|
|
||||||||
array and its position in the genome

Infectious Diseases Group, Indian Institute of Chemical Biology, 4 Raja S. C. Mullick Road, Calcutta 700 032, India
Correspondence
Rupak K. Bhadra
rupakbhadra{at}iicb.res.in
| ABSTRACT |
|---|
|
|
|---|
. The genome of V. cholerae, the host for CTX
, consists of two chromosomes, one large and one small. Here, it is shown that localization and array of CTX prophage DNA in either the large or small chromosome of V. cholerae is likely to be one of the reasons for the emergence of O1 biotype El Tor variants isolated just before and after the V. cholerae O139 cholera outbreak in 1992. Analyses of the organization of the CTX region of the genome of pre-O139 El Tor strains revealed that these strains carry two distinct CTX prophages integrated in the small chromosome in tandem: CTXET, the prophage having a conserved NotI site in its repeat sequence segment which seems to be specific for the El Tor strains so far examined, followed by CTXcalc-like genome, the prophage found in recent O139 clinical isolates from Calcutta. In sharp contrast, in post-O139 El Tor strains only one copy of the CTXET prophage was found to be integrated in the large chromosome. To the authors' knowledge, the presence of CTX prophage in the small chromosome of O1 El Tor strains has not been reported previously. It is also shown that the difference in the CTX copy number and the position of the bacteriophage on the genomes of pre- and post-O139 El Tor strains have an effect on cholera toxin production. While a pre-O139 strain produced maximum cholera toxin in yeast extract/peptone medium at 30 °C, a post-O139 El Tor strain showed maximal yield at 37 °C, indicating differential regulation of cholera toxin between the strains. It appears from this study that the variation in the integration site of the CTX prophage, its copy number and the presence of diverse phage genomes in V. cholerae O1 biotype El Tor may be strategically important for generating variants with subtle phenotypic modulations of virulence factor production in this longest-ruling seventh pandemic strain. Abbreviations: CT, cholera toxin; RS, repeat sequence
Present address: Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern University, IL 60208, USA.
| INTRODUCTION |
|---|
|
|
|---|
The principal virulence factor of V. cholerae is CT. Previously, it has been shown that the genes encoding CT, ctxAB, along with other virulence-related genes reside on a 4·5 kb DNA segment called the core region (Baudry et al., 1992
; Pearson et al., 1993
; Trucksis et al., 1993
). The core region is flanked by one or multiple copies of direct repeat sequences (RSs) that vary in length from 2·4 to 2·7 kb, and this approximately 7 kb DNA segment (RS + core) is called the CTX genetic element (Pearson et al., 1993
). However, it has been discovered (Waldor & Mekalanos, 1996
) that the CTX genetic element of V. cholerae corresponds to the genome of a filamentous bacteriophage designated CTX
(Fig. 1
). The RS region present just upstream of the core of CTX
, named RS2 (2·4 kb in size), encodes functions required for regulation (rstR gene product), replication (rstA gene product) and integration (rstB gene product) of CTX
into the V. cholerae genome (Fig. 1
) (Waldor et al., 1997
). Apart from these genes, some RS2 elements may contain an additional ORF, termed rstC (Fig. 1
), and are called RS1 (2·7 kb in size). This element, when present, always flanks (5' and/or 3') the CTX prophage genome (Davis et al., 2000
; Waldor et al., 1997
) (Fig. 1
). Although the role of the rstC gene of RS1 is not clear, it has been predicted that this region could form a stemloop structure that might act as a transcriptional terminator (Waldor et al., 1997
). CTX
gains entry into the V. cholerae cell through the toxin co-regulated pilus, another important virulence factor of V. cholerae, and integrates its genome into the V. cholerae chromosome by a RecA-independent site-specific process to form a stable lysogen (Pearson et al., 1993
; Waldor & Mekalanos, 1996
). Interestingly, it has been shown that the sixth pandemic classical biotype vibrio strains are unable to generate infectious CTX
particles while the El Tor biotype and O139 serogroup strains can give rise to such particles (Davis et al., 2000
; Kimsey & Waldor, 1998
). Apart from this difference, the organization of the CTX prophage genome in V. cholerae can be used as one of the reliable molecular methods for the differentiation of classical and El Tor biotypes. In El Tor genomes, the CTX prophage may be present either as a single copy or as multiple copies arranged in tandem (Mekalanos, 1983
). In sharp contrast, in classical vibrios, the CTX prophage is present in two copies and these are widely separated on the chromosome (Mekalanos, 1983
). It has been shown that V. cholerae contains two unique chromosomes, one large and one small (Trucksis et al., 1998
). Genetic mapping revealed that in the classical biotype strain O395 the two copies of the CTX prophage are present in one copy on each chromosome (Trucksis et al., 1998
). However, the whole-genome sequencing of an El Tor strain, N16961, revealed the integration of only one copy of the CTX prophage flanked by the RS1 element in its large chromosome (Heidelberg et al., 2000
). Thus, no reports were available to show that CTX
can integrate in the small chromosome of El Tor O1 strains.
|
. The difference in CTX prophage array and the location of integration sites observed between the El Tor strains isolated prior to and after the O139 outbreak also affected the regulation of production of CT. | METHODS |
|---|
|
|
|---|
|
Preparation of high-molecular-mass genomic DNA and restriction digestion.
Intact bacterial DNA was prepared as described previously (Khetawat et al., 1999
). Briefly, V. cholerae cells in the late-exponential phase of growth were suspended in 10 mM Tris/HCl (pH 7·6) buffer containing 1 M NaCl. Agarose blocks were prepared by mixing equal volumes of bacterial cells and molten 1·4 % low-melting-point agarose (FMC). Bacterial cells embedded in agarose plugs were lysed in the presence of RNase, treated with proteinase K and stored in 0·5 M EDTA (pH 9·0) at 4 °C. Before use, the agarose plugs were treated with PMSF to inactivate proteinase K and washed extensively with TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 8·0). The agarose inserts containing intact genomic DNA of V. cholerae were digested with the rare cutter NotI (New England Biolabs) essentially as suggested by the manufacturer. For the separation of the two chromosomes of V. cholerae, an undigested agarose slice was used (Trucksis et al., 1998
).
PFGE.
For the separation of large restriction fragments or the two chromosomes of V. cholerae, electrophoresis was carried out in a Pulsaphor Plus system with a hexagonal electrode array (Amersham Pharmacia Biotech) in 0·5xTAE buffer (20 mM Tris/acetate, 0·5 mM EDTA, pH 8·3). Different electrophoresis conditions were used depending upon the size of the DNA fragment that needed to be resolved. Electrophoresis parameters are given in each figure legend. The
DNA concatemers, Saccharomyces cerevisiae chromosomal DNA and
DNA digested with HindIII were used as DNA molecular size markers. After electrophoresis, gels were stained with ethidium bromide (0·5 µg ml-1) and DNA was visualized and recorded using a gel documentation system (GelDoc 2000; Bio-Rad).
Molecular methods.
Standard molecular methods were followed throughout the study (Sambrook et al., 1989
). For hybridization experiments, the ctxA gene was obtained as described previously (Bhadra et al., 1995
). The position of the ctxA gene probe is shown in Fig. 1
. The RS segment used as a probe was PCR-amplified with a specific pair of primers, IgF (GAGCCTGTGACACTCACCTTGTAT) and RsR (GCTCAGTCAATGCCTTGAGTTG) (Fig. 1
). The amplification conditions used were as follows: denaturation at 94 °C for 1 min, followed by 30 cycles of denaturation at 94 °C for 10 s, primer annealing at 60 °C for 30 s and primer extension at 72 °C for 3 min, with a final extension at 72 °C for 7 min. The PCR assay was performed using a GeneAmp PCR System (Applied Biosystems). PCR-amplified DNA was purified by the electroelution method (Sambrook et al., 1989
). About 50 ng of DNA was labelled with [
-32P]dCTP (Amersham Biosciences) by the random-priming method using the NEBlot kit (New England Biolabs). For Southern blot hybridization, bacterial genomic DNA was digested with restriction endonucleases, separated by electrophoresis, transferred to Hybond-N+ membranes (Amersham Biosciences) and hybridized with a labelled DNA probe at 60 °C in a hybridization oven as described previously (Bhadra et al., 1995
; Khetawat et al., 1999
). The membranes were washed under stringent conditions, dried and exposed to Kodak X-OMAT AR5 films.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
of El Tor origin reveals that there is a conserved NotI site in the intergenic region ig-1, which is physically linked to the rstR gene of the RS (Waldor et al., 1997
. The correlation that there is a conserved NotI site in the ig-1 region of the RSs of El Tor strains is further supported by the whole-genome sequence of El Tor strain N16961 (Heidelberg et al., 2000
|
|
|
always integrates in the large chromosome of El Tor strains or if it was also present in the small chromosome. To determine the integration site of CTX
in the El Tor strains, undigested intact chromosomal DNAs from different V. cholerae strains were subjected to PFGE to separate their two chromosomes (Trucksis et al., 1998
can integrate in the small chromosome of El Tor vibrios, and this is probably one of the reasons for the genome rearrangements leading to the genesis of variants. The result also suggests the presence of a functional attB-like sequence, needed for the integration of CTX prophage (Davis et al., 1999
|
, as a recent study has shown that there are strain-specific CTX
present in various isolates. For example, CTXclass
is found in classical strains, CTXET
is present in El Tor and O139 strains and CTXcalc
is found in resurgent O139 strains (Davis et al., 1999
among biotypes is mainly due to the extensive variations in the RS element, particularly in the rstR gene region (Davis et al., 1999
of resurgent O139 strains (Kimsey et al., 1998
|
is located between the tlc and rtx gene clusters (Davis et al., 2000
may integrate in the small chromosome. An attempt was made to find out whether the empty locus was located in the same region as suggested by Davis et al. (2000)
s in the genomes of resurgent V. cholerae O139 strains has been reported by Kimsey et al. (1998)
detected and characterized in the genomes of resurgent V. cholerae O139 strains had originated from a pre-O139 El Tor strain that also harboured diverse prophages, as shown in this study (Fig. 5
, as well as providing pathogenic fitness to El Tor and O139 vibrios, may also help their hosts to evolve to maintain their epidemic-causing potential. Evolution of the seventh pandemic El Tor strains that replaced the sixth pandemic classical strains may have happened due to the better flexibility of the genomes of the former. Several lines of evidence also indicate that the organization of the ctx locus and the genome of the classical strain were highly stable compared to the El Tor biotype (Bhadra et al., 1995
in the large or small chromosome and tandem amplification, helps these strains to transform into a new pathovar so that their pathogenic potential is not hampered. A schematic representation of the array of various CTX prophages identified so far in the large and small chromosomes of V. cholerae is shown in Fig. 5
Differential regulation of CT production in pre- and post-O139 El Tor strains
To see whether changes in the location and variations in the copy number of CTX prophage in the genomes of pre- and post-O139 El Tor strains have any effect on CT production, we used YEP medium and two incubation temperatures, 30 or 37 °C, as described by Mukhopadhyay et al. (1996b)
. These experiments showed that CT production by V. cholerae El Tor strains grown in YEP medium at 30 °C with shaking was the highly favoured condition compared to 37 °C. When we compared the production of CT by various strains of V. cholerae in YEP medium, the pre-O139 El Tor strains VC20 and VC44 showed optimal production at 30 °C (about 710 ngCTml-1) compared to 37 °C (about 310 ngCTml-1) with shaking. Surprisingly, strains CO457, CO471 and CO473, isolated just after the O139 outbreak, produced their maximal amount of CT at 37 °C (about 950 ngCTml-1) and not at 30 °C (about 750 ngCTml-1). However, the Peru strain C6709, like other El Tor strains reported by Mukhopadhyay et al. (1996b)
, showed optimal production of CT at 30 °C (750 ngCTml-1) compared to 37 °C (600 ngCTml-1). The CT values mentioned here are expressed as the mean of three independent experiments with each strain. Although the exact reasons for the differential regulation of CT production in pre- and post-O139 El Tor strains is currently unknown, it appears from this study that the genomic positions of the CTX prophage may play some role in such variations; these variations need further investigation. Thus, it appears that apart from various environmental cues that control the expression of various virulence factors in V. cholerae, the genomic positions of virulence-determining genes may also intrinsically fine-regulate their expression. This type of subtle phenotypic modulation of a major virulence factor may be a selective advantage when a pathogen persists in an endemic zone for a long time. However, further work is needed in this direction to come to a definite conclusion.
Conclusion
Possible environmental or host factors that determine the emergence and temporal domination of a particular variant of toxigenic V. cholerae and the displacement of an existing variant through natural selection are currently unknown. It is now well established that the major virulence genes of V. cholerae that have been studied extensively are located on mobile elements (Karaolis et al., 1998
, 1999
; Waldor & Mekalanos, 1996
). Previously, we have shown the presence and expression of two critical virulence genes, ctxAB and tcpA, in diverse environmental non-O1, non-O139 strains of V. cholerae, which appear to constitute an environmental reservoir for virulence genes (Chakraborty et al., 2000
). The present study also indicates that the mobile element CTX
, ferrying the virulence genes ctxAB, is also forced to diversify, probably by mixing and matching with other CTX
s leading to the genesis of new versions of phages. This type of diversity in the phage genome and variation in the sites of integration is probably needed for survival of the phage within the bacterial host. However, V. cholerae probably capitalizes on this property of CTX
by rearranging its genome, which may lead to phenotypic modulation of expression of virulence factors such as CT, as shown in this study, and most probably modulation of expression of other virulence-related factors. Thus, the variants of V. cholerae El Tor generated by diverse CTX
s can maintain their pathogenic and epidemic potentials under various stressful conditions. The striking temporal association of the location of CTX prophages in the small chromosomes of V. cholerae O1 El Tor strains isolated just prior to the emergence of strain O139, and the displacement of strain O139 by the O1 El Tor strains carrying a single copy of the prototype CTXET
in their large chromosomes, may be one of the contributory factors for the emergence of El Tor variants.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Baudry, B., Fasano, A., Ketley, J. & Kaper, J. B. (1992). Cloning of a gene (zot) encoding a new toxin produced by Vibrio cholerae. Infect Immun 60, 428434.
Bhadra, R. K., Roychoudhury, S. & Das, J. (1994). Vibrio cholerae O139 El Tor biotype. Lancet 343, 728.[Medline]
Bhadra, R. K., Roychoudhury, S., Banerjee, R. K., Kar, S., Majumdar, R., Sengupta, S., Chatterjee, S., Khetawat, G. & Das, J. (1995). Cholera toxin (CTX) genetic element in Vibrio cholerae O139. Microbiology 141, 19771983.
Bik, E. M., Bunschoten, A. E., Gouw, R. D. & Mooi, F. (1995). Genesis of the novel epidemic Vibrio cholerae O139 strain: evidence of horizontal transfer of genes involved in polysaccharide synthesis. EMBO J 14, 209216.[Medline]
Chakraborty, S., Mukhopadhyay, A. K., Bhadra, R. K. & 8 other authors (2000). Virulence genes in environmental strains of Vibrio cholerae. Appl Environ Microbiol 66, 40224028.
Davis, B. M., Kimsey, H. H., Chang, W. & Waldor, M. K. (1999). The Vibrio cholerae O139 Calcutta bacteriophage CTX
is infectious and encodes a novel repressor. J Bacteriol 181, 67796787.
Davis, B. M., Moyer, K. E., Boyd, E. F. & Waldor, M. K. (2000). CTX prophages in classical biotype Vibrio cholerae: functional phage genes but dysfunctional phage genomes. J Bacteriol 182, 69926998.
Faruque, S. M., Albert, M. J. & Mekalanos, J. J. (1998). Epidemiology, genetics and ecology of toxigenic Vibrio cholerae. Microbiol Mol Biol Rev 62, 13011314.
Heidelberg, J. F., Eisen, J. A., Nelson, W. C. & 29 other authors (2000). DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406, 477484.[CrossRef][Medline]
Kaper, J. B., Morris, J. G., Jr & Levine, M. M. (1995). Cholera. Clin Microbiol Rev 8, 4886.
Karaolis, D. K. R., Johnson, J. A., Bailey, C. C., Boedecker, E. C., Kaper, J. B. & Reeves, P. R. (1998). A Vibrio cholerae pathogenicity island associated with epidemic and pandemic strains. Proc Natl Acad Sci U S A 95, 31343139.
Karaolis, D. K. R., Somara, S., Maneval, D. R., Jr, Johnson, J. A. & Kaper, J. B. (1999). A bacteriophage encoding pathogenicity island, a type-IV pilus and a phage receptor in cholera bacteria. Nature 399, 375379.[CrossRef][Medline]
Khetawat, G., Bhadra, R. K., Nandi, S. & Das, J. (1999). Resurgent Vibrio cholerae O139: rearrangement of cholera toxin genetic elements and amplification of rrn operon. Infect Immun 67, 148154.
Kimsey, H. H. & Waldor, M. K. (1998). CTX
immunity: application in the development of cholera vaccines. Proc Natl Acad Sci U S A 95, 70357039.
Kimsey, H. H., Nair, G. B., Ghosh, A. & Waldor, M. K. (1998). Diverse CTX
s and evolution of new pathogenic Vibrio cholerae. Lancet 352, 457458.[Medline]
Levine, M. M. (1991). South America: the nature of cholera. Lancet 341, 4546.
Lin, W., Fullner, K. J., Clayton, R., Saxton, J. A., Rogers, M. B., Calia, K. E., Calderwood, S. B., Fraser, C. & Mekalanos, J. J. (1999). Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage. Proc Natl Acad Sci U S A 96, 10711076.
Mekalanos, J. J. (1983). Duplication and amplification of toxin genes in Vibrio cholerae. Cell 35, 253263.[CrossRef][Medline]
Mukhopadhyay, A. K., Garg, S., Nair, G. B. & 7 other authors (1995). Biotype traits and antibiotic susceptibility of Vibrio cholerae serogroup O1 before, during and after the emergence of the O139 serogroup. Epidemiol Infect 115, 427434.[Medline]
Mukhopadhyay, A. K., Garg, S., Mitra, R. & 8 other authors (1996a). Temporal shifts in traits of Vibrio cholerae strains isolated from hospitalized patients in Calcutta: a 3-year (1993 to 1995) analysis. J Clin Microbiol 34, 25372543.
Mukhopadhyay, A. K., Garg, S., Saha, P. K., Takeda, Y., Bhattacharya, S. K. & Nair, G. B. (1996b). Comparative analysis of factors promoting optimal production of cholera toxin by Vibrio cholerae O1 (classical and El Tor biotypes) and O139. Indian J Med Res 104, 129133.[Medline]
Nair, G. B. (1996). Molecular insights into the evolution and epidemiology of Vibrio cholerae. Indian J Med Res 104, 513.[Medline]
Nandi, S., Khetawat, G., Sengupta, S., Majumder, R., Kar, S., Bhadra, R. K., Roychoudhury, S. & Das, J. (1997). Rearrangements in the genomes of Vibrio cholerae strains belonging to different serovars and biovars. Int J Syst Bacteriol 47, 858862.
Pearson, G. D. N., Woods, A., Chiang, S. L. & Mekalanos, J. J. (1993). CTX genetic element encodes a site-specific recombination system and an intestinal colonization factor. Proc Natl Acad Sci U S A 90, 37503754.
Ramamurthy, T., Garg, S., Sharma, R. & 8 other authors (1993). Emergence of novel strain of Vibrio cholerae with epidemic potential in Southern and Eastern India. Lancet 341, 703704.[Medline]
Rubin, E. J., Lin, W., Mekalanos, J. J. & Waldor, M. K. (1998). Replication and integration of Vibrio cholerae cryptic plasmid linked to the CTX prophage. Mol Microbiol 28, 12471254.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sharma, C., Nair, G. B., Mukhopadhyay, A. K., Bhattacharya, S. K., Ghosh, R. K. & Ghosh, A. (1997). Molecular characterization of Vibrio cholerae O1 biotype El Tor strains isolated between 1992 and 1995 in Calcutta, India: evidence for the emergence of a new clone of the El Tor biotype. J Infect Dis 175, 11341141.[Medline]
Trucksis, M., Galen, J. E., Michalsky, J., Fasano, A. & Kaper, J. B. (1993). Accessory cholera enterotoxin (Ace), the third toxin of a Vibrio cholerae virulence cassette. Proc Natl Acad Sci U S A 90, 52675271.
Trucksis, M., Michalsky, J., Deng, Y. K. & Kaper, J. B. (1998). The Vibrio cholerae genome contains two unique circular chromosomes. Proc Natl Acad Sci U S A 95, 1446414469.
Waldor, M. K. & Mekalanos, J. J. (1994). Emergence of new cholera pandemic: molecular analysis of virulence determinants in Vibrio cholerae O139 and development of a live vaccine prototype. J Infect Dis 170, 278283.[Medline]
Waldor, M. K. & Mekalanos, J. J. (1996). Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 272, 19101914.[Abstract]
Waldor, M. K., Rubin, E. J., Pearson, G. D. N., Kimsey, H. & Mekalanos, J. J. (1997). Regulation, replication, and integration functions of the Vibrio cholerae (CTX) are encoded by region RS2. Mol Microbiol 24, 917926.[CrossRef][Medline]
Received 20 March 2002;
revised 6 August 2002;
accepted 2 October 2002.
This article has been cited by other articles:
![]() |
K. Halder, B. Das, G. B. Nair, and R. K. Bhadra Molecular evidence favouring step-wise evolution of Mozambique Vibrio cholerae O1 El Tor hybrid strain Microbiology, January 1, 2010; 156(1): 99 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Safa, N. A. Bhuiyan, D. Murphy, J. Bates, S. Nusrin, R. Y. C. Kong, M. Chongsanguan, W. Chaicumpa, and G. B. Nair Multilocus genetic analysis reveals that the Australian strains of Vibrio cholerae O1 are similar to the pre-seventh pandemic strains of the El Tor biotype J. Med. Microbiol., January 1, 2009; 58(1): 105 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Maiti, B. Das, A. Saha, R. K. Nandy, G. B. Nair, and R. K. Bhadra Genetic organization of pre-CTX and CTX prophages in the genome of an environmental Vibrio cholerae non-O1, non-O139 strain Microbiology, December 1, 2006; 152(12): 3633 - 3641. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Nair, A. Safa, N. A. Bhuiyan, S. Nusrin, D. Murphy, C. Nicol, M. Valcanis, S. Iddings, I. Kubuabola, and H. Vally Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol., November 1, 2006; 55(Pt 11): 1559 - 1562. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loconto, P. Viswanathan, S. J. Nowak, M. Gloudemans, and L. Kroos Identification of the {Omega}4406 Regulatory Region, a Developmental Promoter of Myxococcus xanthus, and a DNA Segment Responsible for Chromosomal Position-Dependent Inhibition of Gene Expression J. Bacteriol., June 15, 2005; 187(12): 4149 - 4162. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |