|
|
||||||||
Department of Biotechnology, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan
Correspondence
Hiroyuki Arai
aharai{at}mail.ecc.u-tokyo.ac.jp
| ABSTRACT |
|---|
|
|
|---|
Abbreviations: GSNO, S-nitrosoglutathione; SNP, sodium nitroprusside; N2OR, nitrous oxide reductase; NIR, nitrite reductase; NOR, nitric oxide reductase
| INTRODUCTION |
|---|
|
|
|---|
Genome sequencing of P. aeruginosa PAO1 has shown that the arrangement of the nosRZDFYL genes (PA3391PA3396) is identical to that of P. stutzeri (Stover et al., 2000
); however, the nos gene cluster of strain PAO1 is located separately from the nirnor gene cluster encoding NIR and NOR (Arai et al., 1995a
). Identities of nucleotide sequences of the nos genes with correspondents from P. stutzeri are (in %) nosR, 75, nosZ, 80, nosD, 71, nosF, 70, nosY, 77 and nosL, 60, respectively. The nos genes are probably transcribed as an operon because the genes are located close to one another or overlap in P. aeruginosa.
Many denitrifying bacteria can grow on N2O as the only electron acceptor under anaerobic conditions. However, P. aeruginosa cannot grow on exogenous N2O as the only electron acceptor, although it can utilize endogenous N2O for the generation of energy for growth during denitrification (Bryan et al., 1985
; Carlson & Ingraham, 1983
). P. aeruginosa does not express N2OR in response to exposure to N2O, indicating that the expression of N2OR is regulated by a molecule other than N2O (SooHoo & Hollocher, 1990
). Thus, the regulatory mechanism of N2OR of P. aeruginosa seems to be different from that of other denitrifiers that can grow on N2O, such as P. stutzeri.
The expression of the nir and nor genes is regulated by two FNR-like regulators, ANR and DNR, in P. aeruginosa (Arai et al., 1995b
, 1997
). FNR of Escherichia coli is structurally similar to the CRP that is involved in the catabolite repression control of E. coli (Guest, 1992
). FNR regulates the expression of many genes that are required for anaerobic growth when oxygen is depleted. Four cysteine residues are involved in sensing oxygen depletion through the formation of a 4Fe4S cluster (Kiley & Beinert, 1999
). ANR carries the four cysteine residues and is a functional analogue of FNR (Zimmermann et al., 1991
). DNR does not carry the cysteine residues and is proposed to sense the existence of N-oxides, especially NO, rather than oxygen limitation (Arai et al., 1995b
, 1999b
). The promoters regulated by FNR-like regulators have a sequence similar to the consensus FNR-binding motif (FNR box) (TTGAT----ATCAA), and both ANR and DNR recognize the consensus FNR box (Hasegawa et al., 1998
). There are motifs similar to the FNR box in the promoter regions of the nir and nor operons, but the nir and nor promoters are activated only by DNR and not by ANR. Because expression of DNR is under the control of ANR, transcription of the nir and nor genes is regulated indirectly by ANR. This ANRDNR dual regulatory system causes the expression of the nir and nor genes under anaerobic conditions in the presence of N-oxides (Arai et al., 1997
). The FNR box is also found in the upstream region of nosR, suggesting that the nos genes are also under the control of DNR and/or ANR. In this study, we analysed the transcriptional regulation of the nos genes and the role of DNR in their regulation.
| METHODS |
|---|
|
|
|---|
|
DNA manipulations and ß-galactosidase assay.
The recombinant DNA experiments were carried out by standard methods (Sambrook et al., 1989
). Introduction of DNA into P. aeruginosa strains was carried out as described previously (Arai et al., 1995c
) or by electroporation with a Cell-Porator (BRL Life Technologies). Restriction and modification enzymes were purchased from Toyobo or Takara. EX Taq (Takara) was used for PCR. Synthetic oligonucleotides were prepared by Sawady Technology. ß-Galactosidase assays were performed using the standard protocol (Sambrook et al., 1989
).
Cloning of the nos gene cluster.
Three overlapping fragments (4·7 kb SphI, 4·2 kb PstI and 1·6 kb KpnI) that carry the nos genes of strain PAO1 were cloned by using pUC19 as a vector; the resulting plasmids were designated pMM1, pMM2 and pMM3, respectively (Fig. 1
). We used a DIG DNA labelling and detection kit (Boehringer Mannheim) and a Hybond-N nylon membrane (Amersham Pharmacia Biotech) for Southern blotting and colony hybridization. The probe used for cloning the 4·7 kb SphI fragment was a 0·6 kb fragment of the nosZ gene that was amplified by PCR with oligonucleotides probeA (GAAGCTTGACGTGCACTACCAGCCGGGTCA) and probeB (GCAGAACCAGCTGCAGTAGTACCAGTGCAG) from the chromosomal DNA of strain PAO1. The oligonucleotides were designed from the sequence of the nosZ gene of P. aeruginosa DSM 57001T (Zumft et al., 1992
). A 1·7 kb PstISphI fragment from pMM1 was used as a probe for cloning the 4·2 kb PstI fragment. The probe used for cloning the 1·6 kb KpnI fragment was a 0·6 kb PCR fragment of the 5' region of the nosR gene that was amplified with oligonucleotides NRPF (GGCAGATCTGTTACCTGAAGGCGCTGGGC) and NRPR (GGCGGTACCGTCTGGAAGGCGTAGCCGAG). The oligonucleotides were designed from the sequence obtained from the Pseudomonas Genome Project (http://www.pseudomonas.com).
|
pHA1241
R was constructed by digestion of pHA1241 with KpnI and self-ligation after removing protruding 3' termini with T4 DNA polymerase. A frame-shift mutation was introduced into the nosR gene on the plasmid by this operation. pHA1241NN and pHA1243NN have a mutated FNR-binding motif (TTGACTTTCATCAA
cTGACTTTCATCAg). The mutation was introduced by PCR with oligonucleotides nos13 (CCACTTCCTGACTTTCATCAGGCGCGTTCC) and nos14 (complementary to nos13) as described previously (Arai et al., 1999a
).
Construction of mutant strains.
A nosR-deficient strain, RM1301T, was constructed from strain PAO1 by insertion of the tetracycline-resistance gene (tet) into nosR by homologous recombination using pMM1301T (Fig. 1
); the method of homologous recombination has been described previously (Arai et al., 1995c
). The mutation was confirmed by Southern hybridization analysis (data not shown). pMM1301T was constructed as follows. A 2·7 kb KpnIKpnISmaI fragment containing the nosR gene from pMM1 and pMM3 was cloned into the KpnISmaI sites of pUC19. The resultant plasmid was digested with ClaI and ligated with an end-blunted 1·4 kb EcoRIAvaI fragment of pBR322, which carried the tet gene, resulting in pMM1301T. An anr and dnr double mutant strain, DM536, was constructed from the anr-deficient strain PAO6261 (Ye et al., 1995
) by using pHA536 as described previously (Arai et al., 1995b
). Insertion of the tet gene was confirmed by PCR (data not shown).
RNA extraction and primer extension analysis.
Strain PAO1 was cultivated anaerobically in LB medium supplemented with 5 mM sodium nitrite. Total RNA was isolated at mid-exponential phase by using ISOGEN (Nippon Gene), according to the manufacturer's instructions, and was treated with RNase-free DNase (Nippon Gene). The primer extension reaction was performed with Superscript II (Gibco-BRL). The oligonucleotide primer used for the reaction was nos9 (GACACACCGCCACGATCCG), which was complementary to the mRNA of nosR. The primer was labelled with [
-32P]ATP (Amersham Pharmacia Biotech) by using T4 polynucleotide kinase. The labelled primer and RNA were annealed at 70 °C for 10 min. Extension was carried out at 42 °C for 30 min. The primer extension product was compared on an 8 % polyacrylamide/6 M urea gel with the products of sequence reactions made with the same primer.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
R), the promoter activity was almost identical to that of pHA1243 (Table 2
We determined the promoter activity from pHA1241, pHA1242, pHA1243 and pHA1241
R in the nosR-deficient strain RM1301T. The activity from pHA1241 was about twice as high as that from pHA1243 or pHA1241
R, as in the case of strain PAO1 (Table 2
). The activities in strain RM1301T were about 30 % higher than those in strain PAO1. These results indicated that nosR is not necessary for the activity of the nosR promoter because the complete nosR gene did not exist in strain RM1301T carrying pHA1243 or pHA1241
R.
Analysis of the nosR promoter sequence
The transcriptional initiation site of the nosR promoter was determined by primer extension analysis (Fig. 2
). The mRNA used for the template was prepared from cells of strain PAO1 grown anaerobically with sodium nitrite as an electron acceptor. A major transcriptional start point of nosR was found 77 bp upstream from the initiation codon. In addition, a minor transcriptional start point was found adjacent to the major point. There is a sequence (TTGACTTTCATCAA) similar to the consensus FNR box (TTGAT----ATCAA) in the promoter region. The sequence is centred at -41·5 bp from the major transcriptional start point. This distance is typical of the promoters activated by the FNR-type regulators (Guest, 1992
). No typical -10 sequence was found in this region. A primer extension reaction was also carried out with a primer complementary to nosZ or nosD, but no clear band was detected, suggesting that there is no promoter just upstream of nosZ or nosD (data not shown).
|
C at -48 and A
G at -35 from the major transcriptional start point) into pHA1241 and pHA1243, resulting in pHA1241NN and pHA1243NN, respectively. The mutations were designed to disrupt the consensus sequence but not the palindromic structure of the motif (Lodge et al., 1990
We have reported that both of the FNR-like regulators of Pseudomonas aeruginosa, ANR and DNR, can activate an artificial FNR-dependent promoter (Hasegawa et al., 1998
). It is still unknown how ANR and DNR distinguish their target promoters. To investigate the roles of ANR and DNR in P. aeruginosa, we constructed an anr and dnr double mutant strain, DM536, and measured the nosR promoter activity in this strain. When strain DM536 was transformed with pHA411, which carries anr, the nosR promoter activity from pHA1243 was very low (Table 2
). In contrast, when strain DM536 was transformed with pHA541
, which carries dnr, the activity was nearly identical to that in strain PAO1. These results clearly demonstrated that the nos genes are in the DNR regulon and therefore in the ANR/DNR-regulatory cascade, as was the case for the nir and nor genes. It is probable that the FNR-binding motif of the nosR promoter is recognized only by DNR.
NO-responding induction of the nosR promoter
We have reported that the expression of the nir and nor genes is regulated by DNR (Arai et al., 1997
). NO is a major signal for DNR-dependent transcriptional activation (Arai et al., 1999b
). We investigated the signal molecule for induction of the nos genes by measuring the nosR promoter activity from pHA1243 in the presence of N-oxides or NO-generating reagents (Table 3
). Synthetic medium was used so that we could clearly see the effects of the added compounds. In the wild-type strain PAO1, the nosR promoter activity was highest in the presence of 5 mM
. The activity was also high when NO gas was added to the head space of the incubation vial. The NO-generating reagents SNP and GSNO also activated the promoter. In contrast, no activity was detected when the air in the vial was replaced with N2O. These results indicated that the signal for the activation of the nosR promoter was NO or related reactive nitrogen species and that N2O does not induce the genes for its own reductase. P. aeruginosa does not grow on exogenous N2O as the only terminal electron acceptor of anaerobic respiration, although it can produce energy for growth at the expense of endogenous N2O (Bryan et al., 1985
; Carlson & Ingraham, 1983
). It has been reported that P. aeruginosa does not express N2OR when exposed to N2O under anaerobic conditions (Snyder et al., 1987
; SooHoo & Hollocher, 1990
). The results that the transcription of the nos genes is regulated not by N2O but by NO clearly explain why P. aeruginosa does not grow on exogenous N2O.
|
was significantly lower than that in strain PAO1 (Table 3
. The NO-generating reagents SNP and GSNO induced the nosR promoter, as was the case for strain PAO1. However, the activity of the promoter in the presence of gaseous NO was about a third that of strain PAO1. It has been reported that the in vivo activities of NIR and NOR couple with each other (Ye et al., 1992
or gaseous NO was lower than that in strain PAO1. The low activity might have been caused by the toxicity of the large amount of NO that was produced from
or added exogenously. Interestingly, the promoter activity in strain RM495 was high in the presence of 0·1 mM
, while the activity was very low in other strains. That was probably because NO produced from
was not further metabolized and therefore a suitable concentration was maintained for the activation of the nosR promoter. Such a phenomenon has been observed for the norC and nirQ promoters (Arai et al., 1999b
The nosR promoter activity was not induced by CO in strain PAO1 (Table 3
), but high activity occurred when 0·1 mM
was added to the medium in the CO atmosphere. Because 0·1 mM
alone did not activate the promoter, the high activity must be the result of the synergistic effect of CO and
. CO is known to bind to the active site of NOR (Hendriks et al., 2001
). It is probable that NOR was inhibited by the CO and that the NO produced from
was not further metabolized as in the case of strain RM495.
It has been shown that the nosR promoter of P. aeruginosa is activated by DNR in the presence of NO. The nosR promoter of P. stutzeri is also reported to be regulated by NO (Vollack & Zumft, 2001
). NO might be sensed directly by DNR, because DNR and corresponding regulators such as DnrD of P. stutzeri, NNR of Paracoccus denitrificans and NnrR of Rhodobacter sphaeroides have been shown to be involved in the NO-responding regulation of the denitrification genes (Arai et al., 1999b
; Kwiatkowski et al., 1997
; Hutchings et al., 2000
; Vollack & Zumft, 2001
). The mechanism of NO-sensing by DNR is still unclear, and no cofactor has been identified yet. CooA, a CRP/FNR-related CO-sensing regulator of Rhodospirillum rubrum, uses b-type haem as a cofactor for sensing of CO (Aono et al., 1996
). Because CO had no direct effect on the nosR promoter activity, the NO-sensing mechanism of DNR must be different from the CO-sensing mechanism of CooA.
| REFERENCES |
|---|
|
|
|---|
Arai, H., Igarashi, Y. & Kodama, T. (1994). Structure and ANR-dependent transcription of the nir genes for denitrification from Pseudomonas aeruginosa. Biosci Biotechnol Biochem 58, 12861291.[Medline]
Arai, H., Igarashi, Y. & Kodama, T. (1995a). The structural genes for nitric oxide reductase from Pseudomonas aeruginosa. Biochim Biophys Acta 1261, 279284.[Medline]
Arai, H., Igarashi, Y. & Kodama, T. (1995b). Expression of the nir and nor genes for denitrification of Pseudomonas aeruginosa requires a novel CRP/FNR-related transcriptional regulator, DNR, in addition to ANR. FEBS Lett 371, 7376.[CrossRef][Medline]
Arai, H., Zhang, Y., Sambongi, Y., Igarashi, Y. & Kodama, T. (1995c). Production of recombinant cytochrome c-551 in a Pseudomonas aeruginosa mutant strain. J Ferment Bioeng 79, 489492.[CrossRef]
Arai, H., Kodama, T. & Igarashi, Y. (1997). Cascade regulation of the two CRP/FNR-related transcriptional regulators (ANR and DNR) and the denitrification enzymes in Pseudomonas aeruginosa. Mol Microbiol 25, 11411148.[CrossRef][Medline]
Arai, H., Akahira, S., Ohishi, T. & Kudo, T. (1999a). Adaptation of Comamonas testosteroni TA441 to utilization of phenol by spontaneous mutation of the gene for a trans-acting factor. Mol Microbiol 33, 11321140.[CrossRef][Medline]
Arai, H., Kodama, T. & Igarashi, Y. (1999b). Effect of nitrogen oxides on expression of the nir and nor genes for denitrification in Pseudomonas aeruginosa. FEMS Microbiol Lett 170, 1924.[CrossRef][Medline]
Braun, C. & Zumft, W. G. (1992). The structural genes of the nitric oxide reductase complex from Pseudomonas stutzeri are part of a 30-kilobase gene cluster for denitrification. J Bacteriol 174, 23942397.
Brown, K., Tegoni, M., Prudencio, M., Pereira, A. S., Besson, S., Moura, J. J., Moura, I. & Cambillau, C. (2000). A novel type of catalytic copper cluster in nitrous oxide reductase. Nat Struct Biol 7, 191195.[CrossRef][Medline]
Bryan, B. A., Jeter, R. M. & Carlson, C. A. (1985). Inability of Pseudomonas stutzeri denitrification mutants with the phenotype of Pseudomonas aeruginosa to grow in nitrous oxide. Appl Environ Microbiol 50, 13011303.
Carlson, C. A. & Ingraham, J. L. (1983). Comparison of denitrification by Pseudomonas stutzeri, Pseudomonas aeruginosa, and Paracoccus denitrificans. Appl Environ Microbiol 45, 12471253.
Coyle, C. L., Zumft, W. G., Kroneck, P. M., Körner, H. & Jakob, W. (1985). Nitrous oxide reductase from denitrifying Pseudomonas perfectomarina. Purification and properties of a novel multicopper enzyme. Eur J Biochem 153, 459467.[Medline]
Cuypers, H., Viebrock-Sambale, A. & Zumft, W. G. (1992). NosR, a membrane-bound regulatory component necessary for expression of nitrous oxide reductase in denitrifying Pseudomonas stutzeri. J Bacteriol 174, 53325339.
Cuypers, H., Berghöfer, J. & Zumft, W. G. (1995). Multiple nosZ promoters and anaerobic expression of nos genes necessary for Pseudomonas stutzeri nitrous oxide reductase and assembly of its copper centers. Biochim Biophys Acta 1264, 183190.[Medline]
Dreusch, A., Riester, J., Kroneck, P. M. & Zumft, W. G. (1996). Mutation of the conserved Cys165 outside of the CuA domain destabilizes nitrous oxide reductase but maintains its catalytic activity. Evidence for disulfide bridges and a putative protein disulfide isomerase gene. Eur J Biochem 237, 447453.[Medline]
Dunn, N. W. & Holloway, B. W. (1971). Pleiotropy of p-fluorophenylalanine-resistant and antibiotic hypersensitive mutant of Pseudomonas aeruginosa. Genet Res 18, 185197.[Medline]
Farinha, M. A. & Kropinski, A. M. (1990). Construction of broad-host-range plasmid vectors for easy visible selection and analysis of promoters. J Bacteriol 172, 34963499.
Guest, J. R. (1992). Oxygen-regulated gene expression in Escherichia coli. The 1992 Marjory Stephenson Prize Lecture. J Gen Microbiol 138, 22532263.[Medline]
Hasegawa, N., Arai, H. & Igarashi, Y. (1998). Activation of a consensus FNR-dependent promoter by DNR of Pseudomonas aeruginosa in response to nitrite. FEMS Microbiol Lett 166, 213217.[CrossRef][Medline]
Hendriks, J. H. M., Prior, L., Baker, A. R., Thomson, A. J., Saraste, M. & Watmough, N. J. (2001). Reaction of carbon monoxide with the reduced active site of bacterial nitric oxide reductase. Biochemistry 40, 1336113369.[CrossRef][Medline]
Hulse, C. L. & Averill, B. A. (1990). Isolation of a high specific activity pink, monomeric nitrous oxide reductase from Achromobacter cycloclastes. Biochem Biophys Res Commun 166, 729735.[CrossRef][Medline]
Hutchings, M. I., Shearer, N., Wastell, S., van Spanning, R. J. M. & Spiro, S. (2000). Heterologous NNR-mediated nitric oxide signaling in Escherichia coli. J Bacteriol 182, 64346439.
Jüngst, A., Braun, C. & Zumft, W. G. (1991). Close linkage in Pseudomonas stutzeri of the structural genes for respiratory nitrite reductase and nitrous oxide reductase, and other essential genes for denitrification. Mol Gen Genet 225, 241248.[CrossRef][Medline]
Kawasaki, S., Arai, H., Igarashi, Y. & Kodama, T. (1995). Sequencing and characterization of the downstream region of the genes encoding nitrite reductase and cytochrome c-551 (nirSM) from Pseudomonas aeruginosa: identification of the gene necessary for biosynthesis of heme d1. Gene 167, 8791.[CrossRef][Medline]
Kiley, P. J. & Beinert, H. (1999). Oxygen sensing by the global regulator, FNR: the role of the ironsulfur cluster. FEMS Microbiol Rev 22, 341352.[CrossRef]
Kwiatkowski, A. V., Laratta, W. P., Toffanin, A. & Shapleigh, J. P. (1997). Analysis of the role of the nnrR gene product in the response of Rhodobacter sphaeroides 2.4.1 to exogenous nitric oxide. J Bacteriol 179, 56185620.
Lide, D. R. (editor) (1999). CRC Handbook of Chemistry and Physics, 80th edn, pp. 887. Boca Raton, FL: CRC Press.
Lodge, J., Williams, R., Bell, A., Chan, B. & Busby, S. (1990). Comparison of promoter activities in Escherichia coli and Pseudomonas aeruginosa: use of a new broad-host-range promoter-probe plasmid. FEMS Microbiol Lett 67, 221225.[CrossRef]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Saunders, N. F. W., Houben, E. N. G., Koefoed, S., de Weert, S., Reijnders, W. N. M., Westerhoff, H. V., de Boer, A. P. N. & van Spanning, R. J. M. (1999). Transcription regulation of the nir gene cluster encoding nitrite reductase of Paracoccus denitrificans involves NNR and NirI, a novel type of membrane protein. Mol Microbiol 34, 2436.[CrossRef][Medline]
Snyder, S. W. & Hollocher, T. C. (1987). Purification and some characteristics of nitrous oxide reductase from Paracoccus denitrificans. J Biol Chem 262, 65156525.
Snyder, S. W., Bazylinski, D. A. & Hollocher, T. C. (1987). Loss of N2O reductase activity as an explanation for poor growth of Pseudomonas aeruginosa on N2O. Appl Environ Microbiol 53, 20452049.
SooHoo, C. K. & Hollocher, T. C. (1990). Loss of nitrous oxide reductase in Pseudomonas aeruginosa cultured under N2O as determined by rocket immunoelectrophoresis. Appl Environ Microbiol 56, 35913592.
SooHoo, C. K. & Hollocher, T. C. (1991). Purification and characterization of nitrous oxide reductase from Pseudomonas aeruginosa strain P2. J Biol Chem 266, 22032209.
Stover, C. K., Pham, X. Q., Erwin, A. L. & 28 other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959964.[CrossRef][Medline]
Viebrock, A. & Zumft, W. G. (1988). Molecular cloning, heterologous expression, and primary structure of the structural gene for the copper enzyme nitrous oxide reductase from denitrifying Pseudomonas stutzeri. J Bacteriol 170, 46584668.
Vollack, K.-U. & Zumft, W. G. (2001). Nitric oxide signaling and transcriptional control of denitrification genes in Pseudomonas stutzeri. J Bacteriol 183, 25162526.
Wood, P. M. (1978). Periplasmic location of the terminal reductase in nitrite respiration. FEBS Lett 92, 214218.[CrossRef][Medline]
Ye, R. W., Arunakumari, A., Averill, B. A. & Tiedje, J. M. (1992). Mutants of Pseudomonas fluorescens deficient in dissimilatory nitrite reduction are also altered in nitric oxide reduction. J Bacteriol 174, 25602564.
Ye, R. W., Haas, D., Ka, J.-O., Krishnapillai, V., Zimmermann, A., Baird, C. & Tiedje, J. M. (1995). Anaerobic activation of the entire denitrification pathway in Pseudomonas aeruginosa requires Anr, an analog of Fnr. J Bacteriol 177, 36063609.
Zimmermann, A., Reimmann, C., Galimand, M. & Haas, D. (1991). Anaerobic growth and cyanide synthesis of Pseudomonas aeruginosa depend on anr, a regulatory gene homologous with fnr of Escherichia coli. Mol Microbiol 5, 14831490.[Medline]
Zumft, W. G. (1993). The biological role of nitric oxide in bacteria. Arch Microbiol 160, 253264.[CrossRef][Medline]
Zumft, W. G., Viebrock-Sambale, A. & Braun, C. (1990). Nitrous oxide reductase from denitrifying Pseudomonas stutzeri. Genes for copper-processing and properties of the deduced products, including a new member of the family of ATP/GTP-binding proteins. Eur J Biochem 192, 591599.[Medline]
Zumft, W. G., Dreusch, A., Löchelt, S., Cuypers, H., Friedrich, B. & Schneider, B. (1992). Derived amino acid sequences of the nosZ gene (respiratory N2O reductase) from Alcaligenes eutrophus, Pseudomonas aeruginosa and Pseudomonas stutzeri reveal potential copper-binding residues. Implications for the CuA site of N2O reductase and cytochrome-c oxidase. Eur J Biochem 208, 3140.[Medline]
Received 6 August 2002;
revised 17 September 2002;
accepted 25 September 2002.
This article has been cited by other articles:
![]() |
B. Benkert, N. Quack, K. Schreiber, L. Jaensch, D. Jahn, and M. Schobert Nitrate-responsive NarX-NarL represses arginine-mediated induction of the Pseudomonas aeruginosa arginine fermentation arcDABC operon Microbiology, October 1, 2008; 154(10): 3053 - 3060. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kukavica-Ibrulj, F. Sanschagrin, A. Peterson, M. Whiteley, B. Boyle, J. MacKay, and R. C. Levesque Functional genomics of PycR, a LysR family transcriptional regulator essential for maintenance of Pseudomonas aeruginosa in the rat lung Microbiology, July 1, 2008; 154(7): 2106 - 2118. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Platt, M. J. Schurr, K. Sauer, G. Vazquez, I. Kukavica-Ibrulj, E. Potvin, R. C. Levesque, A. Fedynak, F. S. L. Brinkman, J. Schurr, et al. Proteomic, Microarray, and Signature-Tagged Mutagenesis Analyses of Anaerobic Pseudomonas aeruginosa at pH 6.5, Likely Representing Chronic, Late-Stage Cystic Fibrosis Airway Conditions J. Bacteriol., April 15, 2008; 190(8): 2739 - 2758. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Toyofuku, N. Nomura, T. Fujii, N. Takaya, H. Maseda, I. Sawada, T. Nakajima, and H. Uchiyama Quorum Sensing Regulates Denitrification in Pseudomonas aeruginosa PAO1 J. Bacteriol., July 1, 2007; 189(13): 4969 - 4972. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schreiber, R. Krieger, B. Benkert, M. Eschbach, H. Arai, M. Schobert, and D. Jahn The Anaerobic Regulatory Network Required for Pseudomonas aeruginosa Nitrate Respiration J. Bacteriol., June 1, 2007; 189(11): 4310 - 4314. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Nakano, H. Geng, S. Nakano, and K. Kobayashi The Nitric Oxide-Responsive Regulator NsrR Controls ResDE-Dependent Gene Expression. J. Bacteriol., August 1, 2006; 188(16): 5878 - 5887. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Baek and J. P. Shapleigh Expression of Nitrite and Nitric Oxide Reductases in Free-Living and Plant-Associated Agrobacterium tumefaciens C58 Cells Appl. Envir. Microbiol., August 1, 2005; 71(8): 4427 - 4436. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Arai, M. Hayashi, A. Kuroi, M. Ishii, and Y. Igarashi Transcriptional Regulation of the Flavohemoglobin Gene for Aerobic Nitric Oxide Detoxification by the Second Nitric Oxide-Responsive Regulator of Pseudomonas aeruginosa J. Bacteriol., June 15, 2005; 187(12): 3960 - 3968. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Wunsch and W. G. Zumft Functional Domains of NosR, a Novel Transmembrane Iron-Sulfur Flavoprotein Necessary for Nitrous Oxide Respiration J. Bacteriol., March 15, 2005; 187(6): 1992 - 2001. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Hong, A. Kuroda, N. Takiguchi, H. Ohtake, and J. Kato Expression of Pseudomonas aeruginosa aer-2, One of Two Aerotaxis Transducer Genes, Is Controlled by RpoS J. Bacteriol., February 15, 2005; 187(4): 1533 - 1535. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |