|
|
||||||||
Département de Microbiologie, Faculté de Pharmacie, Université Paris-Sud, 5 rue JB Clément, 92296 Châtenay-Malabry cedex, France
Correspondence
Anne Collignon
anne.collignon{at}cep.u-psud.fr
| ABSTRACT |
|---|
|
|
|---|
The GenBank accession number for the sequence determined in this work is AF394222.
| INTRODUCTION |
|---|
|
|
|---|
The attachment of pathogenic micro-organisms to host cells and tissues is often mediated through the expression of surface receptors recognizing components of the extracellular matrix such as fibronectin. Fibronectin is a ubiquitous 450 kDa glycoprotein found in the body fluids and extracellular matrix of vertebrates (Ozeri et al., 1998
). Fibronectin-binding proteins (Fbps) have been described as possible adhesins mainly in streptococci and staphylococci, in which one bacterial species can express multiple ligands for fibronectin (Courtney et al., 1994
; van der Flier et al., 1995
). In Gram-positive cocci, Fbps are exposed on the bacterial surface (Navarre & Schneewind, 1999
), generally through the LPXTG cell wall anchor (Fischetti et al., 1990
). C. difficile binds to extracellular matrix proteins such as fibronectin, fibrinogen, collagen and vitronectin (Cerquetti et al., 2002
). C. difficile surface layer proteins bind to collagen, thrombospondin and vitronectin, but not to fibronectin or laminin (Calabi et al., 2002
). Binding to fibronectin could be due to Fbps. However, little information concerning Fbps in anaerobic bacteria, including clostridia, is available.
In this study we undertook the isolation and characterization of the C. difficile fbp68 gene encoding a putative Fbp as well as the expression and purification of the recombinant and native forms of the Fbp68 protein. PCR amplification of the fbp68 gene coupled with RFLP analysis were used in an attempt to differentiate between clinical isolates. The surface localization of the protein was investigated as well as its role in fibronectin binding and Vero cell attachment.
| METHODS |
|---|
|
|
|---|
Isolation of the fbp68 gene from C. difficile 79-685 by PCR amplification.
DNA was extracted from 10 ml of C. difficile culture according to the protocol provided in the Puregene Gram-positive and yeast DNA extraction kit (Gentra systems) and resuspended in TE buffer at a concentration of 1 µg µl-1. Amplification of a 2·3 kb DNA fragment that includes upstream and downstream sequences of the fbp68 coding sequence was carried out using primers Fbp1 (GGCATAGTCACAGTATCACATC) and Fbp2 (TACATCTATATAAGAAGACTG). PCR was carried out in a PE Cetus Thermal Cycler 480 with 2 mM MgCl2, 0·2 mM each dNTP and 1 U Taq polymerase (Promega). Cycling conditions were 34 cycles of 95 °C 1 min, 55 °C 1 min, and 72 °C 2 min. Amplified products were purified by the Wizard Gel Extraction Kit (Promega). The nucleotide sequences of both strands of the amplified products were obtained by using the Big Dye Terminator Cycle sequencing kit (Applied Biosystems) and analysed with an ABI PRISM 310 Genetic Analyser (Applied Biosystems). Additional primers were designed to obtain internal sequences. Protein sequence alignments were performed with CLUSTAL W (Thompson et al., 1994
). Homology searches were conducted with Fasta3 (European Bioinformatics Institute) or BLAST (National Institute for Biotechnology Information, USA).
RFLP analysis and Southern blotting.
For PCR-RFLP analysis, the fbp68 gene was amplified by PCR as described above on genomic DNA isolated from 18 C. difficile clinical isolates and reference strain 79-685. The DNA was digested with four restriction enzymes (SspI, DraI, RsaI and HindIII) (Biolabs) and electrophoretic profiles were compared in 1 % agarose gels.
For Southern blotting, 10 µg purified genomic DNA was digested with AccI (Amersham Biosciences). The fragments were separated through a 0·8 % agarose gel and electrically transferred to a positively charged nylon membrane (Roche). The PCR-amplified fbp68 gene from C. difficile 79-685 was used as a probe and labelled with the BioProbe random primer labelling kit (Sigma), according to the manufacturer's instructions. Hybridization was carried out overnight at 42 °C and washing of the membrane was performed under low stringency (0·5x SSC at 42 °C). The subsequent washing steps and detection with streptavidinalkaline phosphatase were carried out as recommended by the manufacturer (CDP-Star Universal detection kit, Sigma).
Production, purification and identification of the Fbp68 proteins
Production of recombinant Fbp68.
The fbp68 gene was cloned into the pGEX-6P1 expression vector (Amersham Biosciences): two oligonucleotides, FbpfusionEcoRI (TAAATGGAATTCGATGGATTAGTTATAC) and FbpfusionSalI (TAGTGTCGACTTTATTCAGATTTAACC), incorporating an EcoRI and a SalI site, respectively (underlined), were used to amplify by PCR the full-length coding region of the fbp68 gene of strain 79-685. The resulting 1·8 kb DNA fragment was digested with the two enzymes and ligated (1 U T4 ligase, Invitrogen) between the EcoRI and SalI sites of pGEX-6P-1. The plasmid carrying an in-frame fusion between gst and fbp68 was transformed into E. coli LB21. Subsequent purification steps using single-step affinity chromatography employing glutathione-Sepharose 4B were performed as described in protocols from Amersham Biosciences.
Production of Fbp68-specific antibodies.
Rabbit polyclonal antibodies were produced by the Agrobio Company (France) with the recombinant Fbp68. Antibodies were then purified on protein A-Sepharose according to the supplier's recommendations (Amersham Biosciences).
Immunoprecipitation of the native Fbp68.
C. difficile was cultured for 24 h in 100 ml TGY and harvested by centrifugation at 5000 g for 10 min at 4 °C. The pellet was washed twice with PBS (pH 7·2) and resuspended in 1·5 ml 0·1 M Tris/HCl (pH 8·6). Protein extracts were obtained by three successive freezethaw cycles, followed by 15 min centrifugation at 15 000 g and recovery of the supernatant. One millilitre of protein A-Sepharose was centrifuged (15 000 g, 5 min, 4 °C), the supernatant was removed and 1 ml of Fbp68-specific antibodies [1 : 10 dilution in buffer B (150 mM NaCl, 20 mM Tris/HCl pH 8·1, 1 % Triton X-100, 0·2 % BSA, 5 mM EDTA)] was added and incubated for 12 h at 4 °C with gentle rotation. After centrifugation (15 000 g, 5 min, 4 °C), a 1 ml mixture of protease inhibitor cocktail (Sigma) and C. difficile protein extracts was added to the protein Aantibody pellet, followed by a 12 h incubation with gentle rotation at 4 °C. After centrifugation (15 000 g, 5 min, 4 °C), the pellet was washed once with buffer B, three times with modified buffer B (0·5 % Triton X-100 plus 0·1 % SDS), three times with differently modified buffer B (500 mM NaCl, 0·5 % Triton X-100, no EDTA) and twice with 50 mM Tris/HCl (pH 8·1). After centrifugation, 10 µl 10 % SDS was added to the pellet and left for 10 min at room temperature. After heating at 100 °C for 5 min, 250 µl of the second washing buffer without BSA was added. The solution was centrifuged and the supernatant containing the protein was recovered.
Reconfiguration of native and recombinant Fbp68.
Because of aberrant migration through SDS-PAGE, native and recombinant Fbp68 (rFbp68) were reconfigured. The protein bands were visualized by soaking the SDS-polyacrylamide gel in cold 0·25 M KCl and 1 mM DTT for 5 min. The visible bands were sliced out from the gel, crushed, resuspended in elution buffer [0·1 % SDS, 0·05 M Tris/HCl (pH 7·9), 0·10 mM EDTA, 5 mM DTT, 0·1 mg BSA ml-1 and 0·15 M NaCl] and incubated at 37 °C for 4 h. The gel fragments were removed from the elution buffer by filtering through a 0·45 µm filter (Millipore). The proteins in the filtrate were precipitated by adding 4 vols cold acetone (-20 °C) and placing the tube in an ethanol/dry ice bath for 30 min. The precipitated proteins were pelleted by a 10 min centrifugation, and the pellet was allowed to dry for 10 min at 42 °C. The proteins were resuspended in 20 µl 6 M guanidine·HCl and incubated at room temperature for 10 min. The guanidine·HCl solution was diluted 50-fold with dilution buffer (0·05 M Tris/HCl, 20 %, v/v, glycerol, 0·10 mg BSA ml-1, 0·15 M NaCl, 1 mM DTT, 0·10 mM Na2EDTA), and the proteins were allowed to reconfigure in this solution for 12 h at room temperature.
Only rFbp68 was used in the binding assays described below, since the specific antibodies were obtained with the recombinant protein.
Fbp68 localization: SDS-PAGE and immunoblotting with cell fractioning.
Bacterial proteins were separated into three fractions cell wall, membrane and cytoplasm as previously described (Hennequin et al., 2001a
), using a modification of the method described by Jonquières et al. (1999)
. Twenty micrograms of the total protein extracts, measured by the Bio-Rad DC protein assay kit, were separated by SDS-PAGE using a 7·5 % SDS-polyacrylamide gel and then transferred to nitrocellulose. The nitrocellulose membrane was incubated for 1 h at room temperature in blocking buffer [5 % skimmed milk in TNT (10 mM Tris/HCl, pH 8·0, 150 mM NaCl, 0·05 % Tween)] and then for 1 h in a 1 : 2500 dilution of Fbp68-specific antibodies. The membranes were washed in TNT and bound antibodies were detected with goat anti-rabbit IgG alkaline phosphatase conjugate (1 : 2500 dilution; Sigma) with NBT-BCIP (Invitrogen) as substrates. The purity of the fractions was verified by determining the presence or absence of Cwp66 (a peptidoglycan-attached protein) (Waligora et al., 2001
), GroEL (a surface-exposed heat-shock protein) (Hennequin et al., 2001a
) and PepC (a cytoplasmic-membrane-associated protein) (Hennequin et al., 2001a
) revealed by specific antibodies.
Binding of Fbp68 to extracellular matrix proteins by far-immuno dot-blotting.
To study the binding of Fbp68 to extracellular matrix protein, 10 µg fibronectin (Roche), fibrinogen (Sigma), collagen type VI (Sigma) and vitronectin (Sigma) were deposited onto a nitrocellulose membrane and air-dried. Similarly, 10 µg BSA (Sigma) was deposited onto the membrane (negative control). The membrane was incubated for 1 h at 37 °C in blocking buffer (5 % skimmed milk in TNT) and then in 10 ml of the same buffer containing 10 µg rFbp68. The rFbp68, adsorbed by the different proteins, was subsequently reacted with a 1 : 2500 dilution of rabbit anti-rFbp68 antibody. Detection was carried out with goat anti-rabbit IgGalkaline phosphatase conjugate (1 : 2500 dilution; Sigma) with NBT-BCIP as substrates.
Binding of C. difficile to soluble and immobilized fibronectin
Binding to soluble fibronectin.
The adsorption of fibronectin by C. difficile 79-685 was examined by indirect immunofluorescence. Bacteria were cultured anaerobically for 16 h at 37 °C. After centrifugation and washing with PBS (pH 7·2), the bacteria were incubated for 2 h in 10 ml PBS in the presence of 0·5 µg fibronectin ml-1. After centrifugation and washing with PBS (pH 7·2), a drop of the culture was deposited onto a microscope slide and dried. The slide was subsequently immersed in PBS (pH 7·2) for 1 h at room temperature, with rabbit anti-fibronectin monoclonal antibody (Sigma) (dilution 1 : 2500). Controls were carried out similarly: rabbit anti-C. difficile antibody was used as a positive control, the primary antibody omitted or bacteria incubated without fibronectin with antiserum raised against fibronectin were used as negative controls. The slide was washed three times with PBS (pH 7·2) for 15 min in total and incubated for 30 min with FITC-conjugated mouse anti-rabbit IgG antibody (Immunotech; 1 : 160 dilution in PBS). After washing, the specimens were examined with a Leitz Aristoplan microscope with epifluorescence coupled to an Image Analyser Visiolab 1000 (Biocom).
Binding to immobilized fibronectin.
The technique used to examine binding of C. difficile to immobilized fibronectin was a modification of the ELISA described by Chia et al. (2000)
. The experimental part with C. difficile was carried out in anaerobic conditions. Purified human fibronectin was immobilized on microtitre plates (Nunc) by adding 100 µl of the protein solution [10 µg ml-1 in 0·05 M sodium carbonate buffer (pH 9·5)] to each well and incubating the plates for 1 h at 37 °C. Subsequently, 200 µl of blocking buffer [1 % BSA in PBS (pH 7·2)] was added per well and the incubation was continued for 2 h at 37 °C. The wells were washed three times with PBS (pH 7·2) before use. C. difficile was grown to late stationary phase and harvested by centrifugation for 10 min at 5000 g. The bacterial pellet was washed with PBS and resuspended in PBS at 107 c.f.u. ml-1 and then serially diluted twofold. The different bacterial dilutions were then applied to the fibronectin-coated assay plates (100 µl per well) and incubated at 37 °C for 30 min. Non-adherent bacteria were removed with five washes in PBS. Subsequently, a 1 : 2500 dilution of a rabbit antiserum against C. difficile was added to each well, followed by incubation for 30 min at 37 °C. Plates were washed with PBS, and a 1 : 2500 dilution of alkaline phosphatase-labelled goat anti-rabbit IgG was added, followed by three washings and addition of 200 µl p-nitrophenyl phosphate (Sigma) substrate per well [1 mg ml-1 dissolved in 0·1 M carbonate buffer (pH 9·6) with 1 mM MgCl2] for 15 min at room temperature. The reactions were stopped by the addition of 50 µl 3 M NaOH. The absorbance was measured at 405 nm in an ELISA plate reader (model Anthos HTII, Anthos Labtec Instruments). Wells without bacteria or without the first or second antibodies served as negative controls. The adhesion index is given at the mean A405 of triplicate test wells of three different assays.
Fibronectin adherence inhibition assays.
107 bacteria were incubated with different dilutions (1 : 100, 1 : 500, 1 : 1000) of anti-Fbp68 in PBS for 30 min before binding to immobilized fibronectin on ELISA plates as described above. The positive control was bacterial adhesion in the presence of a 1 : 500 dilution of preimmune serum and the negative control adhesion to wells without bacteria. The adhesion index was determined as described above. The significance of differences between the positive assay and the inhibition assays was assessed by Student's t-test.
Attachment of C. difficile to Vero cells mediated by Fbp68 and fibronectin
Maintenance and preparation of Vero cells as well as adherence assays were performed as previously described (Karjalainen et al., 1994
).
Binding of radiolabelled Vero cells to fibronectin and Fbp68.
Five micrograms of human fibronectin and rFbp68 were separately deposited on a nitrocellulose membrane and dried. The membrane was blocked at 37 °C for 4 h with 5 % BSA in TNT, washed with PBS, and incubated for 90 min at 37 °C under 5 % CO2 with Vero cells (105 cells cm-2) metabolically labelled with L-[35S]methionine (Amersham-Biosciences) and resuspended in minimum essential medium (Life Technologies). After washing with PBS, protein-bound cells on the blotted membrane were detected by exposure of the membrane to Kodak Biomax photography film (Sigma).
Cell adherence inhibition assays.
Bacteria, washed twice in PBS, were incubated with anti-Fbp68 (1 : 10, 1 : 100 or 1 : 500 dilution in PBS) for 30 min before contact with Vero cells (1 h at 37 °C under anaerobic conditions). Five washings in PBS eliminated non-adherent bacteria and the cells were fixed and stained with May-Grunwald-Giemsa (Sigma). The adhesion index was taken as the mean number of adhering bacteria per cell (counted at a magnification of x1000) from at least three different assays. The positive adherence controls consisted of bacterial adhesion with a 1 : 10 dilution of preimmune serum in PBS or with PBS alone. The results of the inhibition assays were compared to the positive controls (considered as 100 % adhesion) and expressed as relative adherence (%). The significance of differences between the positive assay and the inhibition assays was assessed by Student's t-test.
| RESULTS |
|---|
|
|
|---|
The 1773 bp fbp68 gene of C. difficile 79-685 (GenBank accession no. AF394222) has the capacity to encode a 68 kDa protein. The G+C content of fbp68 is 27 mol%, close to that of the C. difficile genome. The 591 amino acid protein carries 31 % charged residues and is predominantly hydrophilic. Similar to the putative Fbp from B. subtilis, Fbp68 does not appear to possess a classical signal peptide (von Heijne, 1985
) as do most Fbps from other bacteria (Navarre & Schneewind, 1999
). Fbp68 displays the best homology (44 % identity) with the putative Fbp of B. subtilis mentioned above and 38 % and 39 % identity, respectively, with the adherence and virulence protein A (PavA) of Streptococcus pneumoniae (AAF05332) and FBP54 of Streptococcus pyogenes (AAA57236), for which a clear role in adhesion to target cells has been established (Courtney et al., 1994
; Holmes et al., 2001
). In addition, Fbp68 displays 66 % identity with the fibronectin-binding domain of FBP54 (Courtney et al., 1994
).
Eight degenerate repeats r1 to r8 are present in the Fbp68 protein sequence (Fig. 1
a). Analysis using ProDom software (Corpet et al., 2000
; http://protein.toulouse.inra.fr/prodom/doc/prodom.html) revealed that Fbp68 has two distinctive domains, mapped between amino acids 1300 and 480570, respectively (Fig. 1b
). Secondary-structure prediction analysis revealed a relatively long amino acid region, located between residues 305 and 340 in an
-helical region, displaying a very high probability (0·999) to assume a coiled-coil conformation (Lupas et al., 1991
).
|
|
The results of Southern hybridization experiments showed, for all strains tested, the presence of a 1·7 kb band corresponding to the fbp68 gene (not shown), indicating that only one copy of the gene is present on the bacterial chromosome.
Surface localization of Fbp68
Fbp68 localization in whole bacteria was studied by cell fractionation. As shown in Fig. 3
(a, b), Fbp68 was localized mainly in the cytoplasmic fraction and to a lesser extent in the cell wall fraction.
|
Binding of C. difficile to soluble and immobilized fibronectin
Binding of C. difficile to soluble and immobilized fibronectin was studied by two different methods. Further evidence for a specific role of Fbp68 in fibronectin adherence was obtained by adherence inhibition ELISA assays using polyclonal antibodies to Fbp68.
Binding to soluble fibronectin.
As shown in Fig. 4
, whole C. difficile bacteria showed fluorescence with antisera raised against fibronectin when bacteria were preincubated with fibronectin, suggesting that C. difficile can bind to soluble fibronectin.
|
|
0·05).
Attachment of C. difficile to Vero cells mediated by Fbp68 and fibronectin
The fact that Fbp68 can bind to fibronectin and is located in the cell wall fraction suggests a possible role for this protein in cell adherence. Therefore, the capacity of Vero cells to bind fibronectin was studied, and involvement of Fbp68 in adhesion of C. difficile was investigated in competitive inhibition assay using polyclonal antibodies to Fbp68.
Binding of radiolabelled Vero cells to fibronectin and Fbp68.
Radiolabelled Vero cells were able to bind to immobilized fibronectin and, to a lesser extent, directly to the purified rFbp68 (data not shown). This suggests that Vero cells carry fibronectin on their surface and that Fbp68 could mediate C. difficile attachment to Vero cells.
Cell adherence inhibition assays.
Further evidence for a role of Fbp68 in cell adherence was obtained by cell adherence inhibition assays. Bacteria co-incubated with anti-Fbp68 antibody at a dilution of 1 : 10 and 1 : 100 demonstrated a relative adherence of 60 % and 70 % respectively, compared with the controls (incubation with preimmune serum and PBS considered as 100 % adherence), indicating that Fbp68 may indeed be involved in the adherence process. This decrease was statistically significant (P
0·05). Co-incubation with anti-Fbp68 at a dilution of 1 : 1000 gave a relative adherence of 90 %; this decrease was not statistically significant.
| DISCUSSION |
|---|
|
|
|---|
The homology of Fbp68 to other Fbps and the presence of domains including a coiled-coil domain and repeat structures in Fbp68 suggest that the protein is surface-localized. Futhermore, known functions for Fbps are mediation of adherence to fibronectin and eukaryotic cells. Far-immuno dot-blotting established clearly that Fbp68 is capable of binding to fibronectin and some other extracellular matrix proteins. If a protein is to serve as an adhesin, surface localization is frequently observed. Surface proteins of Gram-positive bacteria frequently carry the cell wall anchor LPXTG (Fischetti et al., 1990
; von Heijne, 1985
), which, however, is absent from Fbp68, as it is from FBP54 of S. pyogenes (Courtney et al., 1994
). It is known that not all surface proteins of Gram-positive bacteria contain these motifs (Navarre & Schneewind, 1999
). Immunoblot analyses of cell wall fractions revealed that C. difficile Fbp68 is associated with the cell surface. How Fbp68 of C. difficile ends up on the bacterial surface is unclear at the moment as the protein carries no classical signal peptide. Pathways of protein secretion in Gram-positive bacteria are not fully understood. The alkaline phosphatase reporter transposon (TnFuZ) developed by Gibson and Caparon allowed the study of proteins exported from Gram-positive bacteria; in S. pyogenes, two exported proteins without signal peptide have been described. In addition, it is known that some well-characterized proteins of S. pyogenes (
-enolase, glyceraldehyde-3-phosphate dehydrogenase) which are surface-exposed lack a defined export signal (Gibson & Caparon, 2002
).
When presented with both soluble and immobilized forms of fibronectin, some bacteria selectively react with only one form (Courtney et al., 1994
). Therefore, two types of experiments were performed to assess the capacity of C. difficile to bind fibronectin: indirect immunofluorescence to investigate binding to soluble fibronectin, and an ELISA to investigate binding to immobilized fibronectin. C. difficile could bind both soluble and immobilized fibronectin, and anti-Fbp68 partially inhibited this binding. Group A streptococci also react with both forms (Courtney et al., 1994
). The capacity of C. difficile to bind immobilized fibronectin in vitro may translate to its capacity to bind to fibronectin present on the surface of numerous eukaryotic cells in vivo. Binding to soluble fibronectin, which is ubiquitous in body fluids, could allow the bacteria to attach directly to tissues (Chia et al., 2000
). C. difficile may also be able to bind to tissues through fibronectinfibrin, fibronectincollagen or fibronectinfibronectin interactions (Vercellotti et al., 1985
). In addition, binding to fibronectin could facilitate migration of bacteria to distant regions of the body (liver abscesses due to C. difficile have been described: Sakurai et al., 2001
) and coating of the micro-organism with soluble fibronectin may facilitate escape from host immune surveillance.
We showed that Vero cells are capable of binding Fbp68. These cells produce fibronectin (dos Santos & Wada, 1999
) and our results showed that Vero cells can strongly bind fibronectin. Thus fibronectin could serve as a bridge between C. difficile and certain cell types, as has been described for S. pyogenes cell attachment mediated by protein F (Ozeri et al., 1998
).
The capacity of Vero cells to bind C. difficile Fbp68 and the adherence inhibition by Fbp68-specific antibodies suggest a role for this protein in cell adherence. Adherence assays to fibronectin confirmed the ability of C. difficile to fix fibronectin. Adherence may be optimally induced and expressed in response to various environmental conditions.
Anti-Fbp68 partially inhibited binding of C. difficile to fibronectin, suggesting a specific but partial role for this protein in adherence to fibronectin. The partial adherence inhibition of C. difficile to Vero cells with anti-Fbp68 antibodies confirms that cell adhesion of C. difficile is mediated by multiple adhesins through several extracellular matrix proteins.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Calabi, E., Ward, S., Wren, B., Paxton, T., Panico, M., Morris, H., Dell, A., Dougan, G. & Fairweather, N. (2001). Molecular characterization of the surface layer proteins from Clostridium difficile. Mol Microbiol 40, 11871199.[CrossRef][Medline]
Calabi, E., Calabi, F., Phillips, A. D. & Fairweather, N. (2002). Binding of Clostridium difficile surface layer proteins to gastrointestinal tissues. Infect Immun 70, 57705778.
Cerquetti, M., Molinari, A., Sebastianelli, A., Diociaiuti, M., Petruzzelli, R., Capo, C. & Mastrantonio, P. (2000). Characterization of surface layer proteins from different Clostridium difficile clinical isolates. Microb Pathog 28, 363372.[CrossRef][Medline]
Cerquetti, M., Serafino, A., Sebastianelli, A. & Mastrantonio, O. (2002). Binding of Clostridium difficile to Caco-2 epithelial cell line and to extracellular matrix proteins. FEMS Immunol Med Microbiol 32, 211218.[CrossRef][Medline]
Chia, J. S., Yeh, C. Y. & Chen, J. Y. (2000). Identification of a fibronectin binding protein from Streptococcus mutans. Infect Immun 68, 18641870.
Corpet, F., Servant, F., Gouzy, J. & Kahn, D. (2000). ProDom and ProDom-CG: tools for protein domain analysis and whole genome comparisons. Nucleic Acids Res 28, 267269.
Courtney, H. S., Li, Y., Dale, J. B. & Hasty, D. L. (1994). Cloning, sequencing, and expression of a fibronectin/fibrinogen-binding protein from group A streptococci. Infect Immun 62, 39373946.
Davies, H. A. & Borriello, S. P. (1990). Detection of capsule in strains of Clostridium difficile of varying virulence and toxigenicity. Microb Pathog 9, 141146.[CrossRef][Medline]
dos Santos, A. R., Jr & Wada, M. L. (1999). Foetal calf serum and dexamethasone effects on Vero cell growth and differentiation. Cytobios 99, 159171.[Medline]
Drudy, D., O'Donoghue, D. P., Baird, A., Fenelon, L. & O'Farrelly, C. (2001). Flow cytometric analysis of Clostridium difficile adherence to human intestinal epithelial cells. J Med Microbiol 50, 526534.
Fischetti, V. A., Pancholi, V. & Schneewind, O. (1990). Conservation of a hexapeptide sequence in the anchor region of surface proteins from gram-positive cocci. Mol Microbiol 4, 16031605.[Medline]
Gibson, C. M. & Caparon, M. G. (2002). Alkaline phosphatase reporter transposon for identification of genes encoding secreted proteins in gram-positive microorganisms. Appl Environ Microbiol 68, 928932.
Hennequin, C., Collignon, A. & Karjalainen, T. (2001a). Analysis of expression of GroEL (Hsp60) of Clostridium difficile in response to stress. Microb Pathog 31, 255260.[CrossRef][Medline]
Hennequin, C., Porcheray, F., Waligora-Dupriet, A., Collignon, A., Barc, M. C., Bourlioux, P. & Karjalainen, T. (2001b). GroEL (Hsp60) of Clostridium difficile is involved in cell adherence. Microbiology 147, 8796.
Holmes, A. R., McNab, R., Millsap, K. W., Rohde, M., Hammerschmidt, S., Mawdsley, J. L. & Jenkinson, H. F. (2001). The pavA gene of Streptococcus pneumoniae encodes a fibronectin-binding protein that is essential for virulence. Mol Microbiol 41, 13951408.[CrossRef][Medline]
Jonquières, R., Bierne, H., Fiedler, F., Gounon, P. & Cossart, P. (1999). Interaction between the protein InlB of Listeria monocytogenes and lipoteichoic acid: a novel mechanism of protein association at the surface of Gram-positive bacteria. Mol Microbiol 34, 902914.[CrossRef][Medline]
Karjalainen, T., Barc, M. C., Collignon, A., Trolle, S., Boureau, H., Cotte-Laffitte, J. & Bourlioux, P. (1994). Cloning of a genetic determinant from Clostridium difficile involved in adherence to tissue culture cells and mucus. Infect Immun 62, 43474355.
Karjalainen, T., Waligora-Dupriet, A. J., Cerquetti, M., Spigaglia, P., Maggioni, A., Mauri, P. & Mastrantonio, P. (2001). Molecular and genomic analysis of genes encoding surface-anchored proteins from Clostridium difficile. Infect Immun 69, 34423446.
Karjalainen, T., Saumier, N., Barc, M. C., Delmée, M. & Collignon, A. (2002). Clostridium difficile genotyping based on slpA variable region in S-layer gene sequence: an alternative to serotyping. J Clin Microbiol 40, 24522458.
Lupas, A., Van Dyke, M. & Stock, J. (1991). Predicting coiled coils from protein sequences. Science 252, 11621164.
Manganelli, R. & van de Rijn, I. (1999). Characterization of emb, a gene encoding the major adhesin of Streptococcus defectivus. Infect Immun 67, 5056.
Meehan, M., Muldowney, D. A., Watkins, N. J. & Owen, P. (2000). Localization and characterization of the ligand-binding domain of the fibrinogen-binding protein (FgBP) of Streptococcus equi subsp. equi. Microbiology 146, 11871194.
Navarre, W. W. & Schneewind, O. (1999). Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol Mol Biol Rev 63, 174229.
Ozeri, V., Rosenshine, I., Mosher, D. F., Fassler, R. & Hanski, E. (1998). Roles of integrins and fibronectin in the entry of Streptococcus pyogenes into cells via protein F1. Mol Microbiol 30, 625637.[CrossRef][Medline]
Poilane, I., Karjalainen, T., Barc, M. C., Bourlioux, P. & Collignon, A. (1998). Protease activity of Clostridium difficile strains. Can J Microbiol 44, 157161.[CrossRef][Medline]
Sakurai, T., Hajiro, K., Takakuwa, H., Nishi, A., Aihara, M. & Chiba, T. (2001). Liver abscess caused by Clostridium difficile. Scand J Infect Dis 33, 6970.[CrossRef][Medline]
Seddon, S. V. & Borriello, S. P. (1992). Proteolytic activity of Clostridium difficile. J Med Microbiol 36, 307311.
Tasteyre, A., Barc, M. C., Karjalainen, T., Dodson, P., Hyde, S., Bourlioux, P. & Borriello, P. (2000a). A Clostridium difficile gene encoding flagellin. Microbiology 146, 957966.
Tasteyre, A., Karjalainen, T., Avesani, V., Delmee, M., Collignon, A., Bourlioux, P. & Barc, M. C. (2000b). Phenotypic and genotypic diversity of the flagellin gene (fliC) among Clostridium difficile isolates from different serogroups. J Clin Microbiol 38, 31793186.
Tasteyre, A., Karjalainen, T., Avesani, V., Delmee, M., Collignon, A., Bourlioux, P. & Barc, M. C. (2001a). Molecular characterization of fliD gene encoding flagellar cap and its expression among Clostridium difficile isolates from different serogroups. J Clin Microbiol 39, 11781183.
Tasteyre, A., Barc, M. C., Collignon, A., Boureau, H. & Karjalainen, T. (2001b). Role of FliC and FliD flagellar proteins of Clostridium difficile in adherence and gut colonization. Infect Immun 69, 79377940.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.
van der Flier, M., Chhun, N., Wizemann, T. M., Min, J., McCarthy, J. B. & Tuomanen, E. I. (1995). Adherence of Streptococcus pneumoniae to immobilized fibronectin. Infect Immun 63, 43174322.
Vercellotti, G. M., McCarthy, J. B., Lindholm, P., Peterson, P. K., Jacob, H. S. & Furcht, L. T. (1985). Extracellular matrix proteins (fibronectin, laminin, and type IV collagen) bind and aggregate bacteria. Am J Pathol 120, 1321.[Abstract]
von Heijne, G. (1985). Structural and thermodynamic aspects of the transfer of proteins into and across membranes. Curr Top Membr Transp 242, 151179.
Waligora, A. J., Hennequin, C., Mullany, P., Bourlioux, P., Collignon, A. & Karjalainen, T. (2001). Characterization of a cell surface protein of Clostridium difficile with adhesive properties. Infect Immun 69, 21442153.
Whatmore, A. M. (2001). Streptococcus pyogenes sclB encodes a putative hypervariable surface protein with a collagen-like repetitive structure. Microbiology 147, 419429.
Received 30 May 2003;
revised 13 June 2003;
accepted 4 July 2003.
This article has been cited by other articles:
![]() |
C. Deneve, S. Bouttier, B. Dupuy, F. Barbut, A. Collignon, and C. Janoir Effects of Subinhibitory Concentrations of Antibiotics on Colonization Factor Expression by Moxifloxacin-Susceptible and Moxifloxacin-Resistant Clostridium difficile Strains Antimicrob. Agents Chemother., December 1, 2009; 53(12): 5155 - 5162. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Deneve, C. Delomenie, M.-C. Barc, A. Collignon, and C. Janoir Antibiotics involved in Clostridium difficile-associated disease increase colonization factor gene expression J. Med. Microbiol., June 1, 2008; 57(6): 732 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wright, D. Drudy, L. Kyne, K. Brown, and N. F. Fairweather Immunoreactive cell wall proteins of Clostridium difficile identified by human sera J. Med. Microbiol., June 1, 2008; 57(6): 750 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gerber, C. Walch, B. Loffler, K. Tischendorf, U. Reischl, and G. Ackermann Effect of sub-MIC concentrations of metronidazole, vancomycin, clindamycin and linezolid on toxin gene transcription and production in Clostridium difficile J. Med. Microbiol., June 1, 2008; 57(6): 776 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Janoir, S. Pechine, C. Grosdidier, and A. Collignon Cwp84, a Surface-Associated Protein of Clostridium difficile, Is a Cysteine Protease with Degrading Activity on Extracellular Matrix Proteins J. Bacteriol., October 15, 2007; 189(20): 7174 - 7180. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lemee, I. Bourgeois, E. Ruffin, A. Collignon, J.-F. Lemeland, and J.-L. Pons Multilocus sequence analysis and comparative evolution of virulence-associated genes and housekeeping genes of Clostridium difficile Microbiology, October 1, 2005; 151(10): 3171 - 3180. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pechine, A. Gleizes, C. Janoir, R. Gorges-Kergot, M.-C. Barc, M. Delmee, and A. Collignon Immunological properties of surface proteins of Clostridium difficile J. Med. Microbiol., February 1, 2005; 54(2): 193 - 196. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |