Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 149 (2003), 1227-1238; DOI  10.1099/mic.0.26204-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorsey, C. W.
Right arrow Articles by Actis, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorsey, C. W.
Right arrow Articles by Actis, L. A.
Agricola
Right arrow Articles by Dorsey, C. W.
Right arrow Articles by Actis, L. A.
Microbiology 149 (2003), 1227-1238; DOI  10.1099/mic.0.26204-0
© 2003 Society for General Microbiology

Genetic organization of an Acinetobacter baumannii chromosomal region harbouring genes related to siderophore biosynthesis and transport

Caleb W. Dorsey1, Marcelo E. Tolmasky2, Jorge H. Crosa3 and Luis A. Actis1

1 Department of Microbiology, Miami University, Oxford, OH 45056, USA
2 Department of Biological Science, School of Natural Science and Mathematics, California State University, Fullerton, CA, USA
3 Department of Molecular Microbiology and Immunology, Oregon Health and Science University, Portland, OR, USA

Correspondence
Luis A. Actis
actisla{at}muohio.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Acinetobacter baumannii 8399 clinical isolate secretes dihydroxybenzoic acid (DHBA) and a high-affinity catechol siderophore, which is different from other bacterial iron chelators already characterized. Complementation assays with enterobactin-deficient Escherichia coli strains led to the isolation of a cosmid clone containing A. baumannii 8399 genes required for the biosynthesis and activation of DHBA. Accordingly, the cloned fragment harbours a dhbACEB polycistronic operon encoding predicted proteins highly similar to several bacterial proteins required for DHBA biosynthesis from chorismic acid. Genes encoding deduced proteins related to the E. coli Fes and the Bacillus subtilis DhbF proteins, and a putative Yersinia pestis phosphopantetheinyl transferase, all of them involved in the assembly and utilization of catechol siderophores in other bacteria, were found next to the dhbACEB locus. This A. baumannii 8399 gene cluster also contained the om73, p45 and p114 predicted genes encoding proteins potentially involved in transport of ferric siderophore complexes. The deduced products of the p114 and p45 genes are putative membrane proteins that belong to the RND and MFS efflux pump proteins, respectively. Interestingly, P45 is highly related to the E. coli P43 (EntS) protein that participates in the secretion of enterobactin. Although P114 is similar to other bacterial efflux pump proteins involved in antibiotic resistance, its genetic arrangement within this A. baumannii 8399 locus is different from that described in other bacteria. The product of om73 is a Fur- and iron-regulated surface-exposed outer-membrane protein. These characteristics together with the presence of a predicted TonB box and its high similarity to other siderophore receptors indicate that OM73 plays such a role in A. baumannii 8399. The 184 nt om73p114 intergenic region contains promoter elements that could drive the expression of these divergently transcribed genes, all of which are in close proximity to almost perfect Fur boxes. This arrangement explains the iron- and Fur-regulated expression of om73, and provides strong evidence for a similar regulation for the expression of p114.


Abbreviations: CAS, chrome azurol S; DHBA, dihydroxybenzoic acid; EDDHA, ethylenediamine-di-(o-hydroxyphenyl)acetic acid

The GenBank accession number for the sequence of the DNA fragment containing the A. baumannii 8399 ent locus is AY149472.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacteria survive and multiply under iron-limiting conditions, such as those found in natural and medical environments, by expressing active systems that gather this micronutrient, which is essential for most micro-organisms with some exceptions such as lactobacilli. Some systems involve the secretion of low-molecular-mass ferric-binding compounds called siderophores, which can be classified into different categories based on their chemical structure (Neilands, 1981Down, 1995Down). Many of these high-affinity iron-chelating molecules contain catecholate groups that are part of the iron-binding site. Enterobactin, the prototype catechol siderophore produced by Escherichia coli, is a cyclic trimer of 2,3-dihydroxybenzoyl-L-serine (O'Brien & Gibson, 1970Down; Walsh et al., 1990Down). In contrast, siderophores such as vibriobactin and anguibactin, produced by Vibrio cholerae (Griffiths et al., 1984Down) and Vibrio anguillarum (Actis et al., 1986Down; Jalal et al., 1989Down), respectively, are non-cyclic derivatives of 2,3-dihydroxybenzoic acid (DHBA). In vibriobactin, the DHBA moiety is linked to L-threonine and norspermidine, while in anguibactin DHBA is linked to L-cysteine and hydroxyhistamine.

In E. coli, the conversion of chorismate, which is an aromatic amino acid intermediate, into DHBA requires the consecutive action of isochorismate synthase (EntC), isochorismatase (EntB) and 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EntA) (Earhart, 1996Down; Walsh et al., 1990Down). The ent gene cluster encoding these functions also includes entE, which encodes the 2,3-dihydroxybenzoate-AMP ligase activity required for DHBA activation. The entCEBA gene cluster, which is located next to genes encoding enterobactin transport and utilization functions, is a polycistronic operon transcribed from a promoter region that includes Fur repressor-binding sequences (Earhart, 1996Down). The DHBA genes are present and expressed in other enterobactin-producing bacteria such as Salmonella spp. (Pollack & Neilands, 1970Down), Shigella spp. (Payne et al., 1983Down) and Aeromonas spp. (Massad et al., 1994Down). The plant pathogen Erwinia chrysanthemi, which secretes the siderophore chrysobactin (Persmark et al., 1989Down), has DHBA genes that are arranged in the same order as in E. coli (Franza & Expert, 1991Down; Franza et al., 1991Down). V. cholerae, which produces vibriobactin in response to iron limitation, also contains a cluster harbouring the DHBA biosynthetic genes. However, these genes are organized as an entACEB cluster in which entC and entE are co-transcribed while entA and entB belong to two independent transcriptional units (Wyckoff et al., 1997Down).

Acinetobacter baumannii is being increasingly recognized as an important pathogen that causes severe infections in hospitalized patients (Bergogne-Berenzin & Towner, 1996Down) as well as deadly cases of community-acquired pneumonia (Anstey et al., 1991Down). We have characterized a high-affinity iron-uptake system expressed by A. baumannii 8399, which was isolated during a nosocomial outbreak of lower-tract respiratory infections (Echenique et al., 1992Down). This iron-acquisition system includes a catechol siderophore capable of scavenging iron from the high-affinity iron-binding proteins present in the human host. Furthermore, examination of several clinical isolates revealed that all A. baumannii tested produced iron-regulated catechol compounds, while no hydroxamate compounds were detected in the culture supernatants of these strains (Actis et al., 1993Down). As a first step towards the elucidation of the biosynthetic pathway of the uncharacterized catechol siderophore secreted by the A. baumannii 8399 clinical isolate, we report in this work the cloning and characterization of genes involved in the early steps of the biosynthesis of catechol siderophores and bacterial iron utilization. This work also describes the identification and characterization of genes that code for putative siderophore transport proteins, which flank the siderophore biosynthesis and iron utilization genes found in this gene cluster.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial strains, plasmids, and culture conditions.
Bacterial strains and plasmids used in this work are shown in Table 1Down. Strains were routinely cultured in L broth or L agar (Sambrook et al., 1989Down) at 37 °C in the presence of the appropriate antibiotics. Iron-limiting and iron-rich conditions were achieved by the addition of ethylenediamine-di-(o-hydroxyphenyl)acetic acid (EDDHA) and FeCl3, respectively, to liquid or solid media.


View this table:
[in this window]
[in a new window]
 
Table 1. Bacterial strains and plasmids used in this work

 
Production and utilization of siderophore and iron-containing compounds.
Bacterial cells were cultured in M9 minimal medium (Miller, 1972Down) supplemented with either 100 µM EDDHA or 100 µM FeCl3. Production of extracellular compounds with siderophore activity was investigated with the Chrome Azurol S (CAS) reagent (Schwyn & Neilands, 1987Down). The presence of phenolic compounds was detected with the Arnow test (Arnow, 1937Down). DHBA (Sigma) and enterobactin (kindly provided by J. Neilands) were used as standards in the chemical and biological assays. The presence of DHBA and enterobactin was examined by using the Salmonella typhimurium enb-1 and enb-7 mutants, as previously described (Echenique et al., 1992Down). Minimal inhibitory concentrations (MICs) of EDDHA were determined in L broth or M9 minimal medium containing increasing concentrations of EDDHA; determinations were repeated at least three times. OD600 was used to monitor cell growth after overnight incubation at 37 °C in an orbital shaker. The siderophores anguibactin, enterobactin, and that produced by the 8399 strain were isolated from iron-deficient culture supernatants of V. anguillarum 775 (Actis et al., 1986Down), E. coli HB101 (Rogers, 1973Down) and A. baumannii 8399 (Echenique et al., 1992Down), respectively.

Recombinant DNA techniques.
Restriction endonucleases and DNA modification enzymes were purchased from New England Biolabs and used according to the manufacturer's specifications. Plasmid DNA was isolated by alkaline lysis (Birnboim & Doly, 1979Down) and further purified by ultracentrifugation in CsCl/ethidium bromide density gradients (Sambrook et al., 1989Down). The physical maps of recombinant clones and insertional derivatives were obtained by restriction endonuclease digestion and agarose gel electrophoresis (Sambrook et al., 1989Down). Specific restriction fragments were detected by Southern blot DNA hybridization (Sambrook et al., 1989Down). DNA restriction fragments or amplicons used to prepare radiolabelled probes were isolated from agarose gels using the GeneClean II kit (Q.Biogene). DNA probes were radiolabelled with [{alpha}-32P]dCTP using the oligolabelling method (Feinberg & Vogelstein, 1983Down). Other recombinant DNA methods were performed according to standard protocols (Sambrook et al., 1989Down). Nucleotide sequences were determined by automated DNA sequencing (Applied Biosystems) with template plasmid DNA purified with a commercial kit (Qiagen). The nucleotide sequence of the pMU73 insert was determined in both strands, using pUC18 clones containing each HindIII fragment as templates. The order of the HindIII fragments was confirmed by sequencing across each restriction site using the recombinant cosmid pMU73 and the subclones pMU76 and pMU84 as templates (see Fig. 1Down). Sequences were examined and assembled with Sequencher 4.1.2 (Gene Codes Corp.). Nucleotide and amino acid sequences were analysed with DNASTAR, GCG, BLAST (http://www.ncbi.nlm.nih.gov), and the software available through the ExPASy Molecular Biology Server (http://www.expasy.ch).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. Genetic and physical map of the A. baumannii 8399 DNA fragments cloned in different vectors. The arrows indicate the location and direction of transcription of the ORFs identified by the computer analysis of nucleotide sequence of the complete cloned region. The locations of the HindIII and NcoI restriction sites are indicated by the vertical lines labelled H and N, respectively. The curved arrow in pMU85.1 indicates the insertion site of Tn3-HoHo1 within dhbA.

 
Construction of a gene library and cloning of iron-acquisition genes.
Total genomic DNA from A. baumannii 8399, isolated as described previously (Meade et al., 1982Down), was partially digested with HindIII and ligated into the HindIII site of the cosmid vector pVK100. Cosmid clones were packaged in vitro and transduced into E. coli LE392 or an ent mutant derivative of E. coli following the conditions suggested by the supplier (Amersham). Purified cosmid or plasmid DNA was introduced into E. coli cells either by chemical transformation (Boyer & Roulland-Doussoix, 1969Down) or by electroporation. Electrocompetent cells were prepared as described in the Bio-Rad electroporation manual and electroporation was conducted using the 2510 Eppendorf electroporator and 2-mm-wide cuvettes. After electroporation at 2·5 kV, the cells were suspended in 1 ml SOC (Sambrook et al., 1989Down), allowed to recover for 1 h at 37 °C with shaking, and then plated on L agar containing the appropriate antibiotics.

Cloning and overexpression of om73.
The entire om73 ORF was PCR amplified from pMU76 (see Fig. 1Up) with Pfu DNA polymerase (Stratagene) and the primers 5'-GATAACAATTATCATATGGTAATCG-3' and 5'-CGCGGATCCGCTTAGAAACTATAAGTCGC-3', which included NdeI and BamHI restriction sites, respectively. The PCR conditions were as suggested by the manufacturer of Pfu. The amplicon and the vector pET14b were digested with these two restriction enzymes, ligated, and transformed into E. coli BL21(DE3)(pLysE). The recombinant construct was confirmed by nucleotide sequencing using the T7 primer and plasmid DNA isolated from an ampicillin- and chloramphenicol-resistant colony. Induction of protein expression and electrophoretic analysis was done as described previously (Tolmasky et al., 1994Down). The His-tagged OM73 derivative was purified using the B-Per 6xHis Fusion Protein Purification kit from Pierce Biotechnology, with some modifications. Briefly, cells (250 ml induced culture) were lysed with the B-Per lysis solution provided with the kit, and the inclusion bodies were isolated and washed according to the manufacturer's instructions. The pellet was dissolved in 2 ml buffer B (8 M urea, 0·1 M NaH2PO4, 0·01 M Tris/HCl, pH 8·0), which was also used to equilibrate the Ni columns. After the protein solution was loaded, the column was washed twice successively with 4 ml buffer B and buffer C (same as buffer B but pH adjusted to 6·3). The bound protein was eluted with buffer E (same as buffer B but pH adjusted to 4·5). Fractions were collected and analysed by SDS-PAGE as described previously (Actis et al., 1985Down).

Isolation and electrophoretic analysis of whole-cell lysates and membrane proteins.
Bacterial cells used to prepare whole-cell lysates were collected by centrifugation, after overnight culture in L broth or M9 minimal medium under iron-limiting and iron-rich conditions, and washed once with Tris-buffered saline solution (10 mM Tris/HCl, 0·15 M NaCl, pH 7·5). The cells were resuspended in the same buffer to an OD600 value of 15 and then lysed by adding 1 vol. 2x SDS-PAGE sample buffer (Actis et al., 1985Down) and heating the samples at 100 °C for 10 min. Total and outer membranes were isolated from cells cultured as described above by high-speed centrifugation and selective solubilization as previously reported (Actis et al., 1985Down).

Immunoblot analysis.
Whole-cell lysates and membrane fractions were size-fractionated by SDS-PAGE using 12·5 % polyacrylamide gels. The production of OM73 was examined by Western blot analysis as described before (Smoot et al., 1998Down). The polyclonal antiserum against OM73 was raised in rabbits as reported before (Actis et al., 1985Down); the animals were injected three times with 100 µg purified protein and a final boost dose of 200 µg. Specific antibodies were immunopurified with nitrocellulose strips containing the OM73 protein band (Olmsted, 1981Down). The presence of Fur in cell lysates was tested with anti-Fur serum as described before (Tolmasky et al., 1994Down). The immunocomplexes were detected by chemiluminescence using protein A labelled with horseradish peroxidase.

Biotin labelling of cell-surface proteins.
Outer-membrane proteins exposed to the extracellular environment were biotinylated with the EZ-Link Sulfo-NHS-Biotinylation kit from Pierce. Briefly, bacterial cells grown in M9 minimal medium containing 100 µM EDDHA were washed three times with phosphate-buffered saline solution (PBS) and suspended to a concentration of approximately 20x106 cells ml-1. Then, 0·3 mg Sulfo-NHS-LC-Biotin was added to 1 ml cells and the mixture was incubated at room temperature for 30 min. The cells were washed with PBS and total and outer membranes were isolated as described above. Biotinylated proteins were detected by chemiluminescence with horseradish-peroxidase-labelled avidin (Pierce) and H2O2. The reacting protein bands were detected by exposing the blots to X-ray film.

Transcriptional analysis of gene expression.
Expression of polycistronic genes was tested by RT-PCR analysis using total RNA isolated from bacteria grown under iron limitation as described before (Graber et al., 1998Down). The RNA samples were treated with RNase-free DNase I (Roche) and used with a commercial RT-PCR kit (Qiagen), under the conditions suggested by the manufacturer. The amplicons were analysed by agarose gel electrophoresis (Sambrook et al., 1989Down). PCR of total RNA without reverse transcription was used to test DNA contamination of RNA samples. The nature of the amplicons was confirmed by automated DNA sequencing.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of siderophore biosynthetic genes
Transduction of the cosmid library constructed from A. baumannii 8399 into the E. coli entE mutant strain AN93 resulted in the isolation of colonies capable of growing in the presence of 100 µM EDDHA. Restriction analysis of a pVK100 derivative isolated from one of these colonies, which was named pMU73, showed that it contained a 20–22 kb insert encompassing at least 12 HindIII fragments. Purified pMU73 DNA was able to restore, upon transformation, the ability of E. coli AN93 to grow in L broth containing 25–400 µM EDDHA to levels similar to those observed with AN93 cells harbouring pCP410. The latter is a pACYC184 derivative that contains the E. coli entE gene (Pickett et al., 1984Down). In contrast, the growth of AN93 cells harbouring either the pVK100 or pACYC184 cloning vectors was significantly reduced by the addition of 50 µM EDDHA and impaired further by the addition of increasing concentrations of EDDHA.

The acid ethyl acetate extracts of M9 minimal medium culture supernatants of E. coli AN93 cells harbouring either pVK100 or pMU73 were positive with the Arnow test. However, only the extract obtained from the culture supernatant of AN93 cells harbouring pMU73 was positive with the CAS reagent. Siderophore utilization bioassays showed that addition of the ethyl acetate extract obtained from AN93 carrying pVK100 could stimulate only the growth of the enb-7 mutant of S. typhimurium, a derivative that uses either DHBA or enterobactin to grow under iron-deficient conditions. In contrast, the organic extract obtained from AN93 harbouring pMU73 enhanced the growth of the S. typhimurium enb-7 mutant as well as that of enb-1, which uses only enterobactin to grow under iron deficiency. These results demonstrate that the biosynthesis of enterobactin in E. coli DHBA biosynthetic mutants is restored only when the cells harbour the pMU73 cosmid clone. In addition, transformation of pMU73 into the E. coli ent mutant, which carries a large chromosomal deletion that encompasses most of the enterobactin-coding region (de Lorenzo et al., 1986Down; J. Neilands, personal communication), restored the production of DHBA.

Table 2Down shows that the presence of pMU73 in AN193 (entA), AN192 (entB), AN90 (entD) and AB1515.43 (entG) restored ability of these enterobactin mutants to grow under iron limitation, while transformation with pVK100 did not change their iron-uptake-deficient phenotype. Further subcloning and complementation assays using derivatives obtained by ligating the HindIII fragments of pMU73 into pBCSK+ yielded pMU74, a clone that complemented only the entA mutation in AN193. Restriction analysis of this clone showed that it contained a 3·5 kb HindIII fragment, which is the largest A. baumannii 8399 restriction fragment cloned in pMU73.


View this table:
[in this window]
[in a new window]
 
Table 2. Complementation of E. coli ent mutants by plasmids pVK100 and pMU73

Cells were incubated in L broth containing increasing concentrations of EDDHA. Bacterial growth was determined after overnight incubation at 37 °C in a rotary shaker. Cultures with OD600 <=0·4 at EDDHA concentrations >=25 µM were considered negative (-) complementations, while cultures with OD600 >=1 at the same wavelength at >=25 µM EDDHA were considered positive (+) complementations of the iron-utilization phenotype of the E. coli mutants used in the bioassays. NA, Not applicable.

 
Nucleotide analysis of siderophore biosynthetic and utilization genes
Computer analysis showed that the 21 931 bp fragment cloned in pMU73 contains 10 complete ORFs (Fig. 1Up). ORFs 3 to 6 encode predicted proteins with the highest similarity to the Bacillus subtilis DhbB, DhbE, DhbC and DhbA proteins, respectively (Table 3Down). Table 3Down also shows that these predicted proteins are significantly similar to the E. coli Ent proteins required for enterobactin biosynthesis (Earhart, 1996Down), an observation that validates the complementation approach used in this work to clone these A. baumannii 8399 genes, which are referred as to the dhb genes. The polycistronic nature of this locus was confirmed by RT-PCR analysis, which yielded the cognate amplicons matching their predicted size (Fig. 2Down, lanes 2–4) and nucleotide sequence that were obtained with pMU73. These amplicons were not detected when total RNA was used as a template for PCR.


View this table:
[in this window]
[in a new window]
 
Table 3. Sequence analysis of the ORFs located within the insert of the pMU73 cosmid clone

 


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2. Agarose gel electrophoresis of the amplicons obtained by RT-PCR of total RNA extracted from A. baumannii 8399 cells cultured under iron-deficient conditions. The primers used were designed to detect the expression of ORF 2 (lane 1), ORF 3–ORF 4 (lane 2), ORF 4–ORF 5 (lane 3), ORF 5–ORF 6 (lane 4), ORF 7 (lane 5), ORF 8–ORF 9 (lane 6), and ORF 10 (lane 7). Lane 8, HindIII-digested {lambda} DNA.

 
Introduction of pMU85 (Table 1Up, Fig. 1Up) into AN193 restored the iron-uptake phenotype of this E. coli entA strain (Table 2Up) and the production of enterobactin as detected with the Arnow and CAS reactions and the siderophore utilization bioassays with the S. typhimurium enb-1 and enb-7 mutants. The insertion of Tn3-HoHo1 within dhbA (pMU85.1, see Fig. 1Up) abolished the complementing activity of pMU85 (Table 2Up), which confirms the role of this A. baumannii gene in this heterologous system. The dhbA gene encodes a predicted protein with the highest similarity (Table 3Up) to the B. subtilis DhbA (Rowland et al., 1996Down), which displays the signature pattern for proteins belonging to the short-chain dehydrogenase/reductase family. ORF 5 encodes a predicted protein highly related to EntC-like proteins, displaying the highest similarity to DhbC from B. subtilis (Rowland et al., 1996Down) (Table 3Up). Next is ORF 4 (Fig. 1Up), which encodes a protein highly similar to several bacterial proteins involved in the activation of DHBA, particularly to DhbE from B. subtilis (Rowland et al., 1996Down) (Table 3Up). The restoration of the iron-uptake proficiency and enterobactin production by the presence of pMU73 in the E. coli AN93 entE mutant supports the role of this A. baumannii 8399 siderophore biosynthetic gene. ORF 3, the last component of the A. baumannii 8399 dhbACEB polycistronic locus, encodes a protein related to several EntB-like bacterial proteins, with the highest similarity (Table 3Up) to the DhbB from B. subtilis (Rowland et al., 1996Down). The amino end of this predicted protein contains the domain found in other isochorismatases, while its carboxyl end includes an acyl carrier protein phosphopantetheinyl (ACP) domain. The restoration of enterobactin biosynthesis and iron uptake competency in the E. coli AN192 (entB) and AB1515.43 (entG) mutants harbouring pMU73 (Table 2Up) indicates that the A. baumannii 8399 dhbB gene encodes a bifunctional protein that is required for DHBA biosynthesis and siderophore assembly (Gehring et al., 1997Down).

ORF 8 encodes a protein highly similar (Table 3Up) to DhbF from B. subtilis (Rowland et al., 1996Down), which is highly related to the E. coli EntF protein that participates in the final stages of enterobactin biosynthesis (Rusnak et al., 1991Down). RT-PCR experiments proved that this gene is part of a bicistronic message (Fig. 2Up, lane 6) that includes ORF 9, whose translational product is related to an E. coli efflux pump protein involved in siderophore secretion (Table 3Up). ORF 10 encodes a protein significantly similar to a Yersinia pestis putative phosphopantetheinyl transferase (Parkhill et al., 2001Down), when TTG is considered as an alternative initiation codon (Table 3Up). These A. baumannii and Y. pestis proteins belong to a large family of bacterial proteins related to the EntD enterobactin biosynthetic protein (Armstrong et al., 1989Down; Coderre & Earhart, 1989Down). The ability of the cosmid pMU73 to restore the iron-acquisition phenotype of the E. coli AN90 (entD) (Table 2Up) confirms the siderophore biosynthetic role of this A. baumannii 8399 gene, which is actively transcribed in the natural host cells (Fig. 2Up, lane 7). The predicted translation product of ORF 7, which is also actively transcribed in A. baumannii 8399 cells (Fig. 2Up, lane 5), is a protein significantly similar to Fes (Table 3Up), the E. coli esterase required for the degradation of enterobactin and subsequent release of iron into the bacterial cytoplasm (Brickman & McIntosh, 1992Down).

Nucleotide analysis of a siderophore-receptor gene and cellular localization of its translation product
The first pMU73 ORF encodes a predicted 73·7 kDa outer-membrane protein, referred to as OM73, that is highly related to bacterial iron-regulated siderophore receptors, displaying the highest similarity with the E. coli CirA iron-regulated colicin receptor protein (Nau & Konisky, 1989Down) (Table 3Up). Furthermore, OM73 contains a TonB box found in other siderophore receptors, which is involved in the interaction with the TonB energy-transducing protein required for the transport of ferric siderophores (Crosa, 1989Down). The production and cellular location of OM73 were tested using a specific polyclonal antiserum, which was obtained with His-tagged OM73 that was overexpressed in E. coli BL21 and purified by Ni-affinity column chromatography, and different cellular fractions isolated from cells cultured under iron-rich and iron-deficient conditions. Fig. 3Down shows that OM73 is present in the total membrane and outer-membrane fractions of A. baumannii 8399 cells cultured in the presence of the iron chelator EDDHA (lanes 2 and 4), while no signal was detected in the cognate samples prepared from cells incubated under iron-rich conditions (lanes 1 and 3). While similar results were obtained using whole-cell lysates, no signal could be detected in the inner-membrane and cytoplasmic fractions obtained from cells cultured under iron-rich and iron-deficient conditions (data not shown). The surface exposure of OM73 was tested using sulfo-NHS-biotin, a water-soluble N-hydroxysuccinimide ester of biotin that is membrane impermeable and has been extensively used, in conjunction with enzyme-labelled avidin, to examine cell-surface proteins (Wilchek & Bayer, 1988Down). Electrophoretic analysis showed that several proteins located in the total and outer-membrane fractions obtained from cells incubated under iron limitation were labelled after incubation of whole cells with sulfo-NHS-biotin (Fig. 3Down, lanes 5 and 6). A 73 kDa protein that co-migrates with the single iron-regulated protein detected with the anti-OM73 serum could be detected among the proteins labelled with sulfo-NHS-biotin (compare lanes 2, 4, 5 and 6 of Fig. 3Down). Taken together, these results indicate that the iron-regulated OM73 protein is located in the outer membrane of A. baumannii 8399 and appears to be a surface-exposed membrane protein that could function as a siderophore receptor.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 3. Analysis of native and biotin-labelled membrane proteins. Total membrane proteins (lanes 1, 2 and 5) and outer-membrane proteins (lanes 3, 4 and 6) from A. baumannii 8399 cells cultured under iron-rich (lanes 1 and 3) and iron-limiting (lanes 2, 4, 5 and 6) conditions were size-fractionated by SDS-PAGE. Protein samples from native cells (lanes 1–4) were probed with anti-OM73 and the immunocomplexes were detected with protein A labelled with horseradish peroxidase. The biotin-labelled proteins (lanes 5 and 6) were detected with avidin labelled with horseradish peroxidase. The arrows identify the biotin-labelled protein that co-migrates with OM73.

 
Analysis of the regulation of the expression of om73
Inspection of the 184 nt intergenic region which separates ORFs 1 and 2 revealed the presence of a Fur box in the (+) and (-) strand (Fig. 4Down) that matches 17 of the 19 nucleotides of the GATAATGATAATCATTATC consensus sequence (Calderwood & Mekalanos, 1988Down). Several sequences resembling the consensus -10 promoter region were also located within this region. These in silico findings are in agreement with the observed iron-regulated expression of OM73 in A. baumannii 8399 cells (Fig. 3Up, lanes 1–4). The recombinant plasmid pMU76 (Fig. 1Up, Table 1Up) was used to test the role of the Fur iron-repressor protein in this regulatory process. Similar levels of OM73 were detected in E. coli BN4020 Fur mutant cells harbouring pMU76 and the pACYC184{Delta} cloning vector cultured under either iron-rich or iron-limiting conditions (Fig. 5DownA, lanes 1 and 2). Western blot analysis with anti-Fur confirmed the absence of Fur in these samples (Fig. 5BDown, lanes 1 and 2). In contrast, co-transformation of E. coli BN4020 with pMU76 and pMU45.184, a pACYC184 derivative that harbours the A. baumannii 8399 fur gene, resulted in the repression (lane 3) and induction (lane 4) of the expression of OM73 under iron-rich and iron-limited conditions, respectively. Similar results were obtained with E. coli BN4020 transformed with pMU76 and pMH15, which harbours the E. coli fur gene (lanes 5 and 6). Immunoblot analysis of the four latter samples confirmed the presence of Fur encoded by pMU45.184 and pMH15 (lanes 3 and 4, and 5 and 6, of Fig. 5BDown, respectively). The observation that Fur is also detected by immunoblotting in whole-cell lysates of A. baumannii 8399 (data not shown) suggests that this iron repressor controls the expression of OM73 in its native environment.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4. Nucleotide sequence of the genomic region that encompasses the 5' regions of om73 and p114 and the 184 nt intergenic region that separates them. The boxed nucleotides identify potential Fur-binding sequences. The characters depicted in bold and italics on the lower and upper strands represent the 5' end of om73 and p114, respectively.

 


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5. Analysis of the expression of OM73 and Fur. Whole-cell lysates were prepared from E. coli BN4020 cells harbouring pMU76 and pACYC184{Delta} (lanes 1 and 2) or pMU76 together with either pMU45.184 (lanes 3 and 4) or pMH15 (lanes 5 and 6) cultured either under iron-rich (lanes 1, 3 and 5) or iron-limiting conditions (lanes 2, 4 and 6). (A) Blotted proteins were probed with anti-OM73. (B) Blotted proteins were probed with anti-Fur. Immunocomplexes were detected with protein A labelled with horseradish peroxidase and chemiluminescence.

 
Nucleotide analysis of genes encoding secretion-like proteins
The second ORF of pMU73, which is actively transcribed in A. baumannii 8399 cells (Fig. 2Up lane 1), encodes a 114·5 kDa predicted protein, referred to as P114, that is highly similar to a large number of bacterial multidrug efflux proteins, with a predicted Y. pestis protein (Parkhill et al., 2001Down) as the top match (Table 3Up). The long list of highly related proteins includes the Pseudomonas aeruginosa MexB (score 884; E value 0·0) iron-regulated efflux protein, whose gene is upstream of oprM (Poole et al., 1993aDown, bDown). All these proteins are integral membrane proteins that belong to the AcrB/AcrD/AcrF family generally known as the resistance-nodulation-cell division (RND) transporters, some of which are part of active transport systems involved in bacterial drug resistance (Borges-Walmsley & Walmsley, 2001Down; Paulsen et al., 1996Down). The predicted structure of P114 includes membrane-spanning helices and motifs found in different members of this family of bacterial proteins (Paulsen et al., 1996Down). The om73p114 intergenic region contains potential sequences that could serve as the promoter element of this gene, which are in close proximity to the almost perfect Fur boxes predicted within this genomic area (Fig. 4Up). These observations strongly suggest that the expression of p114 could also be regulated by iron and Fur.

The pMU73 ORF 9, which is part of the bicistronic message containing ORF 8 (Fig. 2Up, lane 6), encodes a 45 kDa protein highly similar to the E. coli P43 membrane protein (Table 3Up). The latter, which was recently named EntS, is encoded by the ybdA gene of the E. coli ent operon (Chenault & Earhart, 1991Down; Shea & McIntosh, 1991Down) and participates in the secretion of enterobactin (Furrer et al., 2002Down). The A. baumannii P45 and E. coli P43 proteins contain, with the exception of one, equivalent transmembrane (TM) domains (Fig. 6Down). The exception is the predicted TM 11 region that has a high probability to be such a domain in P43, while the P45 counterpart seems to have a lower score for a membrane-spanning helix. However, analysis of P45 with HMMTOP predicts 12 membrane-spanning helices. These two proteins showed 43·7 % identity and 55·3 % similarity when aligned with GAP. This analysis also showed that the apparent disparity between the predicted structures of P43 and P45 is consistent with the differences in amino acid sequences between them, particularly within the last half of the predicted amino acid sequence (Fig. 6CDown). The ATG initiation codon of p45 is part of the TGA termination codon of the dhbF-like gene, a finding that is in accordance with the RT-PCR results that showed that these two ORFs are part of a polycistronic mRNA (Fig. 2Up, lane 6). Analysis of the nucleotide region upstream of the latter gene, which is predicted to contain the promoter of this polycistronic locus, showed the presence of the nucleotide sequence GTTAACCATTAATCCTTTTC, which matches 15 of the 19 nucleotides of the Fur-box consensus sequence (Calderwood & Mekalanos, 1988Down).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 6. Comparative analysis of the A. baumannii 8399 P45 and E. coli P43 proteins. The predicted secondary structures of P45 (A) and P43 (B) were obtained with TMHMM. Potential inside and outside protein regions are labelled as I and O, respectively. Black blocks with numbers represent the transmembrane regions predicted in each protein. (C) Alignment of P45 and P43 using GAP.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The finding of dhb genes in the genome of A. baumannii 8399 is in accordance with our previous report showing that this clinical isolate expresses a catechol-based siderophore that scavenges iron from human high-affinity iron-binding proteins (Echenique et al., 1992Down). The genetic arrangement of this gene cluster, which encodes proteins highly similar to other bacterial proteins involved in DHBA biosynthesis, is the same as that found in the B. subtilis dhbACEB (Rowland et al., 1996Down) and the V. cholerae vibACEB (Wyckoff et al., 1997Down) loci. However, the A. baumannii 8399 and B. subtilis loci are transcribed in the same direction as a single polycistronic unit, while the V. cholerae locus is organized in three transcriptional units. Interestingly, the predicted proteins encoded by the A. baumannii 8399 dhb genes are more similar to those found in Gram-positive than in Gram-negative bacteria. This observation suggests that unrelated bacteria acquired these essential iron-acquisition genes from different natural sources. Nevertheless, our findings provide more support to the hypothesis that catechol biosynthetic genes are highly conserved among Gram-positive and Gram-negative bacteria. Genetic complementation assays and siderophore utilization tests proved that the A. baumannii dhbA, dhbB and dhbE genes encode active proteins that restore enterobactin biosynthesis and iron uptake proficiency when introduced in E. coli ent mutants. These assays also showed that the dhbB translational product is a bifunctional protein that is required for the biosynthesis of catechol siderophores such as enterobactin (Earhart, 1996Down) and anguibactin (Crosa & Walsh, 2002Down; Welch et al., 2000Down). This chromosomal region, which is part of the pMU73 insert DNA, also includes genes encoding predicted proteins that belong to the EntD and EntF family. The latter proteins are required for the biosynthesis of catechol siderophores in different bacteria (Crosa & Walsh, 2002Down). Taken together, the data provide strong evidence that A. baumannii 8399 harbours all the genetic determinants required for the biosynthesis of the catechol siderophore detected in iron-limited culture supernatants of this pathogen (Echenique et al., 1992Down), whose structure is still unknown.

This set of dhb genes could also be present in the genome of the A. baumannii 19606 prototype strain that produces DHBA and acinetobactin (Yamamoto et al., 1994Down), a catechol siderophore almost identical to anguibactin, the siderophore produced by the fish pathogen V. anguillarum (Jalal et al., 1989Down). However, it is important to note that the A. baumannii 8399 catechol siderophore appears to be different from acinetobactin and anguibactin. This hypothesis is based on the observation that histamine, a precursor for anguibactin (Tolmasky et al., 1995Down) and most likely acinetobactin biosynthesis, could be detected in culture supernatants of V. anguillarum (Barancin et al., 1998Down) and A. baumannii 19606 (Actis et al., 1999Down). In contrast, the mass spectral analysis of A. baumannii 8399 culture supernatants did not reveal the presence of this biogenic amine, which serves as a siderophore precursor (Actis et al., 1999Down). Furthermore, preliminary tests showed that the production of OM73 could be detected only in cells of 8399, while the production of an outer-membrane protein related to FatA, the receptor for anguibactin in V. anguillarum (Actis et al., 1988Down), was detected only in iron-starved cells of 19606 (C. W. Dorsey, M. S. Beglin & L. A. Actis, unpublished). The results of this protein analysis are further supported by the fact that the genes encoding OM73 and the FatA-like proteins could be detected only in strains 8399 and 19606, respectively. These data are consistent with the possibility that the A. baumannii 8399 and 19606 clinical isolates express similar but unrelated iron-acquisition systems.

The A. baumannii 8399 region cloned in pMU73 also includes a fes-like gene that is actively transcribed and encodes a deduced protein related to the Fes enterobactin esterase (Brickman & McIntosh, 1992Down). This protein is present in bacteria such as E. coli, Salmonella and Shigella, which acquire iron via the production and uptake of ferric enterobactin. The presence and expression of this gene in A. baumannii 8399 could be explained by the potential but untested capacity of this pathogen to use ferric enterobactin. However, this iron chelator must be provided by an exogenous source since siderophore utilization bioassays and chemical tests proved that the 8399 isolate does not produce and secrete enterobactin (Echenique et al., 1992Down). The production of a siderophore similar but not identical to enterobactin is another alternative that can explain the presence of the fes-like gene, a possibility that could be elucidated after the structure of the A. baumannii 8399 siderophore is determined.

Similar to other bacterial gene clusters involved in iron acquisition, this A. baumannii 8399 genomic region also contains genes encoding proteins that are highly related to iron-transport proteins. One of them is OM73, which is one of several iron-regulated outer-membrane proteins detected previously in iron-starved A. baumannii 8399 cells (Echenique et al., 1992Down). This protein is clearly located in the outer-membrane fraction and exposed to the extracellular environment. These properties, together with its iron-regulated expression mediated by Fur, the presence of a TonB box in its predicted amino acid sequence, and its significant similarity to other bacterial siderophore receptors, provide strong support for its potential role as a receptor for ferric siderophore complexes.

Another protein potentially involved in iron acquisition is P45, whose deduced amino acid sequence and secondary structure are highly similar to those of the E. coli P43 protein (Chenault & Earhart, 1991Down; Shea & McIntosh, 1991Down). This finding is significant in light of the recent report showing that the latter, also known as EntS, is involved in the secretion of enterobactin (Furrer et al., 2002Down). P45 also showed significant similarity to six P. aeruginosa proteins that belong to the major facilitator superfamily (MFS) class (Borges-Walmsley & Walmsley, 2001Down; Paulsen et al., 1996Down) but not to OprM, which is an iron-regulated efflux pump protein that appears to function as the pyoverdin exporter (Poole et al., 1993aDown, bDown). The presence of a Fur box located within the promoter region of the entF-like–p45 bicistronic locus suggests that the expression of P45 is regulated by iron and Fur. Thus, the location of p45 within a cluster of genes encoding iron-acquisition functions, the high similarity of its translation product to a siderophore secretion protein, and its potential iron-regulated expression via Fur provide strong support for its possible role in the secretion of the catechol siderophore produced by A. baumannii 8399.

P114, the third protein encoded within this A. baumannii 8399 gene cluster, has striking similarity to a large number of bacterial membrane proteins involved in resistance to antimicrobial agents. Among them is AdeB, an efflux protein produced by the A. baumannii BM4454 isolate, which is encoded by a gene that is part of a gene cluster that encodes all the components of an RND-type efflux system that confers aminoglycoside resistance upon this strain (Magnet et al., 2001Down). Another protein highly similar to P114 is the P. aeruginosa MexB protein, an iron-regulated protein that is part of a polycistronic message that includes oprM (Poole et al., 1993aDown, bDown). Although the role of MexB in antibiotic resistance was proven, the participation of this type of efflux pump protein in iron acquisition and siderophore export remains to be tested. It is clear that the genetic arrangement of the A. baumannii 8399 locus that contains p114, in which this gene is flanked by iron transport and siderophore biosynthetic genes, is different from that reported for other bacterial efflux operons (Paulsen et al., 1996Down), including that found in the genome of P. aeruginosa PAO1 (Stover et al., 2000Down) and A. baumannii BM4454 (Magnet et al., 2001Down). Thus, it is tempting to speculate that P114 functions in siderophore secretion, either by itself or in conjunction with P45 or another undetermined protein(s).

It is worthy of note that several attempts to generate isogenic derivatives affected in some of the functions described in this work, using several well-established insertional systems and different experimental conditions, failed to yield the expected and predicted derivatives. These results suggest that the A. baumannii clinical isolates, such as the 8399 strain, may not be as amenable as other bacteria to this type of genetic manipulation. This hypothesis is supported by our recent observation that among the different systems tested with the prototype strain 19606, electroporation of transposon–transposase complexes is the most efficient approach to obtain isogenic insertion derivatives of this pathogen (Dorsey et al., 2002Down). We are currently testing this approach with strain 8399 and developing the genetic tools required for the functional analysis of the genes described in this work in an isogenic background.


    ACKNOWLEDGEMENTS
 
This work was supported by a grant from the American Lung Association and research funds from Miami University and by United States Public Health Service Grants AI44776 and DE13657-02 (to L. A. A.) and AI19018 (to J. H. C.) from the National Institutes of Health. We thank C. Wood, coordinator of the Miami University Center of Bioinformatics and Functional Genomics, for his support and assistance with automated DNA sequencing and nucleotide sequence analysis.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Actis, L. A., Potter, S. & Crosa, J. H. (1985). Iron-regulated outer membrane protein OM2 of Vibrio anguillarum is encoded by virulence plasmid pJM1. J Bacteriol 161, 736–742.[Abstract/Free Full Text]

Actis, L. A., Fish, W., Crosa, J. H., Kellerman, K., Ellenberger, S., Hauser, F. & Sanders-Loehr, J. (1986). Characterization of anguibactin, a novel siderophore from Vibrio anguillarum 775(pJM1). J Bacteriol 167, 57–65.[Abstract/Free Full Text]

Actis, L. A., Tolmasky, M. E., Farrell, D. & Crosa, J. H. (1988). Genetic and molecular characterization of essential components of the Vibrio anguillarum plasmid-mediated iron-transport system. J Biol Chem 263, 2853–2860.[Abstract/Free Full Text]

Actis, L. A., Tolmasky, M. E., Crosa, L. M. & Crosa, J. H. (1993). Effect of iron-limiting conditions on growth of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 31, 2812–2815.[Abstract/Free Full Text]

Actis, L. A., Smoot, J. C., Barancin, C. E. & Findlay, R. H. (1999). Comparison of differential plating media and two chromatography techniques for the detection of histamine production in bacteria. J Microbiol Methods 39, 79–90.[CrossRef][Medline]

Anstey, N. M., Currie, B. J. & Withnall, K. M. (1991). Community-acquired Acinetobacter pneumonia in the northern territory of Australia. Clin Infect Dis 14, 83–91.

Armstrong, S. K., Pettis, G. S., Forrester, L. J. & McIntosh, M. A. (1989). The Escherichia coli enterobactin biosynthesis gene entD: nucleotide sequence and membrane localization of its protein product. Mol Microbiol 3, 757–766.[CrossRef][Medline]

Arnow, L. (1937). Colorimetric determination of the components of 3,4-dihydroxyphenylalanine-tyrosine mixtures. J Biol Chem 118, 531–537.[Free Full Text]

Bagg, A. & Neilands, J. (1985). Mapping of a mutation affecting regulation of iron uptake systems in Escherichia coli K-12. J Bacteriol 161, 450–453.[Abstract/Free Full Text]

Barancin, C. E., Smoot, J. C., Findlay, R. H. & Actis, L. A. (1998). Plasmid-mediated histamine biosynthesis in the bacterial fish pathogen Vibrio anguillarum. Plasmid 39, 235–244.[CrossRef][Medline]

Bergogne-Berenzin, E. & Towner, K. J. (1996). Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev 9, 148–165.[Medline]

Birnboim, H. C. & Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7, 1513–1523.[Abstract/Free Full Text]

Bolivar, F., Rodriguez, R. L., Greene, P. J., Betlach, H. L., Heynecker, H. L., Boyer, H. W., Crosa, J. H. & Falkow, S. (1977). Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2, 95–113.[Medline]

Borges-Walmsley, M. I. & Walmsley, A. R. (2001). The structure and function of drug pumps. Trends Microbiol 9, 71–79.[CrossRef][Medline]

Boyer, H. W. & Roulland-Doussoix, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41, 459–472.[CrossRef][Medline]

Brickman, T. & McIntosh, M. (1992). Overexpression and purification of ferric enterobactin esterase from Escherichia coli. Demonstration of enzymatic hydrolysis of enterobactin and its iron complex. J Biol Chem 267, 12350–12355.[Abstract/Free Full Text]

Calderwood, S. B. & Mekalanos, J. (1988). Confirmation of the fur operator site by insertion of a synthetic oligonucleotide into an operon fusion plasmid. J Bacteriol 170, 1015–1017.[Abstract/Free Full Text]

Chenault, S. S. & Earhart, C. F. (1991). Organization of genes encoding membrane proteins of the Escherichia coli ferrienterobactin permease. Mol Microbiol 5, 1405–1413.[CrossRef][Medline]

Coderre, P. E. & Earhart, C. F. (1989). The entD gene of the Escherichia coli K12 enterobactin gene cluster. J Gen Microbiol 135, 3043–3055.[Abstract/Free Full Text]

Crosa, J. H. (1989). Genetics and molecular biology of siderophore-mediated iron transport in bacteria. Microbiol Rev 53, 517–530.[Abstract/Free Full Text]

Crosa, J. H. & Walsh, C. T. (2002). Genetics and assembly line enzymology of siderophore biosynthesis in bacteria. Microbiol Mol Biol Rev 66, 223–249.[Abstract/Free Full Text]

de Lorenzo, V., Bindereif, A., Paw, B. H. & Neilands, J. B. (1986). Aerobactin biosynthesis and transport genes of plasmid ColV-K30 in Escherichia coli K-12. J Bacteriol 165, 570–578.[Abstract/Free Full Text]

Dorsey. C. W, Tomaras, A. P. & Actis, L. A. (2002). Genetic and phenotypic analysis of Acinetobacter baumannii insertion derivatives generated with a Transposome system. Appl Environ Microbiol 68, 6353–6360.[Abstract/Free Full Text]

Earhart, C. F. (1996). Uptake and metabolism of iron and molybdenum. In Escherichia coli and Salmonella. Cellular and Molecular Biology, pp. 1075–1090. Edited by F. C. Neidhardt and others. Washington, DC: American Society for Microbiology.

Echenique, J. R., Arienti, H., Tolmasky, M. E., Read, R., Staneloni, J., Crosa, J. H. & Actis, L. A. (1992). Characterization of a high-affinity iron transport system in Acinetobacter baumannii. J Bacteriol 174, 7670–7679.[Abstract/Free Full Text]

Echenique, J. R., Dorsey, C. W., Patrito, L. C., Petroni, A., Tolmasky, M. E. & Actis, L. A. (2001). Acinetobacter baumannii has two genes encoding glutathione-dependent formaldehyde dehydrogenase: evidence for differential regulation in response to iron. Microbiology 147, 2805–2815.[Abstract/Free Full Text]

Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132, 6–13.[CrossRef][Medline]

Franza, T. & Expert, D. (1991). The virulence-associated chrysobactin iron uptake system of Erwinia chrysanthemi 3937 involves an operon encoding transport and biosynthetic functions. J Bacteriol 173, 6874–6881.[Abstract/Free Full Text]

Franza, T., Enard, C., van Gijsegem, F. & Expert, D. (1991). Genetic analysis of the Erwinia chrysanthemi 3937 chrysobactin iron-transport system: characterization of a gene cluster involved in uptake and biosynthetic pathways. Mol Microbiol 5, 1319–1329.[CrossRef][Medline]

Furrer, J. L., Sanders, D. N., Hook-Barnard, I. G. & McIntosh, M. A. (2002). Export of the siderophore enterobactin in Escherichia coli: involvement of a 43 kDa membrane exporter. Mol Microbiol 44, 1225–1234.[CrossRef][Medline]

Gehring, A. M., Bradley, K. A. & Walsh, C. T. (1997). Enterobactin biosynthesis in Escherichia coli: isochorismate lyase (EntB) is a bifunctional enzyme that is phosphopantetheinylated by EntD and then acylated by EntE using ATP and 2,3-dihydroxybenzoate. Biochemistry 36, 8495–8503.[CrossRef][Medline]

Graber, K., Smoot, L. M. & Actis, L. A. (1998). Expression of iron binding proteins and hemin binding activity in the dental pathogen Actinobacillus actinomycetemcomitans. FEMS Microbiol Lett 163, 135–142.[CrossRef][Medline]

Griffiths, G. L., Sigel, S. P., Payne, S. M. & Neilands, J. B. (1984). Vibriobactin, a siderophore from Vibrio cholerae. J Biol Chem 259, 383–385.[Abstract/Free Full Text]

Hantke, K. (1984). Cloning of the repressor protein gene of iron-regulated systems in Escherichia coli K12. Mol Gen Genet 197, 337–341.[CrossRef][Medline]

Hartstein, A. I., Rashad, A. L., Liebler, J. M. & 7 other authors (1988). Multiple intensive care unit outbreak of Acinetobacter calcoaceticus subspecies anitratus respiratory infection and colonization associated with contaminated, reusable ventilators and resuscitation bags. Am J Med 85, 624–631.[Medline]

Jalal, M., Hossain, D., van der Helm, J., Sanders-Loerh, J., Actis, L. A. & Crosa, J. H. (1989). Structure of anguibactin, a unique plasmid-related bacterial siderophore from the fish pathogen Vibrio anguillarum. J Am Chem Soc 111, 292–296.[CrossRef]

Knauf, V. C. & Nester, E. W. (1982). Wide host range cloning vectors: a cosmid clone bank of an Agrobacterium Ti plasmid. Plasmid 8, 45–54.[CrossRef][Medline]

Leong, S., Ditta, G. S. & Helinski, D. R. (1982). Heme biosynthesis in Rhizobium: identification of a cloned gene coding for an amino levulininc acid synthetase from Rhizobium meliloti. J Biol Chem 257, 8724–8730.[Abstract/Free Full Text]

Magnet, S., Courvalin, P. & Lambert, T. (2001). Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob Agents Chemother 45, 3375–3380.[Abstract/Free Full Text]

Massad, G., Arceneaux, J. E. L. & Byers, B. R. (1994). Diversity of siderophore genes encoding biosynthesis of 2,3-dihydroxybenzoic acid in Aeromonas spp. Biometals 7, 227–236.[Medline]

Meade, H. M., Long, S. R., Ruvkum, S. E., Brown, S. E. & Ausubel, F. M. (1982). Physical and genetic characterization of symbiotic and auxotrophic mutants Rhizobium meliloti induced by transposon Tn5 mutagenesis. J Bacteriol 149, 114–122.[Abstract/Free Full Text]

Miller, J. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Murray, N. E., Brammar, W. J. & Murray, K. (1977). Lambdoid phages that simplify the recovery of in vitro recombinants. Mol Gen Genet 150, 53–61.[CrossRef][Medline]

Nau, C. & Konisky, J. (1989). Evolutionary relationship between the TonB-dependent outer membrane transport proteins: nucleotide and amino acid sequences of the Escherichia coli colicin I receptor gene. J Bacteriol 171, 1041–1047.[Abstract/Free Full Text]

Neilands, J. (1981). Microbial iron compounds. Annu Rev Biochem 50, 715–731.[CrossRef][Medline]

Neilands, J. (1995). Siderophores: structure and function of microbial iron transport compounds. J Biol Chem 270, 26723–26726.[Free Full Text]

O'Brien, I. G. & Gibson, F. (1970). The structure of enterochelin and related 2,3-dihydroxy-N-benzoyl serine conjugates from Escherichia coli. Biochim Biophys Acta 215, 393–402.[Medline]

Olmsted, J. B. (1981). Affinity purification of antibodies from diazotized paper blots of heterogeneous protein samples. J Biol Chem 256, 11955–11957.[Abstract/Free Full Text]

Parkhill, J., Wren, B. W., Thomson, N. R. & 38 other authors (2001). Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413, 523–527.[CrossRef][Medline]

Paulsen, I. T., Brown, M. H. & Skurray, R. A. (1996). Proton-dependent multidrug efflux systems. Microbiol Rev 60, 575–608.[Abstract/Free Full Text]

Payne, S. M., Niesel, D. W., Peixotto, S. S. & Lawlor, K. M. (1983). Expression of hydroxamate and phenolate siderophores by Shigella flexneri. J Bacteriol 155, 949–955.[Abstract/Free Full Text]

Persmark, M., Expert, D. & Neilands, J. B. (1989). Isolation, characterization, and synthesis of chrysotobactin, a compound with siderophore activity from Erwinia chrysanthemi. J Biol Chem 264, 3187–3189.[Abstract/Free Full Text]

Pickett, C. L., Hayes, L. & Earhart, C. F. (1984). Molecular cloning of the Escherichia coli K12 entACGBE genes. FEMS Microbiol Lett 24, 77–80.[CrossRef]

Pollack, J. R. & Neilands, J. B. (1970). Enterobactin, an iron transport compound from Salmonella typhimurium. Biochem Biophys Res Commun 38, 989–992.[CrossRef][Medline]

Pollack, J. R., Ames, B. N. & Neilands, J. B. (1970). Iron transport in Salmonella typhimurium: mutants blocked in the biosynthesis of enterobactin. J Bacteriol 104, 635–639.[Abstract/Free Full Text]

Poole, K., Heinrichs, D. E. & Neshat, S. (1993a). Cloning and sequence analysis of an EnvCD homologue in Pseudomonas aeruginosa: regulation by iron and possible involvement in the secretion of the siderophore pyoverdine. Mol Microbiol 10, 529–544.[CrossRef][Medline]

Poole, K., Krebes, K., McNally, C. & Neshat, S. (1993b). Multiple antibiotic resistance in Pseudomonas aeruginosa: evidence for involvement of an efflux operon. J Bacteriol 175, 7363–7372.[Abstract/Free Full Text]

Rogers, H. J. (1973). Iron-binding catechols and virulence in Escherichia coli. Infect Immun 7, 445–446.[Abstract/Free Full Text]

Rowland, B. M., Grossman, T. H., Osburne, M. S. & Tabor, H. W. (1996). Sequence and genetic organization of a Bacillus subtilis operon encoding 2,3-dihydroxybenzoate biosynthetic enzymes. Gene 178, 119–123.[CrossRef][Medline]

Rusnak, F., Sakaitani, M., Drueckhammer, D., Reichert, J. & Walsh, C. (1991). Biosynthesis of the Escherichia coli siderophore enterobactin: sequence of the entF gene, expression and purification of EntF, and analysis of covalent phosphopantetheine. Biochemistry 30, 2916–2927.[CrossRef][Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schwyn, B. & Neilands, J. B. (1987). Universal chemical assay for the detection and determination of siderophores. Anal Biochem 160, 47–56.[CrossRef][Medline]

Shea, C. & McIntosh, M. (1991). Nucleotide sequence and genetic organization of the ferric enterobactin transport system: homology to other periplasmic binding protein-dependent systems in Escherichia coli. Mol Microbiol 5, 1415–1428.[Medline]

Smoot, L. M., Bell, E. C., Paz, R. L., Corbin, K. A., Hall, D. D., Steenbergen, J. N., Harner, A. C. & Actis, L. A. (1998). Molecular and genetic analysis of iron uptake proteins in the Brazilian purpuric fever clone of Haemophilus influenzae biogroup aegyptius. Front Biosci 3, d989–d996.

Stachel, S., An, G., Flores, C. & Nester, E. (1985). A Tn3 lacZ transposon for the random generation of {beta}-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium. EMBO J 4, 891–898.[Medline]

Stover, C. K., Pham, X. Q., Erwin, A. L. & 28 other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959–964.[CrossRef][Medline]

Studier, F., Rosenberg, A., Dunn, J. & Dubendorff, J. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185, 60–89.[Medline]

Tabor, S. & Richardson, C. (1985). A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci U S A 82, 1074–1078.[Abstract/Free Full Text]

Tolmasky, M. E., Wertheimer, A., Actis, L. A. & Crosa, J. H. (1994). Characterization of the Vibrio anguillarum fur gene: role in regulation of expression of the FatA outer membrane protein and catechols. J Bacteriol 176, 213–220.[Abstract/Free Full Text]

Tolmasky, M. E., Actis, L. A. & Crosa, J. H. (1995). A histidine decarboxylase gene encoded by the Vibrio anguillarum plasmid pJM1 is essential for virulence: histamine is a precursor in the biosynthesis of anguibactin. Mol Microbiol 15, 87–95.[CrossRef][Medline]

Walsh, C. T., Liu, J., Rusnak, F. & Sakaitani, M. (1990). Molecular studies on enzymes in chorismate metabolism and enterobactin biosynthetic pathway. Chem Rev 90, 1105–1129.[CrossRef]

Welch, T. J., Chai, S. & Crosa, J. H. (2000). The overlapping angB and angG genes are encoded within the trans-acting factor region of the virulence plasmid in Vibrio anguillarum: essential role in siderophore biosynthesis. J Bacteriol 182, 6762–6773.[Abstract/Free Full Text]

Wilchek, M. & Bayer, E. A. (1988). The avidin-biotin complex in bioanalytical applications. Anal Biochem 171, 1–32.[CrossRef][Medline]

Wyckoff, E. E., Stoebner, J. A., Reed, K. E. & Payne, S. M. (1997). Cloning of a Vibrio cholerae vibriobactin gene cluster: identification of genes required for early steps in siderophore biosynthesis. J Bacteriol 179, 7055–7062.[Abstract/Free Full Text]

Yamamoto, S., Okujo, N. & Sakakibara, Y. (1994). Isolation and structure elucidation of acinetobactin, a novel siderophore from Acinetobacter baumannii. Arch Microbiol 162, 249–252.[Medline]

Received 23 December 2002; revised 12 February 2003; accepted 14 February 2003.


This article has been cited by other articles:


Home page
MicrobiologyHome page
A. P. Tomaras, M. J. Flagler, C. W. Dorsey, J. A. Gaddy, and L. A. Actis
Characterization of a two-component regulatory system from Acinetobacter baumannii that controls biofilm formation and cellular morphology
Microbiology, November 1, 2008; 154(11): 3398 - 3409.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Nakane and M. Miyata
Cytoskeletal "jellyfish" structure of Mycoplasma mobile
PNAS, December 4, 2007; 104(49): 19518 - 19523.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. Quatrini, C. Lefimil, F. A. Veloso, I. Pedroso, D. S. Holmes, and E. Jedlicki
Bioinformatic prediction and experimental verification of Fur-regulated genes in the extreme acidophile Acidithiobacillus ferrooxidans
Nucleic Acids Res., April 1, 2007; 35(7): 2153 - 2166.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
M. Balado, C. R. Osorio, and M. L. Lemos
A gene cluster involved in the biosynthesis of vanchrobactin, a chromosome-encoded siderophore produced by Vibrio anguillarum
Microbiology, December 1, 2006; 152(12): 3517 - 3528.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. Bleuel, C. Grosse, N. Taudte, J. Scherer, D. Wesenberg, G. J. Krauss, D. H. Nies, and G. Grass
TolC Is Involved in Enterobactin Efflux across the Outer Membrane of Escherichia coli
J. Bacteriol., October 1, 2005; 187(19): 6701 - 6707.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
C. W. Dorsey, A. P. Tomaras, P. L. Connerly, M. E. Tolmasky, J. H. Crosa, and L. A. Actis
The siderophore-mediated iron acquisition systems of Acinetobacter baumannii ATCC 19606 and Vibrio anguillarum 775 are structurally and functionally related
Microbiology, November 1, 2004; 150(11): 3657 - 3667.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
K. Mihara, T. Tanabe, Y. Yamakawa, T. Funahashi, H. Nakao, S. Narimatsu, and S. Yamamoto
Identification and transcriptional organization of a gene cluster involved in biosynthesis and transport of acinetobactin, a siderophore produced by Acinetobacter baumannii ATCC 19606T
Microbiology, August 1, 2004; 150(8): 2587 - 2597.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
C. W. Dorsey, M. S. Beglin, and L. A. Actis
Detection and Analysis of Iron Uptake Components Expressed by Acinetobacter baumannii Clinical Isolates
J. Clin. Microbiol., September 1, 2003; 41(9): 4188 - 4193.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorsey, C. W.
Right arrow Articles by Actis, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorsey, C. W.
Right arrow Articles by Actis, L. A.
Agricola
Right arrow Articles by Dorsey, C. W.
Right arrow Articles by Actis, L. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2003 Society for General Microbiology.