Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 149 (2003), 1333-1340; DOI  10.1099/mic.0.26067-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cote, C. K.
Right arrow Articles by Honeyman, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cote, C. K.
Right arrow Articles by Honeyman, A. L.
Agricola
Right arrow Articles by Cote, C. K.
Right arrow Articles by Honeyman, A. L.
Microbiology 149 (2003), 1333-1340; DOI  10.1099/mic.0.26067-0
© 2003 Society for General Microbiology

The LicT protein acts as both a positive and a negative regulator of loci within the bgl regulon of Streptococcus mutans

Christopher K. Cote and Allen L. Honeyman{dagger}

University of South Florida College of Medicine, Department of Medical Microbiology and Immunology, Tampa, FL 33612, USA

Correspondence
Allen L. Honeyman
ahoneyman{at}tambcd.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
An open reading frame (ORF) that would encode a putative antiterminator protein (LicT) of the BglG family was identified in the genomic DNA sequence of Streptococcus mutans. A DNA sequence that would encode a potential ribonucleic antiterminator (RAT) site in the mRNA at which the putative antitermination protein LicT would bind was located immediately downstream from this ORF. These putative antitermination components are upstream of a glucose-independent {beta}-glucoside-utilization system that is responsible for aesculin utilization by S. mutans NG8 in the presence of glucose. It was hypothesized that these putative regulatory components were an important mechanism that was involved with the controlled expression of the S. mutans bglP locus. A strain of S. mutans containing a licT : : {Omega}-Kan2 insertional mutation was created. This strain could not hydrolyse aesculin in the presence of glucose. The transcriptional activity associated with other genes from the bgl regulon was determined in the licT : : {Omega}-Kan2 genetic background using lacZ transcriptional fusions and {beta}-galactosidase assays to determine the effect of LicT on these loci. The LicT protein had no significant effect on the expression of the bglC promoter, a regulator of the bglA locus. However, it is essential for the optimal expression of bglP. These data correlate with the phenotype observed on aesculin plates for the S. mutans wild-type strain NG8 and the licT : : {Omega}-Kan2 strain. Thus, the glucose-independent {beta}-glucoside-specific phosphotransferase system (PTS) regulon in S. mutans relies on LicT for BglP expression and, in turn, aesculin transport in the presence of glucose. Interestingly, LicT also seems to negatively regulate the expression of the bglA promoter region. In addition, the presence of the S. mutans licT gene has been shown to be able to activate a cryptic {beta}-glucoside-specific operon found in Escherichia coli.


Abbreviations: PTS, phosphotransferase system; RAT, ribonucleic antiterminator

{dagger}Present Address: Texas A&M Health Science Center, Baylor College of Dentistry, 3302 Gaston Avenue, Dallas, TX 75246, USA.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
{beta}-Glucosides are carbohydrates that are largely derived from plant sources and include salicin, arbutin, cellobiose and aesculin. {beta}-Glucoside-utilization systems have been described in several bacteria, including Escherichia coli (Ausubel et al., 2001Down), Erwinia chrysanthemi (el Hassouni et al., 1990Down), Clostridium longisporum (Brown & Thomson, 1998Down), Lactobacillus plantarum (Marasco et al., 2000Down), Bacillus subtilis (Le Coq et al., 1995Down; Tobisch et al., 1997Down) and Streptococcus mutans (Cote et al., 2000Down). These organisms rely on the phosphoenolpyruvate-dependent phosphotransferase system (PTS) (Postma & Lengeler, 1985Down) for the transport and the subsequent utilization of various {beta}-glucosides. The structural features of the genes encoding these {beta}-glucoside-utilization systems are markedly similar. In most bacteria, these genes are organized in a simple operon structure (Cote et al., 2000Down). However, in S. mutans, these genes are organized as a regulon (Cote et al., 2000Down). It has been previously shown that the S. mutans bgl regulon encodes a {beta}-glucoside-specific enzyme II of the PTS (bglP), a transcriptional regulator of the AraC/XylS family (bglC), and a phospho-{beta}-glucosidase (bglA) (Cote et al., 2000Down). There are two additional ORFs within this region (bglB and ORF4) that would potentially encode proteins whose function is unknown at this time (Fig. 1Down). The {beta}-glucoside-specific locus isolated from S. mutans is unique because of its regulon gene arrangement and because of the BglC protein, which acts as a positive regulator of the bglA gene (Cote & Honeyman, 2002Down).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. Diagram of {beta}-glucoside PTS operons. (a) The simple operon structure of {beta}-glucoside PTSs described in other organisms. (b) The unique regulon structure displayed by the bgl regulon from S. mutans.

 
Recently, an additional ORF has been identified (Cote & Honeyman, 2002Down) from the S. mutans genomic DNA sequence database (http://www.genome.ou.edu/smutans.html), isolated by PCR amplification, and examined for possible regulatory functions that affect the bgl regulon. This ORF (the licT gene) would encode a putative protein belonging to the BglG family of transcriptional antiterminators (Schnetz et al., 1987Down). Antiterminator proteins are believed to be involved in the transcriptional regulation of {beta}-glucoside-specific genes from Escherichia coli (Hall & Xu, 1992Down), Erwinia chrysanthemi (el Hassouni et al., 1990Down), Lactococcus lactis (Bardowski et al., 1994Down), Lactobacillus plantarum (Marasco et al., 2000Down), B. subtilis (Le Coq et al., 1995Down; Tobisch et al., 1997Down) and C. longisporum (Brown & Thomson, 1998Down). It is believed that these antiterminator proteins would bind to a ribonucleic antiterminator (RAT) site present in a specific mRNA secondary structure and would prevent the formation of a hairpin terminator structure that terminates transcription (Rutberg, 1997Down). The binding of the antiterminator protein to the mRNA would allow transcription through the disrupted terminator structure into the {beta}-glucoside-specific genes that are not normally transcribed. Thus, the antitermination mechanism of transcriptional regulation allows for the expression of {beta}-glucoside-specific loci in the absence of a metabolically preferred carbon source (Rutberg, 1997Down).

In this report, we determine that the LicT protein regulates the S. mutans {beta}-glucoside-specific PTS regulon in the presence of glucose via a putative antitermination mechanism. Additional evidence that LicT acts as an antiterminator is provided by the fact that this protein activates a cryptic Escherichia coli operon. Based upon protein similarities and potential RAT structures, we believe that the E. coli bglGFB operon is induced by the S. mutans LicT protein. LicT is shown to be essential for the efficient expression of bglP and aesculin hydrolysis by S. mutans in the presence of glucose. LicT also acts as a negative regulator of the bglA locus.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacterial strains and media.
All strains used in this report are listed in Table 1Down. S. mutans NG8 was used as the wild-type strain, as the source of chromosomal DNA and as the recipient strain for all S. mutans transformations. E. coli CC118 [{Delta}(araleu)7697 araD139 {Delta}lacX74 galE galK {Delta}phoA20 thi-1 rpsE rpoB argE(Am) recA1] (Manoil & Beckwith, 1985Down) was used for all recombinant DNA procedures. S. mutans strains were grown on brain–heart infusion (BHI) agar plates or in BHI broth (Difco). S. mutans strains were grown under antibiotic selection, when appropriate, with kanamycin (500 µg ml-1), erythromycin (20 µg ml-1) or a combination of both antibiotics. All E. coli strains were grown on Lennox Broth (LB) agar plates or in LB broth (Gibco-BRL). E. coli strains were grown under antibiotic selection with ampicillin (100 µg ml-1) or chloramphenicol (20 µg ml-1), when appropriate. S. mutans cultures were grown statically at 37 °C, while E. coli cultures were grown at 37 °C with shaking aeration. Aesculin plates, with and without supplemental glucose, were made as described previously (Cote et al., 2000Down). Arbutin assay plates were made in a similar manner with arbutin as the sole carbon source rather than aesculin. Unless otherwise noted, all chemicals and reagents were purchased from Sigma-Aldrich.


View this table:
[in this window]
[in a new window]
 
Table 1. Strains and plasmids used in this study

 
DNA isolation, manipulation and PCR amplification.
Streptococcal DNA was isolated as described previously (Cote et al., 2000Down). Plasmid DNA mini-preparations were performed using the QIAprep 8 Miniprep kits or the QIAprep Spin Miniprep kits (Qiagen). Recombinant plasmid constructs were electroporated into E. coli as described by Dower (1990)Down. S. mutans was transformed as described by Murchison et al. (1986)Down or Cvitkovich et al. (1998)Down. All DNA manipulations and enzyme procedures were done using standard protocols (Sambrook et al., 1989Down) and according to the manufacturer's instructions. All experiments were conducted under the National Institutes of Health recombinant DNA guidelines.

The licT gene was PCR-amplified from chromosomal DNA of S. mutans NG8 by primers designed using DNA sequence data obtained from the S. mutans genome database at the University of Oklahoma (http://www.genome.ou.edu/smutans.html). The primers were bglP1 (5'-CGCAAGCGAGTAACACAGTG-3') and licT (5'-GATTAGCAAAATGAAGGCAG-3'). The annealing temperature used for this primer pair was 45 °C. The polymerase used was KlenTaq-LA (Clontech) and was used according to the manufacturer's recommendations for elongation times and temperatures.

Aesculin transport and hydrolysis in S. mutans.
To measure the relative amount of aesculin transported and hydrolysed by the cell, the hydrolysis product of aesculin, 6,7-dihydroxycoumarin, was measured in the following manner. S. mutans cells were grown overnight as 10 ml cultures in CDM (van de Rijn & Kessler, 1980Down) supplemented with 0·5 % glucose and 0·5 % aesculin. The cells were collected by centrifugation and washed twice with TES buffer (10 mM Tris, 1 mM EDTA, 150 mM NaCl, pH 8·0). The cells were resuspended in 250 µl TES buffer and transferred to a 1·5 ml screw-cap microfuge tube (Sarstedt). A small amount of 0·1 mm zirconia/silica beads (Biospec Products) was added to each tube (approx. 1/6 of the total tube volume). The cells were lysed by shaking the tubes in a Mini-BeadBeater-8 (Biospec Products) for 80 s. Cleared cell lysates were formed by centrifugation in a microcentrifuge for 10 min at 13 000 r.p.m. The protein concentration of the lysate was determined using the Coomassie Plus Protein Assay reagent (Pierce). Thirty micrograms of protein from the lysate was diluted with TES to a final volume of 100 µl, and 200 µl of 0·002 M ferric citrate was added to each sample. The samples were mixed briefly and added to wells of a clear, flat-bottomed microtitre plate. The absorbance of the samples was read on a Molecular Devices fMax microplate reader set at 595 nm. TES buffer served as the blank, while lysates of S. mutans cells grown in the absence of aesculin served as the negative control. In this assay, the breakdown product of aesculin cleavage, 6,7-dihydroxycoumarin, reacts with the ferric citrate to form a black product. The relative amount of product formed was assayed by the absorbance at 595 nm. The obtained optical density (OD) values were divided by the OD value of the lysate from wild-type S. mutans NG8 cells. The ODs were plotted as the percentage of the wild-type and the data presented are a mean of at least three independent experiments.

Construction of lacZ fusions.
The lacZ transcriptional fusions with the bglP, bglC and bglA promoter regions were created using the gene reporter vector pALH122 (Honeyman et al., 2002Down). This plasmid is a derivative of the shuttle vector pVA838 (Macrina et al., 1982Down) and contains the lacZ gene from E. coli for use as a reporter of transcriptional activity (Honeyman et al., 2002Down).

Construction of the plasmids pALH187, pALH188 and pALH189 has been reported previously (Cote & Honeyman, 2002Down). Briefly, a 490 bp XbaI–HindIII fragment, a 260 bp PCR fragment and a 233 bp PCR fragment were inserted into the unique SmaI site of pALH122, resulting in the reporter constructs pALH187, pALH188 and pALH189, respectively. These plasmids contained the promoter regions of the bglP, bglC and bglA genes, respectively. S. mutans strains NG8 and ALH201 containing these plasmids were used to monitor the transcriptional activity of the indicated genes.

Construction of the licT : : {Omega}-Kan2 mutant strain.
The PCR fragment containing the licT gene was isolated following amplification by agarose gel electrophoresis. A PCR fragment of approximately 2·15 kb was isolated from the agarose, digested with the restriction endonuclease HindIII and cloned into the HindIII site of the vector pACKS30, a derivative of pBluescript II (Alting-Mees & Short, 1989Down) that has a pACYC184 (Chang & Cohen, 1978Down) origin of replication (A. L. Honeyman, unpublished data). This results in the construction of pALH185. A licT gene interruption was created by inserting the {Omega}-Kan2 cassette (Perez-Casal et al., 1991Down) into the unique StyI site located 293 bp 3' to the LicT initiation codon within the cloned licT gene contained on pALH185. This resulted in the creation of pALH186. Plasmid pALH186 was then linearized by restriction endonuclease digestion with the enzyme XhoI and the linear restriction fragment transformed into S. mutans. Integration of the gene interruption into the S. mutans NG8 chromosome was selected for by kanamycin resistance. This resulted in the S. mutans strain ALH201. The interruption of the licT gene in this strain was confirmed by Southern blot analysis of chromosomal DNA isolated from the kanamycin-resistant transformant (data not shown). The described lacZ transcriptional fusions containing the various promoter regions from the bgl regulon were then transformed into this licT : : {Omega}-Kan2 strain, ALH201, to generate the strains listed in Table 1Up.

Construction of the bglP : : {Omega}-Kan2 mutant strain.
To create a S. mutans strain that has an insertional mutation in the bglP gene, plasmid pALH163 (Cote et al., 2000Down) was altered. Plasmid pALH163, which contains the S. mutans bglPBCA genes, was digested with the restriction endonucleases ClaI and EcoRI to remove a HindIII site located in the multiple cloning region of the vector. The linearized plasmid was treated with the Klenow fragment to generate blunt ends and then re-ligated to itself. The resulting plasmid contains a unique HindIII site located within the cloned bglP gene. This plasmid was digested with HindIII and the 5' overhanging ends were converted to blunt ends using the Klenow fragment. The {Omega}-Kan2 cassette (a SmaI restriction fragment) was ligated to the linearized plasmid (Perez-Casal et al., 1991Down). The insertion of the {Omega}-Kan2 cassette into the unique HindIII site located within the bglP gene resulted in plasmid pALH198. This plasmid was then linearized with the restriction endonuclease XbaI and the resulting DNA fragment was transformed into S. mutans NG8. Growth on kanamycin selected for the integration of the bglP : : {Omega}-Kan2 gene interruption into the chromosome of S. mutans NG8 to generate strain ALH376.

Fluorescent {beta}-galactosidase assays.
S. mutans strains containing the lacZ transcriptional fusions were grown in CDM media (van de Rijn & Kessler, 1980Down) supplemented with glucose, aesculin or a combination of glucose and aesculin. Each carbohydrate was at a concentration of 0·5 %. The cells were physically lysed with a Mini-BeadBeater-8 and fluorescent {beta}-galactosidase assays were performed as described previously (Cote & Honeyman, 2002Down). All data presented are the result of at least five independent assays and the standard deviations are indicated.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Cloning of the licT gene
The gene encoding the putative antiterminator LicT was identified from DNA sequence data obtained from the University of Oklahoma S. mutans genome database. This ORF was located 5' to the bgl regulon described previously (Cote et al., 2000Down) and is shown in Fig. 1Up. The LicT ORF is located at SMU.889 on the S. mutans chromosome (http://www.oralgen.lanl.gov/). PCR primers that flank two native chromosomal HindIII restriction endonuclease sites were designed using the genomic DNA sequence data and a fragment of 2·15 kb was amplified from chromosomal DNA of S. mutans NG8. The PCR fragment was isolated from an agarose gel following electrophoresis, digested with the restriction endonuclease HindIII, and cloned into the vector pACKS30 at the HindIII site. DNA nucleotide sequence analysis was performed on the cloned fragment to confirm its identity. The resulting construct, pALH185, contained a DNA fragment that contained 839 bp 5' to the start of the licT gene, the entire coding region of the licT gene and 476 bp 3' to licT. The gene encoding the putative antiterminator protein was named licT because of the similarity between the putative gene product and the LicT protein from B. subtilis (Schnetz et al., 1996Down; Yoshida et al., 1996Down). The putative LicT protein also displays extensive similarity with other antiterminator proteins (Table 2Down). The LicT ORF consists of 840 nt that would encode a putative protein of 280 aa in length. There is a putative ribosome-binding site, AAGGAA, that is seven bases upstream from the initiation codon (ATG). This sequence resembles ribosome-binding sites described in other Gram-positive bacteria (De Vos, 1987Down; Moran et al., 1982Down). The licT ORF is immediately followed by an inverted repeat sequence of 27 bases that could form a hairpin structure with 10 out of 11 bases pairing and a five base loop. This repeat sequence is immediately followed by a string of T residues. There are 17 bp between the termination codon of the licT gene and the start of the inverted repeat sequence. This type of structure could potentially act as a {rho}-independent transcription terminator. Thus, this region potentially encodes the transcriptional terminator for the S. mutans licT gene. The DNA sequence further downstream from the licT gene contained a region that would encode a putative RAT site (Brown & Thomson, 1998Down) that would potentially form in the mRNA of the bglP gene. This sequence was located 243 bp downstream from the termination codon (TAA) of the licT gene and 127 bp upstream of the initiation codon for the bglP gene (Fig. 1bUp). This putative RAT sequence, GGATTGTTACTGGTCATGCAGGCAAAACCTA, matches the proposed consensus sequence of RATs (Brown & Thomson, 1998Down). An alignment of several known and putative RAT sites is shown in Fig. 2Down, and a high degree of conservation is displayed between the sequences.


View this table:
[in this window]
[in a new window]
 
Table 2. Proteins with similarity to the S. mutans LicT protein

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. DNA sequence alignment of RAT sites. Several known and putative RAT sites were aligned using the BLAST program at NCBI. The consensus sequence was taken from Brown & Thomson (1998)Down. This alignment indicates that the high degree of conservation between the RAT sites of various species is extended to S. mutans.

 
Phenotype of the S. mutans licT : : {Omega}-Kan2 strain
The licT : : {Omega}-Kan2 mutant strain, ALH201, was spotted onto aesculin plates with and without supplemental glucose to determine the phenotype of the licT mutation. While the wild-type S. mutans strain NG8 could hydrolyse aesculin in the presence or absence of glucose, strain ALH201 could not hydrolyse aesculin in the presence of glucose (Fig. 3Down). It has previously been shown that the bgl regulon is not totally repressed by glucose and that a second {beta}-glucoside-utilization system, which is repressed by glucose, exists in S. mutans (Cote et al., 2000Down). While the second system may be involved in the absence of glucose, the bgl PTS regulon is responsible for the hydrolysis of aesculin in the presence of glucose and the phenotypic data presented here support the concept that the licT gene from this regulon is intimately involved with the utilization of {beta}-glucosides.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 3. Phenotype of S. mutans NG8 licT : : {Omega}-Kan2. Aesculin plates without supplemental glucose (left side) and with supplemental glucose (right side) were spotted with the S. mutans strains ALH201 (licT : : {Omega}-Kan2, A spots) and NG8 (wild-type, B spots) prior to overnight incubation. Dark zones indicate aesculin hydrolysis.

 
LicT activation of the cryptic E. coli {beta}-glucoside operon
E. coli contains all of the genes essential for the utilization of {beta}-glucosides. However, these genes remain cryptic and are not expressed unless they are artificially activated by a mutation upstream of the bglG gene that enhances the transcription of the bglG gene (Reynolds et al., 1981Down). The BglG protein is an antiterminator that acts at a RAT site to control expression of the bglGFB operon. It was observed that the E. coli CC118 strain harbouring plasmid pALH185, which contains the S. mutans licT gene, could hydrolyse the {beta}-glucosides arbutin and aesculin. However, neither the host strain nor the host strain harbouring the parental vector pACKS30 could efficiently break down either of these {beta}-glucosides (data not shown). The breakdown of these {beta}-glucosides by E. coli CC118 harbouring pALH185 is thought to be the result of the expression of the native E. coli bglGFB operon. It is hypothesized that the licT gene from S. mutans is expressed in E. coli from pALH185 and that LicT interacts with the E. coli RAT to mediate antitermination of the bglGFB operon, thus allowing expression of the PTS machinery necessary for E. coli to transport and utilize these {beta}-glucosides. This potential interaction is plausible due to the high similarity between the various antiterminator proteins (Table 2Up) and the high conservation of the RAT sites between species (Fig. 2Up) (Brown & Thomson, 1998Down). This observation also lends support to the proposed role of LicT as an antiterminator that regulates the bgl regulon in S. mutans.

Transport of aesculin into specific S. mutans strains
The phenotype observed when S. mutans hydrolyses aesculin on an agar plate, a blackening of the agar, is the result of the interaction of the aesculin hydrolysis product, 6,7-dihydroxycoumarin, and the ferric citrate present in the agar medium. Experiments were performed to further characterize the transport of aesculin into the S. mutans cell. Cell lysates from S. mutans cultures grown in the presence of glucose and aesculin were able to change a ferric citrate solution from colourless or pale-orange to black, indicating the presence of hydrolysed aesculin within the cell lysate. The bglP : : {Omega}-Kan2 mutant strain ALH376 and the licT : : {Omega}-Kan2 mutant strain ALH201 both exhibited significantly lower levels of intracellular hydrolysed aesculin (approx. 20–50 % of wild-type) when compared to the levels observed in the wild-type S. mutans NG8 (data not shown). These results support the hypothesis that the licT and bglP gene products are involved with the transport of aesculin into the S. mutans cell in the presence of glucose. The existence of a second transport system for {beta}-glucosides in S. mutans is also supported by the fact that aesculin transport is not totally eliminated in the mutant strains. However, it is apparent that the licT and bglP gene products are necessary for optimal levels of aesculin translocation into S. mutans.

Effect of the LicT protein on the bgl regulon
The S. mutans licT : : {Omega}-Kan2 strain, ALH201, was transformed with the reporter constructs containing the lacZ transcriptional fusions with the promoters from the bglP, bglC and bglA genes. The specific activity associated with each reporter construct, pALH187, pALH188 and pALH189, was determined by {beta}-galactosidase assays following growth in various media. The specific activity of the bglC promoter region was not significantly influenced by the absence of LicT (Fig. 4Down) when compared to its expression level in the wild-type host. However, the transcriptional activity of the bglP promoter is significantly lowered in the absence of LicT regardless of the carbohydrate examined (Fig. 4Down). When glucose is present as the sole carbon source, a fourfold decrease in activity of the bglP promoter occurs. In the presence of both glucose and aesculin, the bglP promoter is approximately eight times less active in the absence of LicT. When aesculin is the only carbohydrate available, the bglP promoter is approximately fourfold less active in the absence of LicT. In all cases, LicT appears to act as a positive regulator of the bglP locus. It is our assumption that LicT acts as an antiterminator, which is a positive regulator of the bglP transcription. While this locus is somewhat insensitive to glucose repression, it is interesting to note that the largest decrease in bglP transcriptional activity is in the licT-negative strain in the presence of both glucose and aesculin.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Transcriptional activity associated with the bgl regulon in wild-type S. mutans NG8 and in the licT : : {Omega}-Kan2 genetic background, ALH201. The transcriptional activities associated with the bglP promoter (a), the bglC promoter (b), and the bglA promoter (c) are depicted in the presence and in the absence of LicT. All cells were grown in CDM supplemented with 0·5 % of each carbohydrate prior to determination of {beta}-galactosidase activity. The results are the mean of at least 10 experiments and include the standard deviation. Solid bars, glucose; grey bars, glucose and aesculin; hatched bars, aesculin.

 
Interestingly, LicT apparently also regulates the expression of the bglA locus of S. mutans in a negative manner. As shown in Fig. 4Up, the expression of lacZ under the direction of the bglA promoter is significantly induced in the absence of LicT. This phenomenon is particularly evident when examining the transcriptional activity following growth of these strains in glucose alone. In the absence of LicT, the bglA promoter region is approximately 10 times more active than in the wild-type host strain. In the presence of glucose/aesculin or aesculin alone, the bglA gene is expressed at approximately three times the level of the wild-type strain. These results were totally unexpected. There is not a RAT site 5' to the bglA gene at which LicT would act. Thus, LicT would presumably regulate bglA by a mechanism other than antitermination. The molecular mechanism mediating the observed negative regulation is unknown at this time.

Effect of the BglP protein on the bglA gene
It was unclear if the increased transcriptional activity of the bglA promoter observed in the absence of LicT was due directly to the lack of LicT or due to a decrease in the level of BglP mediated by the licT : : {Omega}-Kan2 mutation. The bglA : : lacZ reporter construct (pALH189) was transformed into the bglP : : {Omega}-Kan2 strain ALH376 to generate strain ALH378. The data generated from {beta}-galactosidase assays performed on strain ALH378 following growth on various carbohydrate sources suggested that the absence of BglP does not induce the expression of the bglA promoter (Fig. 5Down) to above the wild-type expression level in a manner similar to the induction seen in the licT mutant strain. Thus, LicT must act as a negative regulator of the bglA locus. In the absence of BglP, the bglA promoter is expressed less than in the wild-type host strain. However, it is uncertain if this slight reduction in transcriptional activity of the bglA promoter is due to the absence of BglP or due to the decreased levels of intracellular aesculin that are mediated by the bglP : : {Omega}-Kan2 mutation. Regardless of the effect of BglP on bglA, these data suggest that LicT negatively regulates the expression of the bglA promoter while positively affecting the expression of the bglP promoter. It is unclear at this time if the effect of LicT on the bglA locus is direct or is mediated by another protein.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Transcriptional activity of the bglA promoter in the presence and absence of BglP. The results presented are the mean of at least five experiments and include the standard deviation. Solid bars, glucose; grey bars, glucose and aesculin; hatched bars, aesculin.

 
Effect of different carbohydrates on the bgl regulon
It is interesting that the bgl regulon of S. mutans is somewhat resistant to catabolite repression by glucose (not repressed to expression levels similar to those found following growth in glucose alone). To determine if the transcriptional activity of the bgl regulon was different in the presence of other carbohydrates, {beta}-galactosidase assays were performed on various S. mutans strains containing the bglP : : lacZ, bglC : : lacZ and bglA : : lacZ reporter fusion constructs grown in the presence of different carbohydrates. The carbohydrates fructose, lactose, mannitol and sucrose all significantly repressed the transcription of bglP to lower levels than following growth in glucose as the sole carbon source (data not shown). The bglP promoter activity (pALH187) was approximately one-third to one-half as active in the presence of these carbohydrates as compared to its activity in the presence of glucose. There were no significant changes in the transcriptional activity of the bglC (pALH188) and bglA (pALH189) promoters when they were tested following growth on these carbohydrates (data not shown).

These observations can potentially be explained by examining the products obtained from the hydrolysis of {beta}-glucosides, specifically aesculin. Hydrolysis of aesculin results in the formation of a glucose 6-phosphate molecule and a 6,7-dihydroxycoumarin molecule. It is hypothesized that if this glucose 6-phosphate, either intra- or extracellularly, or extracellular glucose, which is transported to form glucose 6-phosphate, tightly repressed or regulated the bglP gene, the subsequent transport of additional aesculin would be inhibited. This would effectively block further utilization of an available substrate that is present in the environment. Both extra- and intracellular glucose 6-phosphate has been shown in E. coli to induce catabolite repression (Hogema et al., 1998aDown, bDown). We propose that a similar phenomenon occurs in S. mutans. Therefore, bglP must be somewhat insensitive to catabolite repression by the hydrolysis product of the {beta}-glucoside substrate, glucose 6-phosphate, and must also be insensitive to repression by glucose, which generates glucose 6-phosphate following transport by the PTS.

This {beta}-glucoside-specific region of the S. mutans chromosome has been shown to contain several interesting features. These characteristics include a unique regulon structure and the fact that this bgl regulon is not totally repressed to non-induced levels by the presence of glucose. This region also contains an additional transcriptional regulator encoded by the bglC gene that partially controls the expression level of the bglA gene (Cote & Honeyman, 2002Down). This type of regulatory element is not found in any other {beta}-glucoside PTS described previously (Cote et al., 2000Down).

This report adds transcriptional antitermination to the list of regulatory mechanisms that may govern {beta}-glucoside utilization by S. mutans. We have shown that LicT is essential for optimal expression of the {beta}-glucoside-specific enzyme II of the PTS encoded by the bglP gene. Based upon analogy with other {beta}-glucoside PTSs, and our data, we believe that LicT positively regulates this locus at the level of transcription. It is proposed that LicT acts on the bglP locus via an antitermination mechanism of transcriptional regulation which occurs at the RAT site located upstream of the bglP gene. The binding of LicT to the RAT site would result in transcription through the putative terminator structure and allow the expression of the BglP protein, which translocates {beta}-glucosides such as aesculin into the cell. The proposal of an antitermination mechanism to control the expression of bglP is supported by the activation of a cryptic operon in E. coli by the presence of the S. mutans licT gene. Based upon the amino acid sequence similarity between the LicT protein of S. mutans and the E. coli BglG protein, and their corresponding RAT sites, we believe that the bglGFB operon is induced in E. coli by the expression of the S. mutans gene.

LicT also regulates the transcriptional activity of the bglA promoter in a negative manner. This is also a unique characteristic of this regulon. At this time it remains unclear why LicT would negatively regulate the expression of a gene that encodes the catabolic protein responsible for the breakdown of the translocated carbohydrate while positively regulating the gene encoding the protein responsible for transporting the carbohydrate. A possible explanation for this is that the second {beta}-glucosidase enzyme present in S. mutans also acts upon the substrates transported by BglP and that LicT does not regulate this locus. This dual regulatory role of LicT is very interesting and is currently under further study.


    ACKNOWLEDGEMENTS
 
This work was supported by United States Public Health Service grant DE10890 from the NIH/NIDCR to A. L. H. We would like to thank Joe Ferretti at the University of Oklahoma Health Sciences Center, Department of Microbiology and Immunology, and the Streptococcus mutans Genome Sequencing Project funded by a USPHS/NIH grant from the NIDCR for providing data prior to publication (Ajdic et al., 2002Down).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Ajdic, D., McShan, W. M., McLaughlin, R. E. & 16 other authors (2002). Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci U S A 99, 14434–14439.[Abstract/Free Full Text]

Alting-Mees, M. A. & Short, J. M. (1989). pBluescript II: gene mapping vectors. Nucleic Acids Res 17, 9494.[Free Full Text]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (2001). Current Protocols in Molecular Biology. Edited by V. B. Chanda. New York: Wiley.

Bardowski, J., Ehrlich, S. D. & Chopin, A. (1994). BglR protein, which belongs to the BglG family of transcriptional antiterminators, is involved in {beta}-glucoside utilization in Lactococcus lactis. J Bacteriol 176, 5681–5685.[Abstract/Free Full Text]

Brehm, K., Ripio, M. T., Kreft, J. & Vasquez-Boland, J. A. (1999). The bvr locus of Listeria monocytogenes mediates virulence gene repression by {beta}-glucosides. J Bacteriol 181, 5024–5032.[Abstract/Free Full Text]

Brown, G. D. & Thomson, J. A. (1998). Isolation and characterisation of an aryl-{beta}-D-glucoside uptake and utilisation system (abg) from the gram-positive ruminal Clostridium species C. longisporum. Mol Gen Genet 257, 213–218.[CrossRef][Medline]

Chang, A. C. & Cohen, S. N. (1978). Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134, 1141–1156.[Abstract/Free Full Text]

Cote, C. K. & Honeyman, A. L. (2002). The transcriptional regulation of the Streptococcus mutans bgl regulon. Oral Microbiol Immunol 17, 1–8.[CrossRef][Medline]

Cote, C. K., Cvitkovitch, D., Bleiweis, A. S. & Honeyman, A. L. (2000). A novel {beta}-glucoside-specific PTS locus from Streptococcus mutans that is not inhibited by glucose. Microbiology 146, 1555–1563.[Abstract/Free Full Text]

Cvitkovich, D. G., Gutierrez, J. A., Crowley, P. J., Wojciechowski, L., Hillman, J. D. & Bleiweis, A. S. (1998). Tn917 transposon mutagenesis and marker rescue of interrupted genes of Streptococcus mutans. Methods Cell Sci 20, 1–12.

De Vos, W. M. (1987). Gene cloning and expression in lactic streptococci. FEMS Microbiol Rev 46, 281–295.[CrossRef]

Debarbouille, M., Arnaud, M., Fouet, A., Klier, A. & Rapoport, G. (1990). The sacT gene regulating the sacPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators. J Bacteriol 172, 3966–3973.[Abstract/Free Full Text]

Dower, W. J. (1990). Electroporation of bacteria: a general approach to genetic transformation. In Genetic Engineering – Principles and Methods, pp. 275–296. New York: Plenum.

el Hassouni, M., Chippaux, M. & Barras, F. (1990). Analysis of the Erwinia chrysanthemi arb genes, which mediate metabolism of aromatic {beta}-glucosides. J Bacteriol 172, 6261–6267.[Abstract/Free Full Text]

el Hassouni, M., Henrissat, B., Chippaux, M. & Barras, F. (1992). Nucleotide sequences of the arb genes, which control {beta}-glucoside utilization in Erwinia chrysanthemi: comparison with the Escherichia coli bgl operon and evidence for a new {beta}-glycohydrolase family including enzymes from eubacteria, archaebacteria, and humans. J Bacteriol 174, 765–777.[Abstract/Free Full Text]

Franz, C. M., Worobo, R. W., Quadri, L. E., Schillinger, U., Holzapfel, W. H., Vederas, J. C. & Stiles, M. E. (1999). Atypical genetic locus associated with constitutive production of enterocin B by Enterococcus faecium BFE 900. Appl Environ Microbiol 65, 2170–2178.[Abstract/Free Full Text]

Hall, B. G. & Xu, L. (1992). Nucleotide sequence, function, activation, and evolution of the cryptic asc operon of Escherichia coli K12. Mol Biol Evol 9, 688–706.[Abstract]

Hogema, B. M., Arents, J. C., Bader, R., Eijkemans, K., Inada, T., Aiba, H. & Postma, P. W. (1998a). Inducer exclusion by glucose 6-phosphate in Escherichia coli. Mol Microbiol 28, 755–765.[CrossRef][Medline]

Hogema, B. M., Arents, J. C., Bader, R., Eijkemans, K., Yoshida, H., Takahashi, H., Aiba, H. & Postma, P. W. (1998b). Inducer exclusion in Escherichia coli by non-PTS substrates: the role of the PEP to pyruvate ratio in determining the phosphorylation state of enzyme IIAGlc. Mol Microbiol 30, 487–498.[CrossRef][Medline]

Honeyman, A. L., Cote, C. K., & Curtiss, R., III (2002). Construction of transcriptional and translational lacZ gene reporter plasmids for use in Streptococcus mutans. J Microbiol Methods 49, 163–171.[CrossRef][Medline]

Le Coq, D., Lindner, C., Kruger, S., Steinmetz, M. & Stulke, J. (1995). New {beta}-glucoside (bgl) genes in Bacillus subtilis: the bglP gene product has both transport and regulatory functions similar to those of BglF, its Escherichia coli homolog. J Bacteriol 177, 1527–1535.[Abstract/Free Full Text]

Li, Y. & Ferenci, T. (1996). The Bacillus stearothermophilus NUB36 surA gene encodes a thermophilic sucrase related to Bacillus subtilis SacA. Microbiology 142, 1651–1657.[Abstract/Free Full Text]

Macrina, F. L., Tobian, J. A., Jones, K. R., Evans, R. P. & Clewell, D. B. (1982). A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis. Gene 19, 345–353.[CrossRef][Medline]

Manoil, C. & Beckwith, J. (1985). TnphoA: a transposon probe for protein export signals. Proc Natl Acad Sci U S A 82, 8129–8133.[Abstract/Free Full Text]

Marasco, R., Salatiello, I., De Felice, M. & Sacco, M. (2000). A physical and functional analysis of the newly-identified bglGPT operon of Lactobacillus plantarum. FEMS Microbiol Lett 186, 269–273.[CrossRef][Medline]

Moran, C. P., Jr, Lang, N., LeGrice, S. F., Lee, G., Stephens, M., Sonenshein, A. L., Pero, J. & Losick, R. (1982). Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol Gen Genet 186, 339–346.[CrossRef][Medline]

Murchison, H. H., Barrett, J. F., Cardineau, G. A. & Curtiss, R., III (1986). Transformation of Streptococcus mutans with chromosomal and shuttle plasmid (pYA629) DNAs. Infect Immun 54, 273–282.[Abstract/Free Full Text]

Perez-Casal, J., Caparon, M. G. & Scott, J. R. (1991). Mry, a trans-acting positive regulator of the M protein gene of Streptococcus pyogenes with similarity to the receptor proteins of two-component regulatory systems. J Bacteriol 173, 2617–2624.[Abstract/Free Full Text]

Postma, P. W. & Lengeler, J. W. (1985). Phosphoenolpyruvate : carbohydrate phosphotransferase system of bacteria. Microbiol Rev 49, 232–269.[Free Full Text]

Reynolds, A. E., Felton, J. & Wright, A. (1981). Insertion of DNA activates the cryptic bgl operon in E. coli K12. Nature 293, 625–629.[CrossRef][Medline]

Rutberg, B. (1997). Antitermination of transcription of catabolic operons. Mol Microbiol 23, 413–421.[CrossRef][Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schnetz, K., Toloczyki, C. & Rak, B. (1987). {beta}-Glucoside (bgl) operon of Escherichia coli K-12: nucleotide sequence, genetic organization, and possible evolutionary relationship to regulatory components of two Bacillus subtilis genes. J Bacteriol 169, 2579–2590.[Abstract/Free Full Text]

Schnetz, K., Stulke, J., Gertz, S., Kruger, S., Krieg, M., Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator protein of the BglG family. J Bacteriol 178, 1971–1979.[Abstract/Free Full Text]

Tangney, M. & Mitchell, W. J. (2000). Analysis of a catabolic operon for sucrose transport and metabolism in Clostridium acetobutylicum. J Mol Microbiol Biotechnol 2, 71–80.[Medline]

Tobisch, S., Glaser, P., Kruger, S. & Hecker, M. (1997). Identification and characterization of a new {beta}-glucoside utilization system in Bacillus subtilis. J Bacteriol 179, 496–506.[Abstract/Free Full Text]

van de Rijn, I. & Kessler, R. E. (1980). Growth characteristics of group A streptococci in a new chemically defined medium. Infect Immun 27, 444–448.[Abstract/Free Full Text]

Yoshida, K., Shindo, K., Sano, H., Seki, S., Fujimura, M., Yanai, N., Miwa, Y. & Fujita, Y. (1996). Sequencing of a 65 kb region of the Bacillus subtilis genome containing the lic and cel loci, and creation of a 177 kb contig covering the gnt–sacXY region. Microbiology 142, 3113–3123.[Abstract/Free Full Text]

Zukowski, M. M., Miller, L., Cosgwell, P., Chen, K., Aymerich, S. & Steinmetz, M. (1990). Nucleotide sequence of the sacS locus of Bacillus subtilis reveals the presence of two regulatory genes. Gene 90, 153–155.[CrossRef][Medline]

Received 22 October 2002; revised 20 January 2003; accepted 24 January 2003.


This article has been cited by other articles:


Home page
Microbiol. Mol. Biol. Rev.Home page
J. Deutscher, C. Francke, and P. W. Postma
How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 939 - 1031.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. Cochu, D. Roy, K. Vaillancourt, J.-D. LeMay, I. Casabon, M. Frenette, S. Moineau, and C. Vadeboncoeur
The Doubly Phosphorylated Form of HPr, HPr(Ser-P)(His~P), Is Abundant in Exponentially Growing Cells of Streptococcus thermophilus and Phosphorylates the Lactose Transporter LacS as Efficiently as HPr(His~P)
Appl. Envir. Microbiol., March 1, 2005; 71(3): 1364 - 1372.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. O. Kilic, L. Tao, Y. Zhang, Y. Lei, A. Khammanivong, and M. C. Herzberg
Involvement of Streptococcus gordonii Beta-Glucoside Metabolism Systems in Adhesion, Biofilm Formation, and In Vivo Gene Expression
J. Bacteriol., July 1, 2004; 186(13): 4246 - 4253.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cote, C. K.
Right arrow Articles by Honeyman, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cote, C. K.
Right arrow Articles by Honeyman, A. L.
Agricola
Right arrow Articles by Cote, C. K.
Right arrow Articles by Honeyman, A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2003 Society for General Microbiology.