The genes for nitrous oxide (N2O) reduction, nosRZDFYL, are clustered on the chromosome of Pseudomonas aeruginosa. Promoter assays using transcriptional fusions to lacZ revealed that the structural gene for nitrous oxide reductase, nosZ, is transcribed with the upstream nosR gene. The nosR gene product is not required for the activity of the nosR promoter. A sequence similar to the consensus FNR-binding motif was found 41·5 bp upstream from the major transcriptional start point of nosR. Mutation of the motif significantly reduced the promoter activity. DNR, an FNR-related transcriptional regulator required for the expression of denitrification genes in P. aeruginosa, is necessary for the transcription of nosR, indicating that the motif is recognized by DNR. Nitrite (NO-2), nitric oxide (NO) and NO-generating reagents induced nosR promoter activity, but N2O did not. The NO-2-induced nosR promoter activity was reduced by mutation of the NO-2 reductase gene. However, a low concentration of NO-2 induced the promoter activity in a NO reductase mutant. These results indicate that NO is the inducer molecule for transcription of the nos genes.

Abbreviations: GSNO, S-nitrosoglutathione; SNP, sodium nitroprusside; N2OR, nitrous oxide reductase; NIR, nitrite reductase; NOR, nitric oxide reductase


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Nitrate (NO-3) is reduced through nitrite (NO-2), nitric oxide (NO) and nitrous oxide (N2O) to dinitrogen (N2) by denitrifying bacteria. N2O reductase (N2OR) catalyses the last step of the denitrification pathway, the two-electron reduction of N2O to N2. N2OR has been purified and characterized from many bacteria, such as Pseudomonas stutzeri (Coyle et al., 1985Down), Paracoccus denitrificans (Snyder & Hollocher, 1987Down) and Achromobacter cycloclastes (Hulse & Averill, 1990Down). N2OR from Pseudomonas aeruginosa is, like most of the N2OR from other micro-organisms, a dimeric multicopper enzyme located in the periplasm (SooHoo & Hollocher, 1991Down). This type of N2OR has two copper centres per subunit, CuA and CuZ. CuA is a di-copper centre, similar to that of cytochrome oxidase, and CuZ locates at the catalytic centre (Brown et al., 2000Down). The organization and regulation of the N2OR genes have been investigated intensively in P. stutzeri. In this bacterium, the genes for N2O reduction, nosRZDFYL, are clustered with the genes for other denitrification enzymes, NO-2 reductase (NIR) and NO reductase (NOR) (DownBraun & Zumft, 1992; Jüngst et al., 1991Down). The structural gene for N2OR is nosZ (Viebrock & Zumft, 1988Down), the nosDFY gene products are thought to be involved in the processing and insertion of copper into N2OR (Zumft et al., 1990Down), the nosL gene product is proposed to be an outer membrane disulfide isomerase (Dreusch et al., 1996Down) and nosR encodes a putative membrane protein (Cuypers et al., 1992Down). The nosR gene product is proposed to be an N2O-sensing regulator that is required for the expression of the N2OR genes (Vollack & Zumft, 2001Down). The nos gene cluster of P. stutzeri is transcribed as at least three operons from promoters located upstream of nosR, nosZ and nosD (Cuypers et al., 1995Down).

Genome sequencing of P. aeruginosa PAO1 has shown that the arrangement of the nosRZDFYL genes (PA3391–PA3396) is identical to that of P. stutzeri (Stover et al., 2000Down); however, the nos gene cluster of strain PAO1 is located separately from the nirnor gene cluster encoding NIR and NOR (Arai et al., 1995aDown). Identities of nucleotide sequences of the nos genes with correspondents from P. stutzeri are (in %) nosR, 75, nosZ, 80, nosD, 71, nosF, 70, nosY, 77 and nosL, 60, respectively. The nos genes are probably transcribed as an operon because the genes are located close to one another or overlap in P. aeruginosa.

Many denitrifying bacteria can grow on N2O as the only electron acceptor under anaerobic conditions. However, P. aeruginosa cannot grow on exogenous N2O as the only electron acceptor, although it can utilize endogenous N2O for the generation of energy for growth during denitrification (Bryan et al., 1985Down; Carlson & Ingraham, 1983Down). P. aeruginosa does not express N2OR in response to exposure to N2O, indicating that the expression of N2OR is regulated by a molecule other than N2O (SooHoo & Hollocher, 1990Down). Thus, the regulatory mechanism of N2OR of P. aeruginosa seems to be different from that of other denitrifiers that can grow on N2O, such as P. stutzeri.

The expression of the nir and nor genes is regulated by two FNR-like regulators, ANR and DNR, in P. aeruginosa (Arai et al., 1995bDown, 1997Down). FNR of Escherichia coli is structurally similar to the CRP that is involved in the catabolite repression control of E. coli (Guest, 1992Down). FNR regulates the expression of many genes that are required for anaerobic growth when oxygen is depleted. Four cysteine residues are involved in sensing oxygen depletion through the formation of a 4Fe–4S cluster (Kiley & Beinert, 1999Down). ANR carries the four cysteine residues and is a functional analogue of FNR (Zimmermann et al., 1991Down). DNR does not carry the cysteine residues and is proposed to sense the existence of N-oxides, especially NO, rather than oxygen limitation (Arai et al., 1995bDown, 1999bDown). The promoters regulated by FNR-like regulators have a sequence similar to the consensus FNR-binding motif (FNR box) (TTGAT----ATCAA), and both ANR and DNR recognize the consensus FNR box (Hasegawa et al., 1998Down). There are motifs similar to the FNR box in the promoter regions of the nir and nor operons, but the nir and nor promoters are activated only by DNR and not by ANR. Because expression of DNR is under the control of ANR, transcription of the nir and nor genes is regulated indirectly by ANR. This ANR–DNR dual regulatory system causes the expression of the nir and nor genes under anaerobic conditions in the presence of N-oxides (Arai et al., 1997Down). The FNR box is also found in the upstream region of nosR, suggesting that the nos genes are also under the control of DNR and/or ANR. In this study, we analysed the transcriptional regulation of the nos genes and the role of DNR in their regulation.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacterial strains, plasmids and growth conditions.
The bacterial strains and plasmids used in this study are listed in Table 1Down. E. coli and P. aeruginosa strains were cultivated in Luria–Bertani (LB) medium at 37 °C. A synthetic medium described by Wood (1978)Down was used for promoter assays to analyse the effects of inducers. Concentrations of antibiotics used were 100 µg ampicillin ml-1 and 12·5 µg tetracycline ml-1 for E. coli, and 200 µg carbenicillin ml-1, 300 µg chloramphenicol ml-1, 200 µg streptomycin ml-1 and 150 µg tetracycline ml-1 for P. aeruginosa.


View this table:
[in this window]
[in a new window]
 
Table 1. Bacterial strains and plasmids used in this study

 
To produce anaerobic conditions, we used a 50 ml vial (70 ml total volume) containing 20 ml medium. After inoculating the vial with 200 µl of an aerobically grown culture, the vial was fitted with a butyl-rubber septum and an aluminium seal. The air in the vial was replaced with argon by flushing the gas through a needle. Cultivation was done by gentle shaking. To produce oxygen-limiting conditions, we added oxygen into the vial to a concentration of 2 % (1 ml) with a gas-tight syringe after the air in the vial was replaced with argon. When necessary, sodium nitrite, sodium nitroprusside (SNP) or S-nitrosoglutathione (GSNO) was added to the medium. SNP and GSNO were purchased from Kanto Chemicals and Wako, respectively, and dissolved in 50 mM MOPS just before use. N2O and CO were purchased from GL Science. NO was purchased from Suzuki Shokan.

DNA manipulations and ß-galactosidase assay.
The recombinant DNA experiments were carried out by standard methods (Sambrook et al., 1989Down). Introduction of DNA into P. aeruginosa strains was carried out as described previously (Arai et al., 1995cDown) or by electroporation with a Cell-Porator (BRL Life Technologies). Restriction and modification enzymes were purchased from Toyobo or Takara. EX Taq (Takara) was used for PCR. Synthetic oligonucleotides were prepared by Sawady Technology. ß-Galactosidase assays were performed using the standard protocol (Sambrook et al., 1989Down).

Cloning of the nos gene cluster.
Three overlapping fragments (4·7 kb SphI, 4·2 kb PstI and 1·6 kb KpnI) that carry the nos genes of strain PAO1 were cloned by using pUC19 as a vector; the resulting plasmids were designated pMM1, pMM2 and pMM3, respectively (Fig. 1Down). We used a DIG DNA labelling and detection kit (Boehringer Mannheim) and a Hybond-N nylon membrane (Amersham Pharmacia Biotech) for Southern blotting and colony hybridization. The probe used for cloning the 4·7 kb SphI fragment was a 0·6 kb fragment of the nosZ gene that was amplified by PCR with oligonucleotides probeA (GAAGCTTGACGTGCACTACCAGCCGGGTCA) and probeB (GCAGAACCAGCTGCAGTAGTACCAGTGCAG) from the chromosomal DNA of strain PAO1. The oligonucleotides were designed from the sequence of the nosZ gene of P. aeruginosa DSM 57001T (Zumft et al., 1992Down). A 1·7 kb PstI–SphI fragment from pMM1 was used as a probe for cloning the 4·2 kb PstI fragment. The probe used for cloning the 1·6 kb KpnI fragment was a 0·6 kb PCR fragment of the 5' region of the nosR gene that was amplified with oligonucleotides NRPF (GGCAGATCTGTTACCTGAAGGCGCTGGGC) and NRPR (GGCGGTACCGTCTGGAAGGCGTAGCCGAG). The oligonucleotides were designed from the sequence obtained from the Pseudomonas Genome Project (http://www.pseudomonas.com).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1. Physical map of the nos genes from P. aeruginosa PAO1. Arrows indicate the sizes and directions of the genes. Upper bars indicate the fragments cloned from the chromosomal DNA of strain PAO1. Lower bars indicate the fragments used for the lacZ assay or for the construction of the mutant strain RM1301T. pMM1301T carries a fragment containing the nosR gene disrupted by insertion of the tetracycline-resistance gene (tet).

 
Construction of plasmids.
A 2·7 kb fragment carrying the nosR promoter region, nosR and the 5' region of nosZ was amplified from the chromosomal DNA of strain PAO1 with oligonucleotides nos15 (GAGGCCTGGATCCGTTACCTGAAGGCGC; the BamHI site is underlined) and nos16 (CGACCACCAAGCTTCCCAGGGCGCTGGC; the HindIII site is underlined). The BamHI–HindIII digest of the PCR fragment was ligated with pUC119, resulting in pHA1231. A 2·7 kb BamHI–HindIII fragment, a 1·1 kb KpnI–HindIII fragment and a 1·6 kb BamHI–KpnI fragment from pHA1231 were ligated with the respective sites of pQF50 (Farinha & Kropinski, 1990Down), resulting in pHA1241, pHA1242 and pHA1243, respectively (Fig. 1Up). pHA1244 was constructed by ligation of a 0·54 kb BglII–KpnI fragment, which contains the 5' region of nosD, with the respective sites of pQF50 (Fig. 1Up). The fragment was prepared by PCR amplification from pMM1 with oligonucleotides NDP-BF (GGCAGATCTAGGACGGCATCGACCTGATG; the BglII site is underlined) and NDP-KR (GGCGGTACCGCCTCGCAGCGTAGGTGCAG; the KpnI site is underlined). For construction of pHA1245, a 1·3 kb fragment carrying the 3' region of nosY and nosL was amplified by PCR from pMM2 with oligonucleotides nos3 (CAGGTCGAATTCACCTCGGTGCCGGC; the EcoRI site is underlined) and nos4 (CCGGCGGATCCTCAGTGCGCCGGGTGCC). The amplified fragment was digested with EcoRI and SphI, and the resulting 0·85 kb fragment was ligated with a HincII–SphI digest of pUC118 after the EcoRI end was blunted. The fragment was cut out using BamHI and HindIII, and inserted into the respective sites of pQF50, resulting in pHA1245.

pHA1241{Delta}R was constructed by digestion of pHA1241 with KpnI and self-ligation after removing protruding 3' termini with T4 DNA polymerase. A frame-shift mutation was introduced into the nosR gene on the plasmid by this operation. pHA1241NN and pHA1243NN have a mutated FNR-binding motif (TTGACTTTCATCAA->cTGACTTTCATCAg). The mutation was introduced by PCR with oligonucleotides nos13 (CCACTTCCTGACTTTCATCAGGCGCGTTCC) and nos14 (complementary to nos13) as described previously (Arai et al., 1999aDown).

Construction of mutant strains.
A nosR-deficient strain, RM1301T, was constructed from strain PAO1 by insertion of the tetracycline-resistance gene (tet) into nosR by homologous recombination using pMM1301T (Fig. 1Up); the method of homologous recombination has been described previously (Arai et al., 1995cDown). The mutation was confirmed by Southern hybridization analysis (data not shown). pMM1301T was constructed as follows. A 2·7 kb KpnI–KpnI–SmaI fragment containing the nosR gene from pMM1 and pMM3 was cloned into the KpnI–SmaI sites of pUC19. The resultant plasmid was digested with ClaI and ligated with an end-blunted 1·4 kb EcoRI–AvaI fragment of pBR322, which carried the tet gene, resulting in pMM1301T. An anr and dnr double mutant strain, DM536, was constructed from the anr-deficient strain PAO6261 (Ye et al., 1995Down) by using pHA536 as described previously (Arai et al., 1995bDown). Insertion of the tet gene was confirmed by PCR (data not shown).

RNA extraction and primer extension analysis.
Strain PAO1 was cultivated anaerobically in LB medium supplemented with 5 mM sodium nitrite. Total RNA was isolated at mid-exponential phase by using ISOGEN (Nippon Gene), according to the manufacturer's instructions, and was treated with RNase-free DNase (Nippon Gene). The primer extension reaction was performed with Superscript II (Gibco-BRL). The oligonucleotide primer used for the reaction was nos9 (GACACACCGCCACGATCCG), which was complementary to the mRNA of nosR. The primer was labelled with [{gamma}-32P]ATP (Amersham Pharmacia Biotech) by using T4 polynucleotide kinase. The labelled primer and RNA were annealed at 70 °C for 10 min. Extension was carried out at 42 °C for 30 min. The primer extension product was compared on an 8 % polyacrylamide/6 M urea gel with the products of sequence reactions made with the same primer.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Transcriptional analysis of the nos genes
The gene cluster for N2OR of P. aeruginosa PAO1 is composed of five genes, nosRZDFYL. The nosR and nosZ genes are separated by only 42 bp, and nosZ and nosD, nosD and nosF, and nosF and nosY overlap each other. The nosY and nosL genes are separated by only 16 bp. Promoter activities of the regions upstream of nosR, nosZ, nosD and nosL were determined by using transcriptional fusions with lacZ. Strain PAO1 was transformed with the pQF50-derived plasmids shown in Fig. 1Up. The transformants were cultivated under anaerobic conditions in LB medium supplemented with 5 mM sodium nitrite. After overnight cultivation, the ß-galactosidase activities of the transformants were determined (Table 2Down). pHA1241 and pHA1243, which carried the upstream region of nosR, showed high activities. In contrast, pHA1242, pHA1244 and pHA1245, which carried the upstream regions of nosZ, nosD and nosL, respectively, showed very low activities. These results suggested that the nosRZDFYL genes are transcribed as an operon from a promoter located upstream of nosR. We tried using Northern hybridization analysis to determine the length of the mRNA of the nos genes, but the hybridization signals we obtained using the probes for nosR, nosZ or nosDF were small smeary bands, probably because of the instability of the mRNA (data not shown). This hybridization was detected only for the RNA prepared from the cells grown under denitrifying conditions.


View this table:
[in this window]
[in a new window]
 
Table 2. Promoter activity of the nos genes using transcriptional fusions with lacZ in P. aeruginosa strains grown under anaerobic conditions

 
Role of nosR in the transcription of the nos genes
The promoter activity from pHA1241 was about twice as high as that from pHA1243 (Table 2Up). pHA1241 carries the complete nosR gene but pHA1243 does not. When the nosR gene on pHA1241 was disrupted by a frame-shift mutation (pHA1241{Delta}R), the promoter activity was almost identical to that of pHA1243 (Table 2Up). These results indicated that amplification of nosR on the plasmid had some positive effect on its promoter activity. NosR is proposed to activate the transcription of nosZ in response to N2O in P. stutzeri (Vollack & Zumft, 2001Down). However, expression of nosR from a multicopy expression vector did not raise the promoter activity from pHA1242 or pHA1243 (data not shown). It is probable that the arrangement of the promoter and nosR is important for the full transcriptional activity to occur. Such an importance of gene arrangement was reported for NirI, a homologue of NosR, in Paracoccus denitrificans (Saunders et al., 1999Down). The gene encoding NirI is located upstream of and divergently transcribed from the NIR gene nirS. Disruption of nirI caused a defect in the transcription of nirS, indicating that NirI acts as a transcriptional activator for the nirS promoter. However, the introduction of recombinant nirI into the disruptant did not complement the transcription of nirS. Transcription was restored only when nirI was reintegrated upstream of nirS on the chromosome by homologous recombination.

We determined the promoter activity from pHA1241, pHA1242, pHA1243 and pHA1241{Delta}R in the nosR-deficient strain RM1301T. The activity from pHA1241 was about twice as high as that from pHA1243 or pHA1241{Delta}R, as in the case of strain PAO1 (Table 2Up). The activities in strain RM1301T were about 30 % higher than those in strain PAO1. These results indicated that nosR is not necessary for the activity of the nosR promoter because the complete nosR gene did not exist in strain RM1301T carrying pHA1243 or pHA1241{Delta}R.

Analysis of the nosR promoter sequence
The transcriptional initiation site of the nosR promoter was determined by primer extension analysis (Fig. 2Down). The mRNA used for the template was prepared from cells of strain PAO1 grown anaerobically with sodium nitrite as an electron acceptor. A major transcriptional start point of nosR was found 77 bp upstream from the initiation codon. In addition, a minor transcriptional start point was found adjacent to the major point. There is a sequence (TTGACTTTCATCAA) similar to the consensus FNR box (TTGAT----ATCAA) in the promoter region. The sequence is centred at -41·5 bp from the major transcriptional start point. This distance is typical of the promoters activated by the FNR-type regulators (Guest, 1992Down). No typical -10 sequence was found in this region. A primer extension reaction was also carried out with a primer complementary to nosZ or nosD, but no clear band was detected, suggesting that there is no promoter just upstream of nosZ or nosD (data not shown).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 2. Determination of the transcriptional start point of nosR by primer extension analysis. Lane RT contains the primer extension products from RNA isolated from strain PAO1 grown anaerobically in the presence of NO-2. Sequence ladders generated with the same primer are shown. The arrows indicate the transcriptional start sites; the minor site is indicated by an arrow in parentheses.

 
Effect of DNR on nosR promoter activity
We investigated the role of the putative FNR box in the nosR promoter region by using mutated promoter fragments. Two point mutations were introduced (T->C at -48 and A->G at -35 from the major transcriptional start point) into pHA1241 and pHA1243, resulting in pHA1241NN and pHA1243NN, respectively. The mutations were designed to disrupt the consensus sequence but not the palindromic structure of the motif (Lodge et al., 1990Down). The transcriptional activity of the nosR promoter on both pHA1241NN and pHA1243NN in strain PAO1 was very low, indicating that the FNR-binding motif is necessary for the promoter activity (Table 2Up).

We have reported that both of the FNR-like regulators of Pseudomonas aeruginosa, ANR and DNR, can activate an artificial FNR-dependent promoter (Hasegawa et al., 1998Down). It is still unknown how ANR and DNR distinguish their target promoters. To investigate the roles of ANR and DNR in P. aeruginosa, we constructed an anr and dnr double mutant strain, DM536, and measured the nosR promoter activity in this strain. When strain DM536 was transformed with pHA411, which carries anr, the nosR promoter activity from pHA1243 was very low (Table 2Up). In contrast, when strain DM536 was transformed with pHA541{Omega}, which carries dnr, the activity was nearly identical to that in strain PAO1. These results clearly demonstrated that the nos genes are in the DNR regulon and therefore in the ANR/DNR-regulatory cascade, as was the case for the nir and nor genes. It is probable that the FNR-binding motif of the nosR promoter is recognized only by DNR.

NO-responding induction of the nosR promoter
We have reported that the expression of the nir and nor genes is regulated by DNR (Arai et al., 1997Down). NO is a major signal for DNR-dependent transcriptional activation (Arai et al., 1999bDown). We investigated the signal molecule for induction of the nos genes by measuring the nosR promoter activity from pHA1243 in the presence of N-oxides or NO-generating reagents (Table 3Down). Synthetic medium was used so that we could clearly see the effects of the added compounds. In the wild-type strain PAO1, the nosR promoter activity was highest in the presence of 5 mM . The activity was also high when NO gas was added to the head space of the incubation vial. The NO-generating reagents SNP and GSNO also activated the promoter. In contrast, no activity was detected when the air in the vial was replaced with N2O. These results indicated that the signal for the activation of the nosR promoter was NO or related reactive nitrogen species and that N2O does not induce the genes for its own reductase. P. aeruginosa does not grow on exogenous N2O as the only terminal electron acceptor of anaerobic respiration, although it can produce energy for growth at the expense of endogenous N2O (Bryan et al., 1985Down; Carlson & Ingraham, 1983Down). It has been reported that P. aeruginosa does not express N2OR when exposed to N2O under anaerobic conditions (Snyder et al., 1987Down; SooHoo & Hollocher, 1990Down). The results that the transcription of the nos genes is regulated not by N2O but by NO clearly explain why P. aeruginosa does not grow on exogenous N2O.


View this table:
[in this window]
[in a new window]
 
Table 3. Effects of inducers on the transcription of the nosR promoter

 
nosR promoter activity was also measured in the nirS-deficient mutant strain RM488 (Kawasaki et al., 1995Down) and the norCBD-deficient mutant strain RM495 (Arai et al., 1999bDown), which do not the produce NIR and NOR, respectively. In strain RM488, the nosR promoter activity in the presence of 5 mM was significantly lower than that in strain PAO1 (Table 3Up). This must be because NO is not produced enzymically from . The NO-generating reagents SNP and GSNO induced the nosR promoter, as was the case for strain PAO1. However, the activity of the promoter in the presence of gaseous NO was about a third that of strain PAO1. It has been reported that the in vivo activities of NIR and NOR couple with each other (Ye et al., 1992Down; Zumft, 1993Down). Deficiency in NIR activity causes low activity of NOR, and vice versa. It was difficult to metabolize a large amount of NO in strain RM488, as NO has a toxic effect on the cells and might have caused the low activity of the nosR promoter. The toxic effect might not be expressed when the NO-generating reagents were used because the NO concentration in the medium was kept low. In strain RM495, the promoter activity was also induced by the NO-generating reagents; however, the activity of the promoter in the presence of 5 mM or gaseous NO was lower than that in strain PAO1. The low activity might have been caused by the toxicity of the large amount of NO that was produced from or added exogenously. Interestingly, the promoter activity in strain RM495 was high in the presence of 0·1 mM , while the activity was very low in other strains. That was probably because NO produced from was not further metabolized and therefore a suitable concentration was maintained for the activation of the nosR promoter. Such a phenomenon has been observed for the norC and nirQ promoters (Arai et al., 1999bDown).

The nosR promoter activity was not induced by CO in strain PAO1 (Table 3Up), but high activity occurred when 0·1 mM was added to the medium in the CO atmosphere. Because 0·1 mM alone did not activate the promoter, the high activity must be the result of the synergistic effect of CO and . CO is known to bind to the active site of NOR (Hendriks et al., 2001Down). It is probable that NOR was inhibited by the CO and that the NO produced from was not further metabolized as in the case of strain RM495.

It has been shown that the nosR promoter of P. aeruginosa is activated by DNR in the presence of NO. The nosR promoter of P. stutzeri is also reported to be regulated by NO (Vollack & Zumft, 2001Down). NO might be sensed directly by DNR, because DNR and corresponding regulators such as DnrD of P. stutzeri, NNR of Paracoccus denitrificans and NnrR of Rhodobacter sphaeroides have been shown to be involved in the NO-responding regulation of the denitrification genes (Arai et al., 1999bDown; Kwiatkowski et al., 1997Down; Hutchings et al., 2000Down; Vollack & Zumft, 2001Down). The mechanism of NO-sensing by DNR is still unclear, and no cofactor has been identified yet. CooA, a CRP/FNR-related CO-sensing regulator of Rhodospirillum rubrum, uses b-type haem as a cofactor for sensing of CO (Aono et al., 1996Down). Because CO had no direct effect on the nosR promoter activity, the NO-sensing mechanism of DNR must be different from the CO-sensing mechanism of CooA.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Aono, S., Nakajima, H., Saito, K. & Okada, M. (1996). A novel heme protein that acts as a carbon monoxide-dependent transcriptional activator in Rhodospirillum rubrum. Biochem Biophys Res Commun 228, 752–756.[CrossRef][Medline]

Arai, H., Igarashi, Y. & Kodama, T. (1994). Structure and ANR-dependent transcription of the nir genes for denitrification from Pseudomonas aeruginosa. Biosci Biotechnol Biochem 58, 1286–1291.[Medline]

Arai, H., Igarashi, Y. & Kodama, T. (1995a). The structural genes for nitric oxide reductase from Pseudomonas aeruginosa. Biochim Biophys Acta 1261, 279–284.[Medline]

Arai, H., Igarashi, Y. & Kodama, T. (1995b). Expression of the nir and nor genes for denitrification of Pseudomonas aeruginosa requires a novel CRP/FNR-related transcriptional regulator, DNR, in addition to ANR. FEBS Lett 371, 73–76.[CrossRef][Medline]

Arai, H., Zhang, Y., Sambongi, Y., Igarashi, Y. & Kodama, T. (1995c). Production of recombinant cytochrome c-551 in a Pseudomonas aeruginosa mutant strain. J Ferment Bioeng 79, 489–492.[CrossRef]

Arai, H., Kodama, T. & Igarashi, Y. (1997). Cascade regulation of the two CRP/FNR-related transcriptional regulators (ANR and DNR) and the denitrification enzymes in Pseudomonas aeruginosa. Mol Microbiol 25, 1141–1148.[CrossRef][Medline]

Arai, H., Akahira, S., Ohishi, T. & Kudo, T. (1999a). Adaptation of Comamonas testosteroni TA441 to utilization of phenol by spontaneous mutation of the gene for a trans-acting factor. Mol Microbiol 33, 1132–1140.[CrossRef][Medline]

Arai, H., Kodama, T. & Igarashi, Y. (1999b). Effect of nitrogen oxides on expression of the nir and nor genes for denitrification in Pseudomonas aeruginosa. FEMS Microbiol Lett 170, 19–24.[CrossRef][Medline]

Braun, C. & Zumft, W. G. (1992). The structural genes of the nitric oxide reductase complex from Pseudomonas stutzeri are part of a 30-kilobase gene cluster for denitrification. J Bacteriol 174, 2394–2397.[Abstract/Free Full Text]

Brown, K., Tegoni, M., Prudencio, M., Pereira, A. S., Besson, S., Moura, J. J., Moura, I. & Cambillau, C. (2000). A novel type of catalytic copper cluster in nitrous oxide reductase. Nat Struct Biol 7, 191–195.[CrossRef][Medline]

Bryan, B. A., Jeter, R. M. & Carlson, C. A. (1985). Inability of Pseudomonas stutzeri denitrification mutants with the phenotype of Pseudomonas aeruginosa to grow in nitrous oxide. Appl Environ Microbiol 50, 1301–1303.[Abstract/Free Full Text]

Carlson, C. A. & Ingraham, J. L. (1983). Comparison of denitrification by Pseudomonas stutzeri, Pseudomonas aeruginosa, and Paracoccus denitrificans. Appl Environ Microbiol 45, 1247–1253.[Abstract/Free Full Text]

Coyle, C. L., Zumft, W. G., Kroneck, P. M., Körner, H. & Jakob, W. (1985). Nitrous oxide reductase from denitrifying Pseudomonas perfectomarina. Purification and properties of a novel multicopper enzyme. Eur J Biochem 153, 459–467.[Medline]

Cuypers, H., Viebrock-Sambale, A. & Zumft, W. G. (1992). NosR, a membrane-bound regulatory component necessary for expression of nitrous oxide reductase in denitrifying Pseudomonas stutzeri. J Bacteriol 174, 5332–5339.[Abstract/Free Full Text]

Cuypers, H., Berghöfer, J. & Zumft, W. G. (1995). Multiple nosZ promoters and anaerobic expression of nos genes necessary for Pseudomonas stutzeri nitrous oxide reductase and assembly of its copper centers. Biochim Biophys Acta 1264, 183–190.[Medline]

Dreusch, A., Riester, J., Kroneck, P. M. & Zumft, W. G. (1996). Mutation of the conserved Cys165 outside of the CuA domain destabilizes nitrous oxide reductase but maintains its catalytic activity. Evidence for disulfide bridges and a putative protein disulfide isomerase gene. Eur J Biochem 237, 447–453.[Medline]

Dunn, N. W. & Holloway, B. W. (1971). Pleiotropy of p-fluorophenylalanine-resistant and antibiotic hypersensitive mutant of Pseudomonas aeruginosa. Genet Res 18, 185–197.[Medline]

Farinha, M. A. & Kropinski, A. M. (1990). Construction of broad-host-range plasmid vectors for easy visible selection and analysis of promoters. J Bacteriol 172, 3496–3499.[Abstract/Free Full Text]

Guest, J. R. (1992). Oxygen-regulated gene expression in Escherichia coli. The 1992 Marjory Stephenson Prize Lecture. J Gen Microbiol 138, 2253–2263.[Free Full Text]

Hasegawa, N., Arai, H. & Igarashi, Y. (1998). Activation of a consensus FNR-dependent promoter by DNR of Pseudomonas aeruginosa in response to nitrite. FEMS Microbiol Lett 166, 213–217.[CrossRef][Medline]

Hendriks, J. H. M., Prior, L., Baker, A. R., Thomson, A. J., Saraste, M. & Watmough, N. J. (2001). Reaction of carbon monoxide with the reduced active site of bacterial nitric oxide reductase. Biochemistry 40, 13361–13369.[CrossRef][Medline]

Hulse, C. L. & Averill, B. A. (1990). Isolation of a high specific activity pink, monomeric nitrous oxide reductase from Achromobacter cycloclastes. Biochem Biophys Res Commun 166, 729–735.[CrossRef][Medline]

Hutchings, M. I., Shearer, N., Wastell, S., van Spanning, R. J. M. & Spiro, S. (2000). Heterologous NNR-mediated nitric oxide signaling in Escherichia coli. J Bacteriol 182, 6434–6439.[Abstract/Free Full Text]

Jüngst, A., Braun, C. & Zumft, W. G. (1991). Close linkage in Pseudomonas stutzeri of the structural genes for respiratory nitrite reductase and nitrous oxide reductase, and other essential genes for denitrification. Mol Gen Genet 225, 241–248.[CrossRef][Medline]

Kawasaki, S., Arai, H., Igarashi, Y. & Kodama, T. (1995). Sequencing and characterization of the downstream region of the genes encoding nitrite reductase and cytochrome c-551 (nirSM) from Pseudomonas aeruginosa: identification of the gene necessary for biosynthesis of heme d1. Gene 167, 87–91.[CrossRef][Medline]

Kiley, P. J. & Beinert, H. (1999). Oxygen sensing by the global regulator, FNR: the role of the iron–sulfur cluster. FEMS Microbiol Rev 22, 341–352.[CrossRef]

Kwiatkowski, A. V., Laratta, W. P., Toffanin, A. & Shapleigh, J. P. (1997). Analysis of the role of the nnrR gene product in the response of Rhodobacter sphaeroides 2.4.1 to exogenous nitric oxide. J Bacteriol 179, 5618–5620.[Abstract/Free Full Text]

Lide, D. R. (editor) (1999). CRC Handbook of Chemistry and Physics, 80th edn, pp. 8–87. Boca Raton, FL: CRC Press.

Lodge, J., Williams, R., Bell, A., Chan, B. & Busby, S. (1990). Comparison of promoter activities in Escherichia coli and Pseudomonas aeruginosa: use of a new broad-host-range promoter-probe plasmid. FEMS Microbiol Lett 67, 221–225.[CrossRef]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Saunders, N. F. W., Houben, E. N. G., Koefoed, S., de Weert, S., Reijnders, W. N. M., Westerhoff, H. V., de Boer, A. P. N. & van Spanning, R. J. M. (1999). Transcription regulation of the nir gene cluster encoding nitrite reductase of Paracoccus denitrificans involves NNR and NirI, a novel type of membrane protein. Mol Microbiol 34, 24–36.[CrossRef][Medline]

Snyder, S. W. & Hollocher, T. C. (1987). Purification and some characteristics of nitrous oxide reductase from Paracoccus denitrificans. J Biol Chem 262, 6515–6525.[Abstract/Free Full Text]

Snyder, S. W., Bazylinski, D. A. & Hollocher, T. C. (1987). Loss of N2O reductase activity as an explanation for poor growth of Pseudomonas aeruginosa on N2O. Appl Environ Microbiol 53, 2045–2049.[Abstract/Free Full Text]

SooHoo, C. K. & Hollocher, T. C. (1990). Loss of nitrous oxide reductase in Pseudomonas aeruginosa cultured under N2O as determined by rocket immunoelectrophoresis. Appl Environ Microbiol 56, 3591–3592.[Abstract/Free Full Text]

SooHoo, C. K. & Hollocher, T. C. (1991). Purification and characterization of nitrous oxide reductase from Pseudomonas aeruginosa strain P2. J Biol Chem 266, 2203–2209.[Abstract/Free Full Text]

Stover, C. K., Pham, X. Q., Erwin, A. L. & 28 other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959–964.[CrossRef][Medline]

Viebrock, A. & Zumft, W. G. (1988). Molecular cloning, heterologous expression, and primary structure of the structural gene for the copper enzyme nitrous oxide reductase from denitrifying Pseudomonas stutzeri. J Bacteriol 170, 4658–4668.[Abstract/Free Full Text]

Vollack, K.-U. & Zumft, W. G. (2001). Nitric oxide signaling and transcriptional control of denitrification genes in Pseudomonas stutzeri. J Bacteriol 183, 2516–2526.[Abstract/Free Full Text]

Wood, P. M. (1978). Periplasmic location of the terminal reductase in nitrite respiration. FEBS Lett 92, 214–218.[CrossRef][Medline]

Ye, R. W., Arunakumari, A., Averill, B. A. & Tiedje, J. M. (1992). Mutants of Pseudomonas fluorescens deficient in dissimilatory nitrite reduction are also altered in nitric oxide reduction. J Bacteriol 174, 2560–2564.[Abstract/Free Full Text]

Ye, R. W., Haas, D., Ka, J.-O., Krishnapillai, V., Zimmermann, A., Baird, C. & Tiedje, J. M. (1995). Anaerobic activation of the entire denitrification pathway in Pseudomonas aeruginosa requires Anr, an analog of Fnr. J Bacteriol 177, 3606–3609.[Abstract/Free Full Text]

Zimmermann, A., Reimmann, C., Galimand, M. & Haas, D. (1991). Anaerobic growth and cyanide synthesis of Pseudomonas aeruginosa depend on anr, a regulatory gene homologous with fnr of Escherichia coli. Mol Microbiol 5, 1483–1490.[Medline]

Zumft, W. G. (1993). The biological role of nitric oxide in bacteria. Arch Microbiol 160, 253–264.[CrossRef][Medline]

Zumft, W. G., Viebrock-Sambale, A. & Braun, C. (1990). Nitrous oxide reductase from denitrifying Pseudomonas stutzeri. Genes for copper-processing and properties of the deduced products, including a new member of the family of ATP/GTP-binding proteins. Eur J Biochem 192, 591–599.[Medline]

Zumft, W. G., Dreusch, A., Löchelt, S., Cuypers, H., Friedrich, B. & Schneider, B. (1992). Derived amino acid sequences of the nosZ gene (respiratory N2O reductase) from Alcaligenes eutrophus, Pseudomonas aeruginosa and Pseudomonas stutzeri reveal potential copper-binding residues. Implications for the CuA site of N2O reductase and cytochrome-c oxidase. Eur J Biochem 208, 31–40.[Medline]

Received 6 August 2002; revised 17 September 2002; accepted 25 September 2002.


This article has been cited by other articles:


Home page
MicrobiologyHome page
N. Castiglione, S. Rinaldo, G. Giardina, and F. Cutruzzola
The transcription factor DNR from Pseudomonas aeruginosa specifically requires nitric oxide and haem for the activation of a target promoter in Escherichia coli
Microbiology, September 1, 2009; 155(9): 2838 - 2844.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Saleh-Lakha, K. E. Shannon, S. L. Henderson, B. J. Zebarth, D. L. Burton, C. Goyer, and J. T. Trevors
Effect of Nitrate and Acetylene on nirS, cnorB, and nosZ Expression and Denitrification Activity in Pseudomonas mandelii
Appl. Envir. Microbiol., August 1, 2009; 75(15): 5082 - 5087.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Toyofuku, N. Nomura, E. Kuno, Y. Tashiro, T. Nakajima, and H. Uchiyama
Influence of the Pseudomonas Quinolone Signal on Denitrification in Pseudomonas aeruginosa
J. Bacteriol., December 15, 2008; 190(24): 7947 - 7956.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
B. Benkert, N. Quack, K. Schreiber, L. Jaensch, D. Jahn, and M. Schobert
Nitrate-responsive NarX-NarL represses arginine-mediated induction of the Pseudomonas aeruginosa arginine fermentation arcDABC operon
Microbiology, October 1, 2008; 154(10): 3053 - 3060.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
I. Kukavica-Ibrulj, F. Sanschagrin, A. Peterson, M. Whiteley, B. Boyle, J. MacKay, and R. C. Levesque
Functional genomics of PycR, a LysR family transcriptional regulator essential for maintenance of Pseudomonas aeruginosa in the rat lung
Microbiology, July 1, 2008; 154(7): 2106 - 2118.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. D. Platt, M. J. Schurr, K. Sauer, G. Vazquez, I. Kukavica-Ibrulj, E. Potvin, R. C. Levesque, A. Fedynak, F. S. L. Brinkman, J. Schurr, et al.
Proteomic, Microarray, and Signature-Tagged Mutagenesis Analyses of Anaerobic Pseudomonas aeruginosa at pH 6.5, Likely Representing Chronic, Late-Stage Cystic Fibrosis Airway Conditions
J. Bacteriol., April 15, 2008; 190(8): 2739 - 2758.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Toyofuku, N. Nomura, T. Fujii, N. Takaya, H. Maseda, I. Sawada, T. Nakajima, and H. Uchiyama
Quorum Sensing Regulates Denitrification in Pseudomonas aeruginosa PAO1
J. Bacteriol., July 1, 2007; 189(13): 4969 - 4972.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. Schreiber, R. Krieger, B. Benkert, M. Eschbach, H. Arai, M. Schobert, and D. Jahn
The Anaerobic Regulatory Network Required for Pseudomonas aeruginosa Nitrate Respiration
J. Bacteriol., June 1, 2007; 189(11): 4310 - 4314.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. M. Nakano, H. Geng, S. Nakano, and K. Kobayashi
The Nitric Oxide-Responsive Regulator NsrR Controls ResDE-Dependent Gene Expression.
J. Bacteriol., August 1, 2006; 188(16): 5878 - 5887.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S.-H. Baek and J. P. Shapleigh
Expression of Nitrite and Nitric Oxide Reductases in Free-Living and Plant-Associated Agrobacterium tumefaciens C58 Cells
Appl. Envir. Microbiol., August 1, 2005; 71(8): 4427 - 4436.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
H. Arai, M. Hayashi, A. Kuroi, M. Ishii, and Y. Igarashi
Transcriptional Regulation of the Flavohemoglobin Gene for Aerobic Nitric Oxide Detoxification by the Second Nitric Oxide-Responsive Regulator of Pseudomonas aeruginosa
J. Bacteriol., June 15, 2005; 187(12): 3960 - 3968.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. Wunsch and W. G. Zumft
Functional Domains of NosR, a Novel Transmembrane Iron-Sulfur Flavoprotein Necessary for Nitrous Oxide Respiration
J. Bacteriol., March 15, 2005; 187(6): 1992 - 2001.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. S. Hong, A. Kuroda, N. Takiguchi, H. Ohtake, and J. Kato
Expression of Pseudomonas aeruginosa aer-2, One of Two Aerotaxis Transducer Genes, Is Controlled by RpoS
J. Bacteriol., February 15, 2005; 187(4): 1533 - 1535.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.
Agricola
Right arrow Articles by Arai, H.
Right arrow Articles by Igarashi, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2003 Society for General Microbiology.