Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 149 (2003), 3001-3009; DOI  10.1099/mic.0.26479-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wacker, I.
Right arrow Articles by Stülke, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wacker, I.
Right arrow Articles by Stülke, J.
Agricola
Right arrow Articles by Wacker, I.
Right arrow Articles by Stülke, J.
Microbiology 149 (2003), 3001-3009; DOI  10.1099/mic.0.26479-0
© 2003 Society for General Microbiology

The regulatory link between carbon and nitrogen metabolism in Bacillus subtilis: regulation of the gltAB operon by the catabolite control protein CcpA

Ingrid Wacker{dagger}, Holger Ludwig{dagger}, Irene Reif, Hans-Matti Blencke, Christian Detsch and Jörg Stülke

Lehrstuhl für Mikrobiologie, Institut für Mikrobiologie, Biochemie und Genetik der Friedrich-Alexander-Universität Erlangen-Nürnberg, Staudtstr. 5, D-91058 Erlangen, Germany

Correspondence
Jörg Stülke
jstuelke{at}biologie.uni-erlangen.de


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacillus subtilis assimilates ammonium by the concerted action of glutamine synthetase and glutamate synthase. The expression of the gltAB operon encoding the latter enzyme is impaired in B. subtilis ccpA mutant strains. CcpA is a pleiotropic transcriptional regulator that is the key factor in the regulation of carbon metabolism. However, in addition to their defect in catabolite repression ccpA mutants are unable to grow on minimal media with glucose and ammonium as the single sources of carbon and nitrogen, respectively. In this work, the expression of the gltAB operon was analysed and its role in growth on minimal sugar/ammonium media was studied. Expression of gltAB requires induction by glucose or other glycolytically catabolized carbon sources. In ccpA mutants, gltAB cannot be induced by glucose due to the low activity of the phosphotransferase sugar transport system in these mutants. A mutation that allowed phosphotransferase system activity in a ccpA background simultaneously restored glucose induction of gltAB and growth on glucose/ammonium medium. Moreover, artificial induction of the gltAB operon in the ccpA mutant allowed the mutant strain to grow on minimal medium with glucose and ammonium. It may be concluded that expression of the gltAB operon depends on the accumulation of glycolytic intermediates which cannot occur in the ccpA mutant. The lack of gltAB induction is the bottleneck that prevents growth of the ccpA mutant on glucose/ammonium media. The control of expression of the gltAB operon by CcpA provides a major regulatory link between carbon and amino acid metabolism.


Abbreviations: PTS, phosphotransferase system

{dagger}These authors contributed equally to this work.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacillus subtilis utilizes glucose and glutamine as the preferred sources of carbon and nitrogen, respectively. If glucose or glutamine is present in the growth medium, the genes encoding enzymes involved in the utilization of secondary sources of carbon and nitrogen, respectively, are not expressed. This phenomenon is called catabolite repression.

The global control of carbon catabolism in B. subtilis is exerted by a pleiotropic regulatory protein, CcpA. In the presence of glucose, CcpA can interact with regulatory sites in the control regions of regulated operons to either repress or activate transcription. DNA-binding activity of CcpA is triggered by interaction with a protein of the phosphotransferase system (PTS), HPr or its regulatory paralogue Crh. In the presence of glucose, HPr and Crh are phosphorylated by a HPr kinase/phosphorylase (HPrK/P) on a regulatory seryl residue. HPr(Ser-P) and Crh(Ser-P) act as cofactors for CcpA (Deutscher et al., 1995Down, 2002Down; Galinier et al., 1997Down; Henkin, 1996Down; Stülke & Hillen, 2000Down). Recent proteome and transcriptome studies have demonstrated that about 250 and 85 genes are subject to CcpA-dependent repression and activation, respectively. Among the genes repressed by CcpA are those encoding enzymes required for the utilization of secondary carbon sources, but also genes of the Krebs citric acid cycle. The genes activated by CcpA include those required for overflow metabolism, glycolysis and the biosynthesis of certain amino acids (Blencke et al., 2003Down; Moreno et al., 2001Down; Tobisch et al., 1999Down; Yoshida et al., 2001Down).

Nitrogen metabolism is controlled by another transcription regulator, TnrA. In the absence of glutamine or ammonium, this protein activates transcription of genes encoding enzymes to utilize secondary nitrogen sources and represses expression of the glnA gene and the gltAB operon encoding enzymes of glutamine biosynthesis (Belitsky, 2002Down; Fisher & Débarbouillé, 2002Down). In the presence of repressing nitrogen sources, i.e. glutamine or ammonium, the glutamine synthetase binds and thereby inactivates TnrA (Wray et al., 2001Down).

The two regulatory systems allow the bacteria to utilize sequentially the available sources of carbon and nitrogen, thus enabling them to optimize their metabolism. There are, however, also interactions between carbon and nitrogen regulation. Glycolysis is induced by glucose, but full induction occurs only if amino acids are available as well. Similarly, the Krebs citric acid cycle is synergistically repressed by glucose and glutamate (Ludwig et al., 2001Down; Rosenkrantz et al., 1985Down; Sonenshein, 2002Down). The molecular mechanisms that allow control of gene expression by both carbon and nitrogen sources have not yet been elucidated in B. subtilis.

B. subtilis ccpA mutants are defective in carbon catabolite repression. This is, however, not their only phenotype: they also exhibit a severe growth defect on minimal media (Lindner et al., 1994Down; Martin et al., 1989Down). ccpA mutants are also unable to grow with glucose and ammonium as single sources of carbon and nitrogen, respectively (Faires et al., 1999Down; Miwa et al., 1994Down; Wray et al., 1994Down). The observation that ccpA mutants require glutamate (or a source of it) as a source of nitrogen led us to propose that CcpA might be involved in the control of glutamate biosynthesis (Faires et al., 1999Down). However, while ccpA mutants grow with glucose, ammonium and glutamate, growth is still slower than observed with wild-type bacteria. This can be circumvented by the addition of methionine and the branched-chain amino acids to the growth medium. The ilv–leu operon encoding enzymes of branched-chain amino acid biosynthesis is not fully expressed in ccpA mutants. The reason for the methionine requirement has not yet been elucidated (Ludwig et al., 2002aDown).

CcpA can regulate transcription in different ways. As mentioned above, many genes are controlled by CcpA by binding to a catabolite-responsive element (cre) in the control region. However, there are many CcpA-dependent genes which do not possess any detectable cre target sites (Blencke et al., 2003Down; Moreno et al., 2001Down; Yoshida et al., 2001Down). A novel mechanism of gene regulation was recently discovered for the gapA operon, encoding enzymes of the triose phosphate interconversion part of glycolysis. This operon is induced by glucose and other sugars, but induction by glucose cannot occur in a ccpA mutant. The genetic evidence suggested that this effect is exerted in an indirect way (Fillinger et al., 2000Down; Ludwig et al., 2001Down). Detailed analyses revealed that ccpA mutants are defective in the transport of sugars by the PTS. This defect results from a strongly increased phosphorylation of HPr on the regulatory Ser-46 in the ccpA mutant which prevents participation of HPr in sugar transport and phosphorylation (Ludwig et al., 2002bDown). Mutations that prevent phosphorylation of HPr on Ser-46 result in the restoration of sugar transport and gapA operon expression. Thus, due to the defective transport of PTS sugars in ccpA mutants, the internal inducer of the operon cannot accumulate, resulting in lack of induction of the gapA operon. This novel mode of control of gene expression by CcpA was defined as class II regulation (Ludwig et al., 2002bDown).

Ammonium assimilation involves two enzymes in B. subtilis: the glutamine synthetase catalyses the formation of glutamine from glutamate and ammonium, and the glutamate synthase converts 2-oxoglutarate and glutamine to two molecules of glutamate. One of these molecules of glutamate can be recycled to glutamine while the second molecule is now available for anabolism. This reaction is the main link between carbon metabolism in the Krebs citric acid cycle and nitrogen metabolism since glutamate is the universal donor of amino groups (Belitsky, 2002Down). In contrast to Escherichia coli and other bacteria, the glutamate dehydrogenase does not contribute to glutamate biosynthesis in B. subtilis. It was proposed that this enzyme has a catabolic role in B. subtilis (Belitsky & Sonenshein, 1998Down). Thus, the glutamate synthase encoded by the gltAB operon is essential for glutamate biosynthesis in this bacterium. Expression of the gltAB operon is repressed in the absence of ammonium by the pleiotropic regulator TnrA (Belitsky et al., 2000Down). In addition, the operon is under positive control of the transcriptional activator GltC (Bohannon & Sonenshein, 1989Down). The signal to which GltC responds is currently unknown. In addition, the gltAB operon is subject to control by the pleiotropic regulator CcpA. This control may link ammonium assimilation to the carbon and energy state of the cell (Faires et al., 1999Down).

In this study, we investigated the mechanism by which CcpA controls expression of the gltAB operon and the relation between expression of gltAB and the growth defect of ccpA mutants. As observed for the glycolytic gapA operon, gltAB belongs to the recently discovered class II of CcpA-dependent genes. Expression of the operon requires induction by any of a variety of sugars. Induction by PTS sugars is prevented in ccpA mutants, consistent with the idea that the PTS is inactive in these mutants (Ludwig et al., 2002bDown). The formation of an internal inducer may thus result from transport and metabolism of the sugars. Mutations that allow expression of the gltAB operon independent of CcpA result in a suppression of the growth defect of the ccpA mutants. Thus, the inefficient expression of the gltAB operon is the major bottleneck that limits growth of ccpA mutants.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains and growth conditions.
The B. subtilis strains used in this study are listed in Table 1Down. E. coli DH5{alpha} (Sambrook et al., 1989Down) was used for cloning experiments. B. subtilis was grown in C minimal medium (70 mM K2HPO4, 30 mM KH2PO4, 25 mM (NH4)2SO4, 0·5 mM MgSO4, 10 µM MnSO4, 22 mg ferric ammonium citrate l-1) supplemented with tryptophan (at 50 mg l-1) (Faires et al., 1999Down). CSE medium is C minimal medium supplemented with sodium succinate (6 g l-1) and potassium glutamate (8 g l-1). C-Glc is C minimal medium supplemented with glucose (1 g l-1), and CE-Glc is C minimal medium supplemented with potassium glutamate and glucose (8 g l-1 and 1 g l-1, respectively). E. coli was grown in LB medium and transformants were selected on plates containing ampicillin (100 µg ml-1). LB and SP (Kunst & Rapoport, 1995Down) plates were prepared by the addition of 17 g l-1 Bacto agar (Difco) to the medium.


View this table:
[in this window]
[in a new window]
 
Table 1. B. subtilis strains used in this study

 
DNA manipulation.
Transformation of E. coli and plasmid DNA extraction were performed by standard procedures (Sambrook et al., 1989Down). Restriction enzymes, T4 DNA ligase and DNA polymerases were used as recommended by the manufacturers. DNA fragments were purified from agarose gels using the Nucleospin extract kit (Macherey and Nagel). Pfu DNA polymerase was used for the polymerase chain reaction (PCR) as recommended by the manufacturer. DNA sequences were determined using the dideoxy chain termination method (Sambrook et al., 1989Down). Chromosomal DNA of B. subtilis was isolated as described by Kunst & Rapoport (1995)Down.

Transformation and characterization of the phenotype.
B. subtilis was transformed with plasmid and chromosomal DNA according to the two-step protocol (Kunst & Rapoport, 1995Down). Transformants were selected on SP plates containing chloramphenicol (5 µg ml-1), spectinomycin (100 µg ml-1), kanamycin (5 µg ml-1), or erythromycin plus lincomycin (1 and 10 µg ml-1, respectively). Quantitative assays of lacZ expression in B. subtilis were performed with cell extracts using ONPG as the substrate (Kunst & Rapoport, 1995Down).

Plasmid constructions.
A translational fusion of the gltAB promoter to a promoterless lacZ gene was constructed using the vector pAC7 (Weinrauch et al., 1991Down), which allows the introduction of the fusion into the amyE locus of B. subtilis. The 245 bp gltA promoter fragment (216 bp upstream to 29 bp downstream of the translational start codon) was amplified by PCR using primer pair IW1 (5'AAAGAATTCGATCAGCGGCTTCTGAAACGTG3')/IW2 (5'AAAGGATCCTGAGCTTTTGGCATTTGATTGTACGTC3'). The PCR product was digested by EcoRI and BamHI (the sites were introduced with the PCR primers; they are underlined in the sequences) and ligated with pAC7 linearized with the same enzymes. The identity of the cloned insert was verified by sequencing and the resulting plasmid was pGP526.

Construction of a strain allowing expression of the gltAB operon under control of the pxylA promoter.
To express the gltAB operon under a controllable promoter plasmid pGP724 was constructed as follows (see Fig. 1Down). A 520 bp PCR fragment (extending from 53 bp upstream to 467 bp downstream relative to the translational start of gltA) was generated by PCR using primers HMB55 (5'AACGCGGATCCGTTGTTAGATTTTATGACCGG3') and HMB56 (5'AACGCGGATCCAACTTGCGCCGATAAATACC3'). The resulting PCR product was digested with BamHI and ligated into plasmid pX2 (Mogk et al., 1997Down) linearized with BamHI (see Fig. 1aDown). The identity of the cloned insert was verified by sequencing. B. subtilis 168 was transformed with the resulting plasmid pGP724 and transformants were selected on SP plates containing chloramphenichol and xylose (1·5 %, w/v). The resulting strain GP222 was able to grow in C-Glc minimal medium only in the presence of xylose (1·5 %, w/v) or glutamate (0·8 %, w/v). Strain GP223, carrying the ccpA : : Tn917 insertion in addition to the xylose-inducible gltAB operon, was constructed by transformation of GP222 with chromosomal DNA of BGW2. The chromosomal arrangement of the gltAB operon of these strains is shown in Fig. 1(b)Down.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Construction of strains GP222 and GP223 carrying the gltAB operon fused to a xylose-inducible promoter. (a) Construction of plasmid pGP724 carrying the 5' region of the gltA gene ('gltA) including its Shine–Dalgarno region (SD) fused to the xylose-inducible promoter (pxylA). (b) Chromosomal arrangement of the gltAB region in B. subtilis GP222 after Campbell-type integration of pGP724 into the genome. GP223 was constructed by transformation of GP222 with chromosomal DNA of strain BGW2.

 
Northern blot analysis.
Preparation of total RNA of B. subtilis and Northern blot analysis were carried out as described previously (Ludwig et al., 2001Down). The gltA Digoxigenin RNA probe was obtained by in vitro transcription with T7 RNA polymerase (Roche Diagnostics) using a PCR-generated fragment obtained with primer pair HL45 (5'CAAAAGCTCAAGGTCTCTAC3')/HL46 (5'CTAATACGACTCACTATAGGGAGAATAAATACCTGACGGACAAAC3'). The reverse primer contained a T7 RNA polymerase recognition sequence (underlined in HL46). In vitro RNA labelling, hybridization and signal detection were carried out according to the manufacturer's instructions (DIG RNA labelling Kit and detection chemicals; Roche Diagnostics).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Regulation of the gltAB operon by the carbon source
Previous work demonstrated that expression of the gltAB operon is induced by ammonium and by glucose (Belitsky et al., 2000Down; Faires et al., 1999Down). While the ammonium-dependent regulation by the transcriptional regulator TnrA was studied in detail, the mechanism of induction by glucose has remained unknown. To analyse the regulation of the gltAB operon by different carbon sources, we assayed the expression of a translational fusion of the gltAB promoter region to a promoterless lacZ gene present in B. subtilis GP342. This strain was grown in CSE minimal medium in the presence of different carbon sources and {beta}-galactosidase activities were determined (Table 2Down). While the expression of the operon was very low in CSE medium, a more than 20-fold induction was observed in the presence of glucose. Similarly, fructose, glycerol and glucitol induced gltAB expression. Thus, the expression of the gltAB operon is induced by carbon sources metabolized via the glycolytic pathway.


View this table:
[in this window]
[in a new window]
 
Table 2. Induction of the gltAB operon by different sugars

Cultures of the B. subtilis strains GP342 (wild-type) and GP351 (ccpA) were grown in CSE medium supplemented with different carbon sources (final concentration 0·5 %, w/v, each) as indicated. The {beta}-galactosidase activities were measured in extracts prepared from exponentially growing cells (OD600 0·6–0·8).

 
The role of the transcriptional regulator CcpA in sugar induction of the gltAB operon
It has previously been reported that expression of the gltAB operon is impaired in ccpA mutants. However, no potential cre target site for binding of CcpA was detected in the gltAB promoter region (Faires et al., 1999Down). To study the role of CcpA in the induction of the gltAB operon in more detail, we analysed the expression of the gltA–lacZ fusion in the ccpA mutant strain GP351 (Table 2Up). While the ccpA mutation did not affect the basal expression of the fusion in CSE medium, there was no induction of gltAB expression in the presence of either glucose or fructose. In contrast, the ccpA mutation had no effect on the induction of the operon by glycerol and glucitol. The induction profile of the gltAB operon in the ccpA mutant strain was very similar to the regulation of the glycolytic gapA operon. In both cases, CcpA was required for induction by sugars transported by the PTS, but not for non-PTS carbohydrates.

The specific loss of induction by PTS sugars in the CcpA mutant suggested that the lack of PTS activity was the reason for the absence of expression of the gltAB operon. It had already been demonstrated that the reduced PTS activity in ccpA mutants is due to an excessive kinase activity of HPrK/P, which interferes with phosphorylation of HPr by Enzyme I of the PTS (Ludwig et al., 2002bDown). If this were the reason for the loss of glucose induction of gltAB in the ccpA mutant, we would expect that a mutation that prevents phosphorylation of HPr by the HPr kinase would restore sugar transport and concomitant induction of the gltAB operon. Such a mutation is the ptsH1 mutation, which affects the regulatory phosphorylation site in HPr. The ccpA ptsH1 double mutant strain is indeed capable of transporting glucose (Ludwig et al., 2002bDown). To address the involvement of CcpA and the PTS in the regulation of gltAB, we analysed the transcription of the operon in a wild-type strain (B. subtilis 168) and in its isogenic derivatives GP302 (ccpA) and GP335 (ccpA ptsH1). RNA was extracted from cells of the three strains grown in CSE minimal medium in the absence or presence of glucose and subjected to Northern blot analysis using a riboprobe specific for gltA (Fig. 2Down). In the wild-type strain, a 6·1 kb transcript was detected for glucose-grown cells. This mRNA size corresponds to the bicistronic gltAB operon encoding the two subunits of glutamate synthase. As observed with the lacZ fusion, no gltAB expression was detectable after growth of B. subtilis 168 in CSE medium without glucose. In the ccpA mutant, glucose did not induce the transcription of the gltAB operon. In contrast, induction was restored in the ccpA ptsH1 double mutant strain GP335. This finding is in good agreement with an analysis at the transcriptome level (Blencke et al., 2003Down) and with the idea that the reduced sugar transport by the PTS is the limiting factor for induction of the gltAB operon in the ccpA mutant, and suggests that gltAB is the second recognized member of class II of CcpA-regulated genes (see Discussion).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 2. Influence of a functional CcpA on expression of the gltAB operon. For Northern blot analysis total RNA was isolated from B. subtilis 168 (wild-type), GP302 (ccpA) and GP335 (ccpA ptsH1) grown in CSE minimal medium in the absence (-) or presence (+) of glucose (0·5 %, w/v). RNA was separated by electrophoresis in a 0·8 % formaldehyde agarose gel. After blotting, the nylon membrane was hybridized to a gltA-specific DIG-labelled riboprobe. Five micrograms of RNA per lane was applied. The size of the transcript corresponding to the full-length gltAB operon mRNA (6·1 kb) is indicated. The sizes of 16S rRNA and 23S rRNA are indicated by arrows.

 
Effect of the ptsH1 mutation on growth of the ccpA mutant in minimal medium
B. subtilis is able to grow with glucose and ammonium as single sources of carbon and nitrogen, respectively. However, ccpA mutant strains cannot grow in such a medium unless provided with glutamate or another source of organic nitrogen (Fig. 3Down; see also Faires et al., 1999Down; Ludwig & Stülke, 2001Down). If expression of the gltAB operon were the growth-limiting factor in the ccpA mutant, we would expect that the ptsH1 mutation would suppress the growth defect in addition to restoring glucose induction of gltAB. Indeed, the double mutant strain GP335 was able to grow in the absence of glutamate with glucose and ammonium as the only sources of carbon and nitrogen, respectively (Fig. 3Down). However, the growth rate of the double mutant was reduced as compared to the wild-type strain growing in the same medium. This might result from insufficient expression of the ilv–leu operon in the mutant (Ludwig et al., 2001Down). Moreover, both the wild-type and the ccpA ptsH1 double mutant strains grew faster in the presence of glutamate than in the medium containing ammonium as the single nitrogen source (see Fig. 3Down). This may be due to the need to assimilate ammonium via glutamine synthetase and glutamate synthase, which requires the consumption of one mole of ATP per mole of assimilated ammonium (Belitsky, 2002Down).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Suppression of the growth defect of a B. subtilis ccpA mutant strain by introduction of the ptsH1 allele. The growth of the wild-type strain 168, the ccpA mutant strain GP302 and the ccpA ptsH1 double mutant GP335 was monitored by measuring the OD600. Cultures were grown at 37 °C with vigorous agitation in C-Glc ({bullet}) and CE-Glc ({circ}). See Methods for details of media composition.

 
Growth of the ccpA mutant in minimal media in the presence of different carbon sources
As shown above, B. subtilis ccpA mutants are not able to use ammonium as a nitrogen source if glucose is present as a carbon source. This may be due to the lack of glucose induction of gltAB expression in the ccpA mutant. So far, growth of a ccpA mutant with ammonium and sugars different from glucose as single carbon sources has not been reported. Therefore, we compared the growth of the B. subtilis wild-type strain 168 and its isogenic ccpA derivative QB5407 in the presence of different carbohydrates. As shown in Fig. 4Down, the wild-type strain grew in the presence of all substrates tested. This correlates with the induction of the gltAB operon (see Table 2Up). In contrast, no growth of the ccpA mutant QB5407 was possible if the PTS sugars glucose or fructose were used as carbon sources. However, QB5407 grew if provided with glycerol or glucitol. This is in good agreement with the fact that the latter two carbohydrates are not transported by the PTS and induced the expression of the gltAB operon even in the ccpA mutant (see Table 2Up).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Identification of carbon sources that allow growth of a ccpA mutant strain with ammonia as the single nitrogen source. The growth of the wild-type strain 168 and the ccpA mutant QB5407 was monitored by measuring the OD600. Cultures were grown at 37 °C with vigorous agitation in C-glycerol ({triangledown}), C-glucitol ({blacktriangledown}), C-fructose ({circ}) and C-glucose ({bullet}). The final concentration of the different carbon sources was 1·0 %. Note that the scaling for the two strains is different due to large differences in the generation times.

 
Effect of artificially induced expression of the gltAB operon on the growth of a ccpA mutant
The results presented above strongly suggest that the lack of gltAB expression and the resulting deficiency in ammonium assimilation is the reason for the growth defect of the ccpA mutant. To prove this hypothesis, we placed the gltAB operon under the control of a xylose-inducible promoter. The functionality of this system was tested by a Northern blot analysis of gltAB expression in the wild-type strain 168 and in GP222 containing the regulatable promoter pxylA in front of its chromosomal gltAB operon (see Fig. 1bUp, Fig. 5Down). As noted before, expression of the gltAB operon was induced by glucose in the wild-type strain whereas xylose did not cause any induction. In contrast, a very strong expression of the gltAB operon was observed in strain GP222 in the presence of xylose. Thus, artificial induction of the gltAB operon was confirmed. The generation times of the relevant B. subtilis strains in ammonium-based minimal media containing (i) succinate, glutamate, glucose and xylose, (ii) glucose, or (iii) glucose and xylose are shown in Table 3Down. The B. subtilis strain GP222 contains the artificially inducible gltAB operon. Unlike the wild-type, this strain was unable to grow with glucose and ammonium as carbon and nitrogen source, respectively. Growth of GP222 was possible if the medium was supplemented with either glutamate or xylose, which artificially induced the gltAB operon in this strain. If the xylose-inducible gltAB operon was introduced into a ccpA mutant, the addition of xylose as the inducer allowed growth of the resulting strain GP223 in minimal medium containing glucose and ammonium (generation time 77 min; see Table 3Down). Our results demonstrate that expression of the gltAB operon is necessary and sufficient to support growth of the ccpA mutant. Thus, the limited induction of the gltAB operon is the major bottleneck for growth of the ccpA mutant in minimal medium with glucose and ammonium.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 5. Artificially induced expression of the gltAB operon. RNA was isolated from B. subtilis 168 (wild-type, WT) and GP222 (pxylA : : gltA) grown in CSE minimal medium in the absence (-) or presence of xylose (Xyl; 1·5 %, w/v) or glucose (Glc; 0·5 %, w/v). RNA was electrophoresed and probed as described in the legend to Fig. 2Up. The size of the transcript corresponding to the full-length gltAB operon mRNA (6·1 kb) is indicated. The sizes of 16S rRNA and 23S rRNA are indicated by arrows.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Growth rates of B. subtilis ccpA mutant strains expressing the gltAB operon from its own or a xylose-inducible promoter

Cells were grown at 37 °C with vigorous agitation in C minimal medium supplemented with glutamate (E, 0·8 %, w/v), succinate (S, 0·8 %), glucose (Glc, 0·5 %) or xylose (Xyl, 1·5 %) as indicated. Growth was monitored by measuring the OD600.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CcpA is the major player in the regulation of carbon catabolism in B. subtilis and other Gram-positive bacteria. In agreement with this notion, ccpA mutants do not exhibit carbon catabolite repression of numerous catabolic genes and operons. While this phenotype of ccpA mutants is immediately obvious, the reason for the growth defect observed with ccpA mutants of any tested species in minimal media has long been a matter of debate. In this work, we provide unequivocal evidence that lack of expression of the gltAB operon is the major bottleneck preventing growth of B. subtilis ccpA mutants in minimal media with glucose and ammonium as single sources of carbon and nitrogen, respectively.

Two alternative explanations have been proposed to explain the glutamate auxotrophy of ccpA mutants: while Faires et al. (1999)Down argued in favour of an insufficient expression of the gltAB operon, Belitsky (2002)Down suggested that the glutamate pool would be low in ccpA mutants due to the loss of carbon catabolite repression of rocG, encoding glutamate dehydrogenase (Belitsky & Sonenshein, 1998Down, 1999Down). Three lines of evidence presented in this work are clearly in agreement with the former idea. First, the gltAB operon is expressed in the ccpA mutant if non-PTS carbohydrates are present. Expression of the operon correlates with the growth of the ccpA mutant in the presence of these substrates. Second, the ptsH1 mutation suppresses both the loss of gltAB expression and the growth deficiency without restoring carbon catabolite repression (Blencke et al., 2003Down). Thus, loss of catabolite repression of rocG cannot be the cause of glutamate auxotrophy of the ccpA mutant. Finally, independent expression of the gltAB operon in a ccpA mutant is sufficient to suppress the growth defect. We were not able to get this result in a previous study (Faires et al., 1999Down). Detailed analyses revealed that the construct used in that analysis was not fully inducible (our unpublished results). However, the pxylA system used for artificial induction in this work has already proven to be very useful in previous studies (Ludwig et al., 2002aDown; Mogk et al., 1997Down). Thus, expression of the gltAB operon is necessary and sufficient to allow the ccpA mutant strain to grow on minimal media with glucose and ammonium.

Expression of the gltAB operon is controlled by three factors. First, in the absence of ammonium, the operon is repressed by the pleiotropic transcriptional regulator of nitrogen metabolism in B. subtilis, TnrA (Belitsky et al., 2000Down). Second, glutamate causes a mild repression of the gltAB operon. Third, expression of the gltAB operon is induced by the presence of carbohydrates such as glucose, glycerol and glucitol. Catabolism of all these carbohydrates involves glyceraldehyde 3-phosphate, which can then be further catabolized via the lower part of glycolysis. It is, however, unknown by which mechanism(s) repression and induction by glutamate and sugars, respectively, are exerted. The positive regulator of the gltAB operon, GltC, is a candidate for either control (Bohannon & Sonenshein, 1989Down).

Induction of the operon by glucose and fructose but not by glucitol and glycerol requires a functional CcpA protein. A similar induction pattern was observed for the glycolytic gapA operon of B. subtilis (Ludwig et al., 2002bDown). Moreover, we were not able to detect a potential cre site in the control region of the gltAB operon that might serve as a target for regulation by CcpA. We considered, therefore, that CcpA might play a similar role in induction of gltAB as recently demonstrated for the gapA operon: ccpA mutants are impaired in PTS sugar transport and phosphorylation due to an excessive kinase activity of HPr kinase/phosphatase. Therefore, internal inducers derived from the catabolism of these sugars cannot accumulate in ccpA mutants, resulting in loss of induction of gene expression. The PTS defect of ccpA mutants can be suppressed by a ptsH1 mutation, which prevents HPr phosphorylation by the HPr kinase. Indeed, the ptsH1 mutation did also suppress both the deficient expression of the gltAB operon and the growth defect of the ccpA mutant. Thus, the gltAB operon is the second recognized member of the class II of CcpA-responsive genes in addition to the glycolytic gapA operon. In a previous study, we isolated spontaneous mutants that exhibited suppression of the growth defect of ccpA mutants. One of these mutations, sgd-1, restored expression of the gltAB operon (Faires et al., 1999Down). However, the sgd-1 mutation has so far not been identified. With the finding that ptsH1 causes exactly the same phenotype, this latter mutation can be regarded as the first genetically defined sgd mutation understood at the molecular level.

For efficient growth of bacteria, the different branches of metabolism need to be tightly coordinated. Recent work demonstrates that there are several regulatory interrelationships between carbon and nitrogen metabolism in B. subtilis. As shown in this work, ammonium assimilation is strongly dependent on the carbohydrate supply. Moreover, syntheses of methionine and the branched-chain amino acids also depend on a functional CcpA, although to a lower degree (Ludwig et al., 2002aDown). In turn, several important steps of carbon metabolism are co-regulated by signals from carbohydrate and amino acid metabolism: expression of the glycolytic gapA operon is only fully induced if the cells are provided with both a sugar and a good source of amino acids (Ludwig et al., 2001Down); on the other hand, several genes encoding enzymes of the Krebs citric acid cycle such as citZ and citB are synergistically repressed by glucose and glutamate (Rosenkrantz et al., 1985Down). Interestingly, the specific regulators of citB and gltAB, CcpC and GltC, respectively, are both members of the LysR family of transcriptional regulators (Bohannon & Sonenshein, 1989Down; Jourlin-Castelli et al., 2000Down; Schell, 1993Down).

To better understand both the regulation of the gltAB operon and the interdependence between carbon and nitrogen metabolism it will be necessary to study the molecular details of the induction process by sugars. Work with this aim is in progress in our laboratory.


    ACKNOWLEDGEMENTS
 
We wish to thank Wolfgang Hillen, who provided a stimulating scientific environment. We acknowledge the help of Anastasija Matin, Karl-Ludwig Leidinger and Christoph Meinken with some experiments. This work was supported by grants from the DFG (Stu 214/2-2) and the Fonds der Chemischen Industrie.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Belitsky, B. R. (2002). Biosynthesis of amino acids of the glutamate and aspartate families, alanine and polyamines. In Bacillus subtilis and its Closest Relatives: from Genes to Cells, pp. 203–231. Edited by A. L. Sonenshein, J. A. Hoch & R. Losick. Washington, DC: American Society for Microbiology.

Belitsky, B. R. & Sonenshein, A. L. (1998). Role and regulation of Bacillus subtilis glutamate dehydrogenase genes. J Bacteriol 180, 6298–6305.[Abstract/Free Full Text]

Belitsky, B. R. & Sonenshein, A. L. (1999). An enhancer element located downstream of the major glutamate dehydrogenase gene of Bacillus subtilis. Proc Natl Acad Sci U S A 96, 10290–10295.[Abstract/Free Full Text]

Belitsky, B. R., Wray, L. V., Jr, Fisher, S. H., Bohannon, D. E. & Sonenshein, A. L. (2000). Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. J Bacteriol 182, 5939–5947.[Abstract/Free Full Text]

Blencke, H.-M., Homuth, G., Ludwig, H., Mäder, U., Hecker, M. & Stülke, J. (2003). Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab Eng 5, 133–149.[CrossRef][Medline]

Bohannon, D. E. & Sonenshein, A. L. (1989). Positive regulation of glutamate biosynthesis in Bacillus subtilis. J Bacteriol 171, 4718–4727.[Abstract/Free Full Text]

Deutscher, J., Küster, E., Bergstedt, U., Charrier, V. & Hillen, W. (1995). Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in Gram-positive bacteria. Mol Microbiol 15, 1049–1053.[Medline]

Deutscher, J., Galinier, A. & Martin-Verstraete, I. (2002). Carbohydrate uptake and metabolism. In Bacillus subtilis and its Closest Relatives: from Genes to Cells, pp. 129–150. Edited by A. L. Sonenshein, J. A. Hoch & R. Losick. Washington, DC: American Society for Microbiology.

Faires, N., Tobisch, S., Bachem, S., Martin-Verstraete, I., Hecker, M. & Stülke, J. (1999). The catabolite control protein CcpA controls ammonium assimilation in Bacillus subtilis. J Mol Microbiol Biotechnol 1, 141–148.[Medline]

Fillinger, S., Boschi-Muller, S., Azza, S., Dervyn, E., Branlant, G. & Aymerich, S. (2000). Two glyceraldehyde-3-phosphate dehydrogenases with opposite physiological roles in a nonphotosynthetic bacterium. J Biol Chem 275, 14031–14037.[Abstract/Free Full Text]

Fisher, S. H. & Débarbouillé, M. (2002). Nitrogen source utilization and its regulation. In Bacillus subtilis and its Closest Relatives: from Genes to Cells, pp. 181–191. Edited by A. L. Sonenshein, J. A. Hoch & R. Losick. Washington, DC: American Society for Microbiology.

Galinier, A., Haiech, J., Kilhoffer, M.-C., Jaquinod, M., Stülke, J., Deutscher, J. & Martin-Verstraete, I. (1997). The Bacillus subtilis crh gene encodes a HPr-like protein involved in catabolite repression. Proc Natl Acad Sci U S A 94, 8439–8444.[Abstract/Free Full Text]

Henkin, T. M. (1996). The role of the CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis. FEMS Microbiol Lett 135, 9–15.[CrossRef][Medline]

Jourlin-Castelli, C., Mani, N., Nakano, M. M. & Sonenshein, A. L. (2000). CcpC, a novel regulator of the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J Mol Biol 295, 865–878.[CrossRef][Medline]

Krüger, S., Stülke, J. & Hecker, M. (1993). Catabolite repression of {beta}-glucanase synthesis in Bacillus subtilis. J Gen Microbiol 139, 2047–2054.[Medline]

Kunst, F. & Rapoport, G. (1995). Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis. J Bacteriol 177, 2403–2407.[Abstract/Free Full Text]

Lindner, C., Stülke, J. & Hecker, M. (1994). Regulation of xylanolytic enzymes in Bacillus subtilis. Microbiology 140, 753–757.[Abstract/Free Full Text]

Ludwig, H. & Stülke, J. (2001). The Bacillus subtilis catabolite control protein CcpA exerts all its regulatory functions by DNA-binding. FEMS Microbiol Lett 203, 125–129.[CrossRef][Medline]

Ludwig, H., Homuth, G., Schmalisch, M., Dyka, F. M., Hecker, M. & Stülke, J. (2001). Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon. Mol Microbiol 41, 409–422.[CrossRef][Medline]

Ludwig, H., Meinken, C., Matin, A. & Stülke, J. (2002a). Insufficient expression of the ilv-leu operon encoding enzymes of branched-chain amino acid biosynthesis limits growth of a Bacillus subtilis ccpA mutant. J Bacteriol 184, 5174–5178.[Abstract/Free Full Text]

Ludwig, H., Rebhan, N., Blencke, H.-M., Merzbacher, M. & Stülke, J. (2002b). Control of the glycolytic gapA operon by the catabolite control protein A in Bacillus subtilis: a novel mechanism of CcpA-mediated regulation. Mol Microbiol 45, 543–553.[CrossRef][Medline]

Martin, I., Débarbouillé, M., Klier, A. & Rapoport, G. (1989). Induction and metabolite regulation of levanase synthesis in Bacillus subtilis. J Bacteriol 171, 1885–1892.[Abstract/Free Full Text]

Miwa, Y., Saikawa, M. & Fujita, Y. (1994). Possible function and some properties of the CcpA protein of Bacillus subtilis. Microbiology 140, 2567–2575.[Abstract/Free Full Text]

Mogk, A., Homuth, G., Scholz, C., Kim, L., Schmid, F. X. & Schumann, W. (1997). The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis. EMBO J 16, 4579–4590.[CrossRef][Medline]

Moreno, M. S., Schneider, B. L., Maile, R. R., Weyler, W. & Saier, M. H., Jr (2001). Catabolite repression mediated by CcpA protein in Bacillus subtilis: novel modes of regulation revealed by whole-genome analyses. Mol Microbiol 39, 1366–1381.[CrossRef][Medline]

Rosenkrantz, M. S., Dingman, D. W. & Sonenshein, A. L. (1985). Bacillus subtilis citB gene is regulated synergistically by glucose and glutamine. J Bacteriol 164, 155–164.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schell, M. A. (1993). Molecular biology of the LysR family of transcriptional regulators. Annu Rev Microbiol 47, 597–626.[CrossRef][Medline]

Sonenshein, A. L. (2002). The Krebs citric acid cycle. In Bacillus subtilis and its Closest Relatives: from Genes to Cells, pp. 151–162. Edited by A. L. Sonenshein, J. A. Hoch & R. Losick. Washington, DC: American Society for Microbiology.

Stülke, J. & Hillen, W. (2000). Regulation of carbon catabolism in Bacillus species. Annu Rev Microbiol 54, 849–880.[CrossRef][Medline]

Tobisch, S., Zühlke, D., Bernhardt, J., Stülke, J. & Hecker, M. (1999). Role of CcpA in regulation of the central pathways of carbon catabolism in Bacillus subtilis. J Bacteriol 181, 6996–7004.[Abstract/Free Full Text]

Weinrauch, Y., Msadek, T., Kunst, F. & Dubnau, D. (1991). Sequence and properties of comQ, a new competence regulatory gene of Bacillus subtilis. J Bacteriol 173, 5685–5693.[Abstract/Free Full Text]

Wray, L. V., Jr, Pettengill, F. K. & Fisher, S. H. (1994). Catabolite repression of the Bacillus subtilis hut operon requires a cis-acting site located downstream of the transcription initiation site. J Bacteriol 176, 1894–1902.[Abstract/Free Full Text]

Wray, L. V., Jr, Zalieckas, J. M. & Fisher, S. H. (2001). Bacillus subtilis glutamine synthetase controls gene expression through a protein-protein interaction with transcription actor TnrA. Cell 107, 427–435.[CrossRef][Medline]

Yoshida, K.-I., Kobayashi, K., Miwa, Y. & 9 other autors (2001). Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucleic Acids Res 29, 6683–6692.

Received 11 May 2003; revised 2 July 2003; accepted 2 July 2003.


This article has been cited by other articles:


Home page
MicrobiologyHome page
A. Kayumov, A. Heinrich, M. Sharipova, O. Iljinskaya, and K. Forchhammer
Inactivation of the general transcription factor TnrA in Bacillus subtilis by proteolysis
Microbiology, August 1, 2008; 154(8): 2348 - 2355.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
F. M. Commichau, K. Gunka, J. J. Landmann, and J. Stulke
Glutamate Metabolism in Bacillus subtilis: Gene Expression and Enzyme Activities Evolved To Avoid Futile Cycles and To Allow Rapid Responses to Perturbations of the System
J. Bacteriol., May 15, 2008; 190(10): 3557 - 3564.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
O. Schilling, O. Frick, C. Herzberg, A. Ehrenreich, E. Heinzle, C. Wittmann, and J. Stulke
Transcriptional and Metabolic Responses of Bacillus subtilis to the Availability of Organic Acids: Transcription Regulation Is Important but Not Sufficient To Account for Metabolic Adaptation
Appl. Envir. Microbiol., January 1, 2007; 73(2): 499 - 507.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Miethke, H. Westers, E.-J. Blom, O. P. Kuipers, and M. A. Marahiel
Iron Starvation Triggers the Stringent Response and Induces Amino Acid Biosynthesis for Bacillibactin Production in Bacillus subtilis
J. Bacteriol., December 15, 2006; 188(24): 8655 - 8657.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
J. Deutscher, C. Francke, and P. W. Postma
How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 939 - 1031.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Y. Wei, G. Deikus, B. Powers, V. Shelden, T. A. Krulwich, and D. H. Bechhofer
Adaptive Gene Expression in Bacillus subtilis Strains Deleted for tetL.
J. Bacteriol., October 1, 2006; 188(20): 7090 - 7100.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. K. Marr, B. Joseph, S. Mertins, R. Ecke, S. Muller-Altrock, and W. Goebel
Overexpression of PrfA Leads to Growth Inhibition of Listeria monocytogenes in Glucose-Containing Culture Media by Interfering with Glucose Uptake
J. Bacteriol., June 1, 2006; 188(11): 3887 - 3901.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
G. L. Lorca, Y. J. Chung, R. D. Barabote, W. Weyler, C. H. Schilling, and M. H. Saier Jr
Catabolite Repression and Activation in Bacillus subtilis: Dependency on CcpA, HPr, and HprK
J. Bacteriol., November 15, 2005; 187(22): 7826 - 7839.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
B. Gorke, E. Foulquier, and A. Galinier
YvcK of Bacillus subtilis is required for a normal cell shape and for growth on Krebs cycle intermediates and substrates of the pentose phosphate pathway
Microbiology, November 1, 2005; 151(11): 3777 - 3791.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S.-K. Choi and M. H. Saier Jr.
Regulation of sigL Expression by the Catabolite Control Protein CcpA Involves a Roadblock Mechanism in Bacillus subtilis: Potential Connection between Carbon and Nitrogen Metabolism
J. Bacteriol., October 1, 2005; 187(19): 6856 - 6861.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
B. R. Belitsky, H.-J. Kim, and A. L. Sonenshein
CcpA-Dependent Regulation of Bacillus subtilis Glutamate Dehydrogenase Gene Expression
J. Bacteriol., June 1, 2004; 186(11): 3392 - 3398.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
B. R. Belitsky and A. L. Sonenshein
Modulation of Activity of Bacillus subtilis Regulatory Proteins GltC and TnrA by Glutamate Dehydrogenase
J. Bacteriol., June 1, 2004; 186(11): 3399 - 3407.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
C. Detsch and J. Stulke
Ammonium utilization in Bacillus subtilis: transport and regulatory functions of NrgA and NrgB
Microbiology, November 1, 2003; 149(11): 3289 - 3297.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wacker, I.
Right arrow Articles by Stülke, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wacker, I.
Right arrow Articles by Stülke, J.
Agricola
Right arrow Articles by Wacker, I.
Right arrow Articles by Stülke, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2003 Society for General Microbiology.