|
|
||||||||
1 INSERM U411, Faculté de Médecine Necker, 156 rue de Vaugirard, 75730 Paris Cedex 15, France
2 Laboratoire Mixte PasteurNecker de Recherche sur les Streptocoques et Streptococcies, Faculté de Médecine Necker, 156 rue de Vaugirard, 75730 Paris Cedex 15, France
3 INSERM U345, Faculté de Médecine Necker, 156 rue de Vaugirard, 75730 Paris Cedex 15, France
Correspondence
Shamila Nair
nair{at}necker.fr
| ABSTRACT |
|---|
|
|
|---|
The GenBank accession number for the Streptococcus agalactiae clpP gene sequence reported in this paper is AJ413168.
| INTRODUCTION |
|---|
|
|
|---|
Group B Streptococcus (GBS), also known as Streptococcus agalactiae, is part of the normal human microflora colonizing the respiratory, gastrointestinal and urogenital tracts. This extracellular bacterium is one of the leading causes of invasive infections, bacterial sepsis and meningitis in neonates (Schuchat, 1998
). The physiopathology of GBS infections implies that this bacterium can adapt rapidly to various growth conditions, including pH, osmolarity and temperature variations (Tamura et al., 1994
). In this study, we investigated the contribution of oxidative stress due to heat exposure in GBS. We identified the clpP gene of S. agalactiae and showed that its product, the serine protease ClpP, is involved in the regulation of growth at high temperatures and survival under stress conditions. During heat shock, an S. agalactiae
clpP mutant was growth-arrested and displayed important modifications of its total protein content, including a decreased level of essential metabolic enzymes such as the alcohol dehydrogenase. Under these conditions, ClpP also contributed to cell division and septum formation. Finally, we demonstrated that in the absence of the ClpP protease, the level of carbonylated DnaK was increased. Our results suggest that, during heat shock, GBS ClpP might play an important role in the synthesis of functional proteins in the cell.
| METHODS |
|---|
|
|
|---|
was used for cloning experiments. S. agalactiae and E. coli were cultured in brainheart infusion (BHI) broth or on BHI agar (Difco Laboratories) at 37 °C. Unless specified otherwise, antibiotics were used at the following concentrations: for E. coli, 100 µg ampicillin ml-1, 150 µg erythromycin ml-1, 50 µg kanamycin ml-1 and 60 µg spectinomycin ml-1; for S. agalactiae, 10 µg erythromycin ml-1, 1000 µg kanamycin ml-1 and 250 µg spectinomycin ml-1. S. agalactiae liquid cultures were grown in standing, filled flasks. Stress conditions at 37 °C in the presence or absence of 1 M NaCl or 0·5 mM H2O2 were as described previously (Nair et al., 1999
|
Cloning and sequencing of ClpP.
Based on the alignment of the ClpP amino acid sequences of Streptococcus pyogenes, Streptococcus salivarius, Streptococcus mutans and Streptococcus pneumoniae, we designed two degenerate oligonucleotide primers, designated P1 and P2. These primers were used to amplify a 573 bp DNA fragment internal to the streptococcal clpP gene. PCR was carried out in a final volume of 50 µl containing 50 ng S. agalactiae DNA, 0·1 µM each primer, 200 µM each dNTP and 2 U AmpliTaq Gold DNA polymerase (Applied Biosystems) in 1x times; amplification buffer. DNA was sequenced with an ABI model 310 automated DNA sequencer using the ABI PRISM dye terminator cycle sequencing kit (Applied Biosystems). Sequence analysis of the cloned PCR fragment revealed that it was highly related to known clpP genes present in the databases (data not shown). Southern blot analysis of S. agalactiae NEM316 chromosomal DNA using the cloned PCR fragment as a probe revealed that the clpP gene was located on a 1500 bp SspI DNA fragment (data not shown). Therefore, the remaining portion of the clpP gene was obtained by inverse PCR of chromosomal DNA digested with SspI. Self-ligated DNA was used as a template in PCRs carried out with primers P3 and P4. The resulting 950 bp PCR fragment was cloned into pUC18 and sequenced using custom-synthesized oligonucleotides. Assembly of the sequences of the DNA fragments amplified with the primer pairs P1/P2 and P3/P4 yielded a 1458 bp SspI DNA fragment containing clpP. To verify that we had correctly assembled the PCR fragments, primers P5 and P6 were used to amplify a 1316 bp fragment from S. agalactiae NEM316 chromosomal DNA; three clones were sequenced in their entirety on both strands.
Construction of an allelic GBS ClpP mutant.
To construct the S. agalactiae
clpP strain, we inserted a promoterless and terminatorless kanamycin-resistance cassette, aphA-3, within DNA segments internal to clpP. This was done by ligating, after digestion with the appropriate enzymes, the amplicons P7P8, KanKKanB and P9P10. The corresponding EcoRIPstI fragments were cloned into pG+host5; the resulting recombinant vector, pSN600, was introduced into S. agalactiae NEM316 by electroporation. The double-crossover events leading to the expected gene replacements were screened and obtained as described previously (Biswas et al., 1993
; Rouquette et al., 1998
). In the resulting S. agalactiae mutant NEM1968 (
clpP), the promoterless kanamycin-resistance cassette used to inactivate clpP is likely to be transcribed from PclpP. Southern analysis of restriction-enzyme-digested chromosomal DNA revealed that the mutant strain was devoid of sequences related to pG+host5 and that insertion of the resistance cassette had occurred at the expected location (data not shown).
For complementation analysis, we used the following strategy. Primer pair P5/P6 was used to amplify clpP together with its upstream promoter region (409 bp), PclpP. The corresponding 1316 bp fragment was cloned into pAT113/Sp to give pAT113/Sp
clpP. This vector was conjugatively transferred (Poyart et al., 2001b
) from HB101/pRK24 to S. agalactiae
clpP/pTCV-int to restore the ClpP activity in this mutant strain. The plasmid insertion site was characterized in three integrants harbouring a single copy of pAT113/Sp
clpP inserted at different loci. This was done by inverted PCR as described previously (Poyart et al., 2001b
). The complemented strain NEM1969 (
clpPc) was chosen for further studies because in this strain pAT113/Sp
clpP was not inserted within a protein-coding sequence (data not shown).
RNA preparations and Northern blot analysis.
Total RNAs were extracted as described previously (Gaillot et al., 1997
) from exponential phase (OD600 0·6) cultures of S. agalactiae grown in BHI broth at 37 or 41 °C without agitation. For Northern blot analysis, 40 µg RNA were separated through a 1·3 % formaldehyde/agarose gel (Sambrook et al., 1989
) and transferred to a Hybond-N+ membrane (Amersham). The filters were baked for 2 h at 80 °C in an oven. Pre-hybridization and hybridization were performed under stringent conditions as described by Sambrook et al. (1989)
. The DNA probe used was a PCR fragment obtained from NEM316 genomic DNA by using primers P1 and P2. DNA fragments were labelled with [
-32P]dCTP by using the Nick Translation Kit (Amersham).
Flow cytometry analysis.
GBS strains were cultivated in BHI broth, at either 37 or 41 °C, and collected during the exponential and stationary phases of growth. Samples were fixed by the addition of cold ethanol to a final concentration of 70 % and stored for up to one week at 4 °C in ethanol. When appropriate, fixed cultures were centrifuged and resuspended in PBS (10 mM potassium phosphate; 150 mM sodium chloride; pH 7·0). Dilutions were mixed with 10 µM propidium iodide (PI) and cells were analysed on a Becton Dickinson Calibur System. Excitation was at 458 nm and fluorescence was measured at 495 nm. Flow cytometry data were collected and analysed using CELLQUEST software (Becton Dickinson).
Carbonylation assays.
Exponential and stationary phase cultures (20 ml) were pelleted and crude protein extracts were prepared using the Fast Prep BIO101 machine and kit (Ozyme). The carbonyl groups in the protein side chains were derivatized, using the OxyBlot kit (Oncor), to 2,4-dinitrophenylhydrazone (DNP-hydrazone) by reaction with 2,4-dinitrophenylhydrazine as described by Dukan & Nystrom (1998)
. The DNP-derivatized crude protein extracts were separated by SDS-PAGE and subsequently transferred to PVDF membranes by using a semi-dry blotting system. The filters were incubated with primary antibody, specific to the DNP moiety of the proteins, and subsequently incubated with a secondary (goat-anti-rabbit) horseradish peroxidaseantibody conjugate directed against the primary antibody. For detection, the filters were treated with the ECL+ chemiluminescence blotting substrate (Amersham Pharmacia Biotech).
Protein analysis.
Protein extracts were prepared from cultures of the wild-type,
clpP and
clpPc strains grown at 37 or 41 °C using the Fastprep kit (Ozyme) and the BIO 101 machine. The concentration of protein in each soluble extract was measured using the Bradford assay and equal amounts of protein were loaded into each lane. SDS-PAGE and Western blot analyses were done as described previously (Nair et al., 2000a
). Polyclonal antibodies raised against pneumococcal DnaK (Kim et al., 1998
) were diluted 1 : 1000 in PBS. Comparative two-dimensional gel analysis of proteins was performed in a Protean II xi 2D-cell apparatus (Bio-Rad). IEF was prepared with ampholines covering pH 310.
The Panvera Protease Activity Detection kit was used to calculate overall protease activity. This kit uses an FTC-labelled casein as a substrate, which decreases in size as a result of degradation causing a change in spectrophotometric absorbance and fluorescence. Experiments were repeated at least three times on different protein extracts.
Protein sequencing was done by Edman degradation at the Protein Sequencing Laboratory, Pasteur Institute.
Electron microscopy.
Exponential or stationary phase growing bacteria (37 and 41 °C) were processed for thin-sectioning and examined under the electron microscope as described by Frehel & Leduc (1987)
.
Mouse virulence assays.
Six- to eight-week-old pathogen-free ICR female Swiss mice (Janvier, Le Geneset St Isle) were used in this study. Groups of 10 mice were inoculated intravenously with increasing doses of the wild-type, ClpP mutant and complemented strain. The LD50 was determined by the probit method. For estimation of bacterial numbers in organ homogenates, groups of four mice were inoculated intravenously with 106 bacteria diluted in 0·9 % NaCl. Bacterial numbers in homogenates of spleen, liver, brain and blood were determined at various intervals by plating onto BHI agar plates supplemented, when possible, with the appropriate antibiotic(s) as described previously (Poyart et al., 2001b
). Mice were killed by cervical dislocation in accordance with the policies of the Animal Welfare Committee of the Faculte Necker (Paris), and the experiment was performed twice.
Oligonucleotides.
The sequences (5' to 3') of the relevant oligonucleotides used in this study were: P1, ATGATTCCTGTWGTWATTGAACAAAC; P2, CCATRATTTCATCRATRAARCC; P3, CATAAGAGCGTTCACCACGAC; P4, CACTTGATTATGGCTTCATCG; P5, GTTACCTGAAGATATTGATCAACG; P6, CCTGATCAATATCATCAATTGC; P7, ATGAATTCTGTTGTTATTGAACAAACAAGTCG; P8, AGCGGTACCAGCCGATACTGAACCACCTGG; P9, GTGGATCCATGAACTTTATTAAATCGGACG; P10, ATGCTGCAGTCGATGAAGCCATAATCAAGTG. The sequences of the restriction sites added for molecular cloning are shown in bold.
| RESULTS |
|---|
|
|
|---|
G° at 37 °C=-12·6 kcal mol-1) was detected 17 bp downstream from orf3, which suggested that clpP is transcribed as a monocistronic mRNA.
|
A-type -35 and -10 promoter recognition sequence (TTGACc-X17-TATAAT) was detected 32 bp upstream from clpP, which is likely to constitute the promoter of this gene (PclpP). The transcription of clpP from NEM316 was studied in bacteria cultivated at 37 and 41 °C in BHI broth. A single transcript of approximately 1 kb in size was detected with the P1P2 DNA probe and the intensity of the signal was higher with the RNA extracted from the culture grown at 41 °C than from that grown at 37 °C (Fig. 1c
ClpP is required for growth under different stress conditions
The ClpP proteins of various prokaryotes, including B. subtilis (Gerth et al., 1998
) and the facultative intracellular pathogen L. monocytogenes (Gaillot et al., 2000
), have been shown to play an essential role in stress tolerance. To determine the role of ClpP in GBS stress tolerance, we constructed an S. agalactiae strain lacking a functional ClpP (
clpP) and an S. agalactiae
clpP complemented strain (
clpPc) (see Methods). Stress tolerances of the
clpP and
clpPc strains were compared to those of the wild-type. At 37 °C, the growth rate of
clpP was reduced when compared to that of the wild-type and
clpPc strains (Fig. 2
a); in the presence of NaCl or H2O2, the growth rate of the
clpP strain was severely impaired (Fig. 2c, d
). During heat shock at 41 °C, the mutant grew very slowly and after reaching an OD600 value of approximately 0·4 stopped growing, even after overnight incubation (Fig. 2b
). Bacterial growth was fully restored in the complemented strain. Taken together, these results indicate that ClpP is required for growth of S. agalactiae under heat-shock, salt- and oxidative-stress conditions. However, in the presence of ethanol, which is supposed to induce a heat-shock response (Bochner et al., 1984
), we observed that growth of the mutant was not as affected by this stress as compared to growth in the presence of NaCl or H2O2 (data not shown).
|
clpP strain struggled to grow under the different stress conditions, we checked whether it displayed stress-related morphological changes. The wild-type,
clpP and
clpPc strains were examined by electron microscopy during the exponential and stationary phases of growth when cultivated at 37 or 41 °C in BHI broth. Thin-section electron microscopy of the wild-type and
clpPc strains showed new septal planes formed parallel to the cell division plane and occurring at the mid-point of the elongating cells (Fig. 3a
clpP mutant exhibited no relevant morphological changes (data not shown). In contrast, during exponential, and even more pronounced during stationary phase at 41 °C, the
clpP strain displayed an aberrant morphology due to the presence of large multiseptated cells containing non-parallel septa (Fig. 3b
clpPc strains were surrounded by a thin and heavily stained cell wall, the
clpP strain exhibited a thick and lightly stained cell wall. Surprisingly, these pleomorphic cells were only observed during growth of the mutant at 41 °C but not during the other stress conditions tested in this study (NaCl or H2O2). Thus, during heat shock, lack of ClpP in GBS results in poor survival and in dramatic morphological alterations.
|
clpP strain was temperature-sensitive, did not separate, had multiple septa and appeared to be blocked in its cell cycle and cell division. We thus tested whether depleting cells for ClpP would result in an alteration of DNA content and block DNA replication under stress conditions. Flow cytometry was used to screen the different strains grown at 37 and 41 °C. Signal intensity of cells stained with PI is directly proportional to their DNA content. Bacterial cells were stained with PI, measurements were gated by cell size, 3x104 cells, and the data were plotted as a dual-parameter histogram of relative cell counts versus DNA content (PI) (Fig. 4
clpP and
clpPc strains had similar DNA contents, albeit slightly higher than the wild-type. However, during heat shock, mutant cells displayed a dramatic increase in their DNA content, probably explaining the defects in morphology observed at this restrictive temperature (Fig. 4
|
clpP mutant as compared to the wild-type or complemented strains, even though the same quantity of total protein extract was loaded on the gels for each strain as determined by the Bradford assay (Fig. 5
clpP mutant probably contained more truncated proteins and/or low-molecular-mass polypeptides that could not be visualized as individual bands by SDS-PAGE. The presence of smeared low-molecular-mass peptides could explain why there were apparently less proteins in the
clpP extracts as compared with the wild-type strain, even though the same amount of proteins were loaded onto the gel, as quantified by the Bradford assay. When we extracted proteins from the same amount of cells, we still observed this difference in the protein patterns (data not shown). We measured total protease activity in crude extracts of the wild-type,
clpP and
clpPc strains grown at 41 °C. A significant decrease in overall protease activity was observed for the mutant (66±8 % versus 100±12 %). Thus, it is conceivable that the smeared proteins observed in the
clpP strain grown at 41 °C (Fig. 5
|
clpP mutant. Two proteins that were missing in the mutant were unambiguously identified as the 21·5 kDa GBS ClpP protein (MIPVVIEQTSR) and the alcohol dehydrogenase protein (MKAVVVNQAS) of S. agalactiae (Glaser et al., 2002
Lack of ClpP protease induces DnaK protein carbonylation
As shown previously, the growth of the
clpP mutant was blocked during heat shock. In E. coli and Saccharomyces cerevisiae, oxidative stress is involved in heat-induced cell death (Davidson et al., 1996
; Dukan & Nystrom, 1998
, 1999
). Therefore, we looked at the levels of oxidized proteins during heat shock and growth arrest of the
clpP mutant as compared to the wild-type and complemented strains. This was done by using an immunochemical assay to detect protein carbonyl groups (Tamarit et al., 1998
) in crude protein extracts obtained after overnight growth at 37 or 41 °C. This analysis revealed a similar low level of protein carbonylation in the wild-type and complemented strains grown at both temperatures (Fig. 6
a, lanes 11' and 22'). In contrast, higher levels of carbonylated proteins were detected in the clpP mutant and the patterns obtained clearly indicated that, in this strain, carbonylation is heat-induced (Fig. 6a
, lanes 33'). Using SDS-PAGE, we further analysed the pattern of carbonylation of proteins extracted from the wild-type and mutant strains grown at 41 °C. Three carbonylated protein bands were detected in all strains (Fig. 6b
). This is in contrast to the many carbonylated proteins observed in E. coli by Dunkan & Nystrom (1998)
. We took advantage of this situation to sequence carbonylated proteins directly off one-dimensional gels and in all cases, HPLC analysis of Edman degradation products clearly revealed single peaks corresponding to a single protein. Two of these bands were identified as DnaK (XKIIGIDLGTTNSAV) and glyceraldehyde-3-phosphate dehydrogenase (VVKVGINGFGRIGRLAFRRIQNV) (Glaser et al., 2002
). It is worth noting that, at 41 °C, the levels of oxidized DnaK were higher in the mutant than in the wild-type strain, indicating that in the absence of the ClpP protease there is an accumulation of oxidized DnaK (Fig. 6b
). This result cannot be explained by an increased production of DnaK since a Western blot analysis demonstrated that the amount of this protein was very similar in the wild-type and mutant background (Fig. 6c
).
|
clpP mutant strains. By following the mortality after inoculation with increasing doses of bacteria, we found no significant difference between the LD50 of these strains (approx. 6·4x106 bacteria). We then followed, over a period of 4 days, the bacterial survival of these strains in the blood and organs (spleen, liver and brain) of mice infected with a sublethal dose of bacteria (106) (Fig. 7
|
| DISCUSSION |
|---|
|
|
|---|
clpP mutant was significantly lower than that of the wild-type GBS strain suggests that ClpP constitutes an essential heat-induced protease.
During heat shock, an S. agalactiae
clpP mutant was growth-arrested and displayed important modifications to its protein content, which included a decreased level of essential metabolic enzymes such as the alcohol dehydrogenase. Pyruvate can be converted to ethanol via acetaldehyde, a reaction requiring alcohol dehydrogenase and generating NAD+. If NAD+ were not regenerated, glycolysis could not proceed beyond glyceraldehyde 3-phosphate, which means that no ATP would be generated (Lehninger, 1982
; Lodish et al., 2000
). Thus, the absence or availability of decreased levels of metabolic enzymes, such as the alcohol dehydrogenase, may be responsible for the growth arrest of the
clpP mutant observed at 41 °C. As a major effect, heat shock may cause cellular oxidation and many of the heat-shock proteins may function to protect against oxidation (Bochner et al., 1984
). Interestingly, we showed that there is an accumulation of oxidized GBS DnaK in the absence of ClpP. This might indicate that DnaK is a preferred target for oxidation and/or that oxidized DnaK is a preferred substrate for ClpP. Oxidized proteins lose their structural integrity and catalytic activity, and the levels of oxidized proteins increase exponentially with age (Stadtman, 1992
). Mutations inactivating the genes encoding the chaperone proteins GroESL and DnaK are known to have pleiotropic effects on host metabolism, including defects in DNA and RNA synthesis, proteolysis and cell division. E. coli cells lacking DnaK die rapidly during stasis and fail to develop resistance to heat and oxidation (Georgopoulos et al., 1994
). In particular, DnaK is important in the resurrection of the activity of heat-inactivated RNA polymerase (Georgopoulos et al., 1994
). These findings are consistent with our proposal that, at 41 °C, the
clpP GBS mutant synthesizes numerous aberrant and prematurely terminated peptides made from truncated mRNAs probably due to oxidized/inactive DnaK. However, the lack of ClpP, which, together with ClpX and ClpC, has to fulfil general quality control functions and possible regulatory functions, could also be the more-direct cause of these phenotypes. It has recently been shown that the S. pneumoniae
clpP mutant is also sensitive to H2O2 (Robertson et al., 2002
). In addition, micro-array analysis of this mutant showed regulatory phenotypes that included downregulation of the oxidative-stress response. Thus, the phenotypes we observed in the S. agalactiae
clpP mutants were probably due to pleiotropic regulatory effects caused by the lack of ClpP.
The role of chaperone proteins in the cell division cycle is unknown, yet many of the division components are peripheral or integral inner-membrane proteins. Defects in cell division as a result of mutations in the clp genes have also been observed in B. subtilis and L. monocytogenes, suggesting that proteins involved in cell morphology or cell division are controlled either directly or indirectly by the ClpXP protease complexes (Gerth et al., 1998
; Nair et al., 1999
). In C. crescentus, ClpXP is required in vivo for the cell-cycle-dependent degradation of the regulatory protein CtrA (Jenal & Fuchs, 1998
). Common strategies in cell-cycle control exist in prokaryotes and eukaryotes, suggesting that specific proteolysis/degradation events play a key role in the cell cycle. Similarly, we observed that, during heat shock, an S. agalactiae
clpP mutant displayed important morphological alterations, indicating that, just like in eubacteria, the ClpP in GBS could play an essential role in the checkpoint mechanism of cell-cycle control. Under these growth condition, the mutant also showed altered basic cell functions, as exemplified by the absence of the alcohol dehydrogenase and DnaK oxidation, which are likely to be responsible for the dramatic phenotypic modifications observed, including the growth arrest. Since the cytoplasm becomes pro-oxidant during lethal heating, a role for GBS ClpP as an anti-oxidant in the protection of DnaK cannot be excluded.
Finally, our results showed that ClpP does not play a major role in the virulence of S. agalactiae, at least in our murine infection model. The slight difference observed between the kinetics of elimination of the wild-type and mutant strains is likely to reflect the growth defect of the
clpP mutant observed in vitro at 37 °C, i.e. the temperature of the bodies of the mice. Our results apparently conflict with those of Jones et al. (2000)
, who identified, by using signature-tagged mutagenesis, a GBS Clp regulatory subunit as an essential virulence factor. However, it should be noted that, whereas the proteolytic activity sensu stricto resides in the ClpP subunit, the regulatory subunits also act as molecular chaperones involved in the folding and assembly of proteins (Schirmer et al., 1996
). The Clp chaperonin activity might thus be more important than its proteolytic activity for the proper development of the GBS infectious process. Thus, we have concluded that, as opposed to the Gram-positive intracellular pathogen L. monocytogenes (Gaillot et al., 2000
), ClpP is not critical for the virulence of the extracellular pathogen S. agalactiae. This difference might reflect the difference in the lifestyles (extracellular versus intracellular) of these two pathogens.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bochner, B. R., Lee, P. C., Wilson, S. W., Cutler, C. W. & Ames, B. N. (1984). AppppA and related adenylated nucleotides are synthesized as a consequence of oxidation stress. Cell 37, 225232.[CrossRef][Medline]
Boyer, H. W. & Roulland-Dussoix, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41, 459472.[CrossRef][Medline]
Celli, J. & Trieu-Cuot, P. (1998). Circularization of Tn916 is required for expression of the transposon-encoded transfer functions: characterization of long tetracycline-inducible transcripts reading through the attachment site. Mol Microbiol 28, 103118.[CrossRef][Medline]
Chastanet, A., Prudhomme, M., Claverys, J. P. & Msadek, T. (2001). Regulation of Streptococcus pneumoniae clp genes and their role in competence development and stress survival. J Bacteriol 183, 72957307.
Cruz-Rodz, A. & Gilmore, M. S. (1990). High efficiency introduction of plasmid DNA into glycine treated Enterococcus faecalis by electroporation. Mol Gen Genet 224, 152154.[CrossRef][Medline]
Davidson, J. F., Whyte, B., Bissinger, P. H. & Schiestl, R. H. (1996). Oxidative stress is involved in heat-induced cell death in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 93, 51165121.
Derre, I., Rapoport, G. & Msadek, T. (1999). CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Mol Microbiol 31, 117131.[CrossRef][Medline]
Dukan, S. & Nystrom, T. (1998). Bacterial senescence: stasis results in increased and differential oxidation of cytoplasmic proteins leading to developmental induction of the heat shock regulon. Genes Dev 12, 34313441.
Dukan, S. & Nystrom, T. (1999). Oxidative stress defense and deterioration of growth-arrested Escherichia coli cells. J Biol Chem 274, 2602726032.
Frehel, C. & Leduc, M. (1987). Cytochemical localization of lipopolysaccharides during peptidoglycan degradation of Escherichia coli cells. J Bacteriol 169, 210217.
Gaillot, O., Poyart, C., Berche, P. & Trieu-Cuot, P. (1997). Molecular characterization and expression analysis of the superoxide dismutase gene from Streptococcus agalactiae. Gene 204, 213218.[CrossRef][Medline]
Gaillot, O., Pellegrini, E., Bregenholt, S., Nair, S. & Berche, P. (2000). The ClpP serine protease is essential for the intracellular parasitism and virulence of Listeria monocytogenes. Mol Microbiol 35, 12861294.[CrossRef][Medline]
Gaillot, O., Bregenholt, S., Jaubert, F., Di Santo, J. P. & Berche, P. (2001). Stress-induced ClpP serine protease of Listeria monocytogenes is essential for induction of listeriolysin O-dependent protective immunity. Infect Immun 69, 49384943.
Georgopoulos, C., Liberek, K., Zylicz, M. & Ang, D. (1994). Properties of the heat shock proteins of Escherichia coli and the autoregulation of the heat shock response. In The Biology of Heat Shock Proteins and Molecular Chaperones, pp. 209249. Edited by R. I. Morimoto, A. Tissières & C. Georgopoulos. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Gerth, U., Kruger, E., Derre, I., Msadek, T. & Hecker, M. (1998). Stress induction of the Bacillus subtilis clpP gene encoding a homologue of the proteolytic component of the Clp protease and the involvement of ClpP and ClpX in stress tolerance. Mol Microbiol 28, 787802.[CrossRef][Medline]
Glaser, P., Rusniok, C., Buchrieser, C. & 9 other authors (2002). Genome sequence of Streptococcus agalactiae, a pathogen causing invasive neonatal disease. Mol Microbiol 45, 14991513.[CrossRef][Medline]
Gottesman, S. (1996). Proteases and their targets in Escherichia coli. Annu Rev Genet 30, 465506.[CrossRef][Medline]
Gottesman, S., Roche, E., Zhou, Y. & Sauer, R. T. (1998). The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. Genes Dev 12, 13381347.
Jenal, U. & Fuchs, T. (1998). An essential protease involved in bacterial cell-cycle control. EMBO J 17, 56585669.[CrossRef][Medline]
Jones, A. L., Knoll, K. M. & Rubens, C. E. (2000). Identification of Streptococcus agalactiae virulence genes in the neonatal rat sepsis model using signature-tagged mutagenesis. Mol Microbiol 37, 14441455.[CrossRef][Medline]
Kim, S. W., Choi, I. H., Kim, S. N., Kim, Y. H., Pyo, S. N. & Rhee, D. K. (1998). Molecular cloning, expression, and characterization of dnaK in Streptococcus pneumoniae. FEMS Microbiol Lett 161, 217224.[CrossRef][Medline]
Lehninger, A. L. (1982). Principles of Biochemistry. New York: Worth.
Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D. & Darnell, J. E. (2000). Molecular Cell Biology, 4th edn. New York: W. H. Freeman.
Maurizi, M. R., Clark, W. P., Kim, S. H. & Gottesman, S. (1990). ClpP represents a unique family of serine proteases. J Biol Chem 265, 1254612552.
Morimoto, R. I. (1998). Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes Dev 12, 37883796.
Morimoto, R. I., Tissieres, I. & Georgopoulos, C. (1994). Progress and perspectives on the biology of heat shock proteins and molecular chaperones. In The Biology of Heat Shock Proteins and Molecular Chaperones, pp. 130. Edited by R. I. Morimoto, I. Tissieres & C. Georgopoulos. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Nair, S., Frehel, C., Nguyen, L., Escuyer, V. & Berche, P. (1999). ClpE, a novel member of the HSP100 family, is involved in cell division and virulence of Listeria monocytogenes. Mol Microbiol 31, 185196.[CrossRef][Medline]
Nair, S., Milohanic, E. & Berche, P. (2000a). ClpC ATPase is required for cell adhesion and invasion of Listeria monocytogenes. Infect Immun 68, 70617068.
Nair, S., Derre, I., Msadek, T., Gaillot, O. & Berche, P. (2000b). CtsR controls class III heat shock gene expression in the human pathogen Listeria monocytogenes. Mol Microbiol 35, 800811.[CrossRef][Medline]
Newton, A. (1972). Role of transcription in the temporary control of development in Caulobacter crescentus. Proc Natl Acad Sci U S A 69, 447451.
Poyart, C. & Trieu-Cuot, P. (1997). A broad-host-range mobilizable shuttle vector for the construction of transcriptional fusions to
-galactosidase in Gram-positive bacteria. FEMS Microbiol Lett 156, 193198.[Medline]
Poyart, C., Lamy, M.-C., Boumaila, C., Fiedler, F. & Trieu-Cuot, P. (2001a). Regulation of D-alanyl-lipoteichoic acid biosynthesis in Streptococcus agalactiae involves a novel two-component regulatory system. J Bacteriol 183, 63246334.
Poyart, C., Pellegrini, E., Gaillot, O., Boumaila, C., Baptista, M. & Trieu-Cuot, P. (2001b). Contribution of Mn-cofactored superoxide dismutase (SodA) to the virulence of Streptococcus agalactiae. Infect Immun 69, 50985106.
Poyart-Salmeron, C., Trieu-Cuot, P., Carlier, C., MacGowan, A., McLauchlin, J. & Courvalin, P. (1992). Genetic basis of tetracycline resistance in clinical isolates of Listeria monocytogenes. Antimicrob Agents Chemother 36, 463466.
Robertson, G. T., Ng, W. L., Foley, J., Gilmour, R. & Winkler, M. E. (2002). Global transcriptional analysis of clpP mutations of type 2 Streptococcus pneumoniae and their effects on physiology and virulence. J Bacteriol 184, 35083520.
Rouquette, C., de Chastellier, C., Nair, S. & Berche, P. (1998). The ClpC ATPase of Listeria monocytogenes is a general stress protein required for virulence and promoting early bacterial escape from the phagosome of macrophages. Mol Microbiol 27, 12351245.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schirmer, E. C., Glover, J. R., Singer, M. A. & Lindquist, S. (1996). HSP100/Clp proteins: a common mechanism explains diverse functions. Trends Biochem Sci 21, 289296.[CrossRef][Medline]
Schuchat, A. (1998). Epidemiology of group B streptococcal disease in the United States: shifting paradigms. Clinical Microbiol Rev 11, 497513.
Squires, C. & Squires, C. L. (1992). The Clp proteins: proteolysis regulators or molecular chaperones? J Bacteriol 174, 10811085.
Stadtman, E. R. (1992). Protein oxidation and aging. Science 257, 12201224.
Tamarit, J., Cabiscol, E. & Ros, J. (1998). Identification of the major oxidatively damaged proteins in Escherichia coli cells exposed to oxidative stress. J Biol Chem 273, 30273032.
Tamura, G. S., Kuypers, J. M., Smith, S., Raff, H. & Rubens, C. E. (1994). Adherence of group B streptococci to cultured epithelial cells: roles of environmental factors and bacterial surface components. Infect Immun 62, 24502458.
Thomas, C. & Smith, C. (1987). Incompatibility group P plasmids: genetics, evolution, and use in genetic manipulation. Annu Rev Microbiol 41, 77101.[CrossRef][Medline]
Wang, J., Hartling, J. A. & Flanagan, J. M. (1997). The structure of ClpP at 2·3 Å resolution suggests a model for ATP-dependent proteolysis. Cell 91, 447456.[CrossRef][Medline]
Winzeler, E. & Shapiro, L. (1995). Use of flow cytometry to identify a Caulobacter 4·5S RNA temperature-sensitive mutant defective in the cell cycle. J Mol Biol 251, 346365.[CrossRef][Medline]
Woo, K. M., Chung, W. J., Ha, D. B., Goldberg, A. L. & Chung, C. H. (1989). Protease Ti from Escherichia coli requires ATP hydrolysis for protean breakdown but not for hydrolysis of small peptides. J Biol Chem 264, 20882091.
Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103119.[CrossRef][Medline]
Zhou, Y., Gottesman, S., Hoskins, J. R., Maurizi, M. R. & Wickner, S. (2001). The RssB response regulator directly targets
S for degradation by ClpXP. Genes Dev 15, 627637.
Received 3 June 2002;
revised 8 October 2002;
accepted 8 October 2002.
This article has been cited by other articles:
![]() |
J. Zhang, A. Banerjee, and I. Biswas Transcription of clpP Is Enhanced by a Unique Tandem Repeat Sequence in Streptococcus mutans J. Bacteriol., February 1, 2009; 191(3): 1056 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fredriksson, M. Ballesteros, C. N. Peterson, O. Persson, T. J. Silhavy, and T. Nystrom Decline in ribosomal fidelity contributes to the accumulation and stabilization of the master stress response regulator {sigma}S upon carbon starvation Genes & Dev., April 1, 2007; 21(7): 862 - 874. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |