Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 149 (2003), 1569-1580; DOI  10.1099/mic.0.26053-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kotrba, P.
Right arrow Articles by Yukawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kotrba, P.
Right arrow Articles by Yukawa, H.
Agricola
Right arrow Articles by Kotrba, P.
Right arrow Articles by Yukawa, H.
Microbiology 149 (2003), 1569-1580; DOI  10.1099/mic.0.26053-0
© 2003 Society for General Microbiology

A single V317A or V317M substitution in Enzyme II of a newly identified {beta}-glucoside phosphotransferase and utilization system of Corynebacterium glutamicum R extends its specificity towards cellobiose

Pavel Kotrba{dagger}, Masayuki Inui and Hideaki Yukawa

Research Institute of Innovative Technology for the Earth, 9-2 Kizugawadai, Kizu, Soraku, Kyoto 619-0292, Japan

Correspondence
Hideaki Yukawa
mmg-lab{at}rite.or.jp


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A catabolic system involved in the utilization of {beta}-glucosides in Corynebacterium glutamicum R and its spontaneous mutant variants allowing uptake of cellobiose were investigated. The system comprises a {beta}-glucoside-specific Enzyme IIBCA component (gene bglF) of the phosphotransferase system (PTS), a phospho-{beta}-glucosidase (bglA) and an antiterminator protein (bglG) from the BglG/SacY family of transcription regulators. The results suggest that transcription antitermination is involved in control of induction and carbon catabolite repression of bgl genes, which presumably form an operon. Functional analysis of the bglF and bglA products revealed that they are simultaneously required for uptake, phosphorylation and breakdown of methyl {beta}-glucoside, salicin and arbutin. Although cellobiose is not normally a substrate for BglF permease and is not utilized by C. glutamicum R, cellobiose-utilizing mutants can be obtained. The mutation responsible was mapped to the bgl locus and sequenced, and point mutations were found in codon 317 of bglF. These led to substitutions V317A and/or V317M near the putative PTS active-site H313 in the membrane-spanning IIC domain of BglF and allowed BglF to act on cellobiose. Such results strengthen the evidence that the IIC domains can be regarded as selectivity filters of the PTS.


Abbreviations: PEP, phosphoenolpyruvate; PNPG, p-nitrophenyl {beta}-D-1,4-glucopyranoside; PRD, PTS regulatory domain; PTS, phosphotransferase system; RAT, ribonucleic antiterminator

The GenBank accession number for the sequence reported in this paper is AF508972.

{dagger}Present address: Department of Biochemistry and Microbiology, Institute of Chemical Technology Prague, Technická 3, 166 28 Prague, Czech Republic.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The phosphoenolpyruvate (PEP) : carbohydrate phosphotransferase system (PTS) in many bacteria catalyses the import of several sugars and hexitols. The system consists of two general cytoplasmic proteins named Enzyme I and HPr that are common to the transport of most carbohydrates, and a range of carbohydrate-specific Enzymes II (Postma et al., 1993Down). The Enzymes II are modular proteins composed of cytoplasmic IIA and IIB, and a membrane-spanning IIC (sometimes also IID), which occur either as domains in a single polypeptide or as subunits of a complex. For carbohydrate transport, Enzyme I autophosphorylates from PEP and the phosphate is sequentially transferred to HPr, IIA, IIB and then to an incoming carbohydrate molecule during its translocation by IIC. The presence of general as well as glucose-, mannose-, fructose- and sucrose-specific components of the PTS has been demonstrated in the high-G+C Gram-positive soil bacterium Corynebacterium glutamicum in several biochemical and genetic studies (Mori & Shiio, 1987Down; Malin & Bourd, 1991Down; Lee et al., 1994Down; Dominguez et al., 1998Down; Parche et al., 2001Down). Non-pathogenic corynebacteria, such as C. glutamicum strains ATCC 13032 or ATCC 13869, have a long history of commercial use as producers of various amino acids, notably lysine and glutamic acid (Kinoshita, 1985Down; Lessard et al., 1999Down). Another strain, C. glutamicum R, recently received our attention as it provided high yields of the plastics precursors lactate and succinate. By using a genetic approach employing inactivation of the ptsI gene encoding Enzyme I, we showed that for this bacterium, PTS represents the dominant sugar-uptake system (Kotrba et al., 2001Down). A distinct feature of C. glutamicum R is that, unlike strains ATCC 13032 or ATCC 13869, it is capable of PTS-dependent utilization of methyl {beta}-glucoside and the natural aryl {beta}-glucosides salicin and arbutin (Kotrba et al., 2001Down). Moreover, C. glutamicum R may adapt to growth on the 1,4-{beta}-glucoside cellobiose, which could play an important role in the fermentation of hydrolysed cellulosic materials.

The {beta}-glucoside utilization pathways that rely upon the PTS for carbohydrate uptake have been characterized in several bacteria. They include {beta}-glucoside-specific Enzymes IIBgl and associated activities encoded within operons arbGFB from Erwinia chrysanthemi (el Hassouni et al., 1992Down), abgGFA from Clostridium longisporum (Brown et al., 1998Down), bglGPT from Lactobacillus plantarum (Marasco et al., 2000Down), bglPH from Bacillus subtilis (Krüger & Hecker, 1995Down), casRAB from Klebsiella oxytoca (Lai et al., 1997Down), bvrABC from Listeria monocytogenes (Brehm et al., 1999Down), and cryptic bglGFB from Escherichia coli (Schnetz et al., 1987Down). Expression of these operons is controlled by multi-domain antiterminators of the BglG/SacY family (Stülke et al., 1998Down), which, in active dimeric form, bind to nascent mRNA and prevent premature transcription termination. The activity of antiterminator proteins is controlled by the PTS in a substrate-dependent manner via antagonistic phosphorylations at two PTS regulatory domains (PRDs) (Stülke et al., 1998Down; Görke & Rak, 1999Down). Only a few of the permeases encoded by the above operons, namely the casA and bvrB products, have been reported to facilitate transport of cellobiose (Lai et al., 1997Down; Brehm et al., 1999Down).

It is believed that the IIC component of PTS permease is responsible for selective binding and transport of the carbohydrate. As yet unknown are the amino acid residues responsible for specific recognition of the substrate to be translocated and phosphorylated by the PTS permease. Mutations in the IIC domains of glucose- and mannitol-specific Enzymes II from E. coli that abolished sugar binding (Saraceni-Richards et al., 1997Down) or allowed facilitated diffusion of substrate without phosphorylation (Ruijter et al., 1992Down) and/or its phosphorylation without transport (Buhr et al., 1992Down) are known, however. Several point mutations that extend the substrate specificity of glucose-specific IICBGlc of E. coli were reported recently. These mutations are scattered along the IIC sequence and are believed to induce conformational changes in IICBGlc, which then promote facilitated diffusion of ribose or fructose (Oh et al., 1999Down; Kornberg et al., 2000Down; Notley-McRobb & Ferenci, 2000Down). Other amino acid exchanges allowed IICBGlc-dependent uptake of mannitol (Begley et al., 1996Down), glucosamine and mannose (Plumbridge, 2000Down; Notley-McRobb & Ferenci, 2000Down; Zeppenfeld et al., 2000Down), which normally are not, or are poorly, transported by this PTS.

In the present study we describe a {beta}-glucoside phosphotransferase and utilization system from C. glutamicum R, which we believe represents the first example of such a system reported from Actinobacteria. Specifically, it comprises three genes, bglF, bglA and bglG, encoding PTS permease, {beta}-glucosidase and the positive transcription regulator, respectively. We demonstrate the potential of this system in the utilization of {beta}-glucosides and its repression exerted by glucose. We further show that a single amino acid substitution is required for activity of BglF on cellobiose in adaptive cellobiose-utilizing mutants of C. glutamicum R.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
C. glutamicum strains and culture conditions.
Strains used in this study are described in Table 1Down. C. glutamicum was routinely grown at 33 °C in AR medium (Kurusu et al., 1990Down) with glucose or acetate added at 2 % (w/v). Where appropriate, media contained 50 µg kanamycin (Km) ml-1 or 5 µg chloramphenicol (Cm) ml-1. AR medium without yeast extract (AA medium) and without both yeast extract and Casamino acids (minimal BT medium) were used for sugar utilization studies. To obtain cellobiose-utilizing (Cel+) mutants, 108–1010 viable cells were plated on BT medium supplemented with 0·5 % (w/v) cellobiose. The cells from single colonies of 0·5–1·0 mm i.d., which typically appeared after 7–10 days of incubation at 33 °C, were further cultivated in the same medium.


View this table:
[in this window]
[in a new window]
 
Table 1. C. glutamicum strains used in this study

 
DNA techniques.
Routine recombinant DNA manipulations and analyses were performed according to standard protocols (Sambrook et al., 1989Down). Electroporation was used to transform C. glutamicum with plasmid DNA (Vertès et al., 1993Down). Chromosomal DNA was isolated by the phenol extraction method described by Sambrook et al. (1989)Down and plasmid DNA was isolated by using the Qiagen Plasmid Midi Kit. C. glutamicum was incubated with 10 mg lysozyme ml-1 at 37 °C for 90 min prior to alkaline lysis. DNA fragments from chromosomal or plasmid DNA were amplified with ExTaq polymerase (Takara) and specific primers by PCR following appropriate protocols (Innis et al., 1990Down). The PCR products were purified by using the PCR Purification Kit from Qiagen, inserted into a suitable plasmid (see below) and sequenced.

The DNA sequences were determined on both strands of the linear template by the dideoxy chain-termination method using the BigDye Terminator Cycle Sequencing kit in the presence of 5 % dimethyl sulfoxide and by use of the ABI Prism 377 DNA sequencer (Applied Biosystems–Perkin-Elmer). The DNA sequences were analysed by the Genetyx version 4.0 program (Software Development, Japan), and database searches were performed using the BLAST server of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov).

Isolation of bgl genes and construction of plasmids.
The C. glutamicum R {lambda} FIX library (Kotrba et al., 2001Down) was screened by plaque hybridization using a probe obtained in PCR with degenerate primers. To do this, the primers 5'-ACICAYTGYGCIACIMGIYTIMG-3' (PBG1, plus strand, [I, inosine; Y, T or C; M, A or C]) and 5'-GGIRTIACIGARCCIGC-3' (PBG8, minus strand [R, A or G]) were designed for amino acid sequences of highly conserved regions of the IIB (THCATRLR) and IIC (G[IV]TEPA) domains of {beta}-glucoside-specific Enzymes II. The amplified DNA fragment was cloned in pGEM-T (Promega), sequenced and labelled with digoxigenin-dUTP (DIG), which was later detected by using the DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to the protocol supplied. DNA from positive phages was isolated by using the Lambda Midi Kit (Qiagen), digested with SalI, and the resulting fragments of C. glutamicum DNA were subcloned in pUC118 (Takara). The sequences at the 5' and 3' ends of the cloned fragments were determined with the vector primers and fragments fr-FA and fr-AG (Fig. 1DownA) in plasmids pUC-SB2 and pUC-SB3, respectively, by using a primer-walking strategy.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 1. Organization of the 5·8 kb DNA region containing bgl genes from C. glutamicum R (GenBank accession number AF508972). (A) Physical map of cloned DNA fragments. The open reading frames designated bglF, bglA and bglG, and encoded protein activities, are indicated. The positions of the putative promoter (Pbgl), transcription terminators (hairpin-like symbols) and RAT are shown. The bgl : : npt mutants were constructed by allelic exchange by using a pHSG396 derivative harbouring fr-FA in which an ApaLI fragment was replaced with a Kmr cassette and homologous recombination. Abbreviations: S, SalI (S{lambda}, SalI originating from {lambda} phage and used to clone fr-AG); P, PstI; B, BamHI; A, ApaLI. (B) Nucleotide sequence of DNA upstream of the bglF. Potential -35 and -10 promoter consensus sequences and ribosome-binding site (RBS) are underlined. Possible transcription terminator sequences are marked with arrows. The putative RAT sequence is boxed. (C) Comparative analysis of RAT sequences. Multiple alignment and consensus in predicted secondary structures of the putative RAT from upstream of bglF of C. glutamicum R with RAT sequences situated upstream of B. subtilis (Bsu) licT (Schnetz et al., 1996Down), bglP (Krüger & Hecker, 1995Down) and sacB (Crutz & Steinmetz, 1992Down), E. coli (Eco) bglG and bglF (Schnetz et al., 1987Down), and C. longisporum (Clo) abgF (Brown & Thomson, 1998Down). Highly conserved nucleotides are boxed and a secondary-structure model of the RAT preceding bgl is shown to the right.

 
The continuous DNA harbouring bglFAG genes was restored in plasmid pRbglFAG by consecutively inserting the 3·2 kb PstI/SalI fragment of fr-FA and the entire 1·7 kb fr-AG (SalI) fragment into the PstI/SalI restriction sites of plasmid pCRA1. Plasmid pCRA1 is an E. coliCorynebacterium spp. shuttle vector from our laboratory collection. It was derived from pHSG298 (Takara) and coryneform plasmid pBL1 (Goyal et al., 1996Down) and confers Cm resistance. The bglG deletion plasmid pRbglFA was created by inserting 3·75 kb PCR product containing the promoter region and bglFA genes into BamHI/BglII restriction sites of pCRA1. The PCR product was prepared from pRbglFAG with primers RBF (AAGGATCCTGCAGTAAAAGCTAG [plus strand; BamHI site underlined]) and RBB (CTAAGATCTACCGAGGTGACACCTCC [minus strand; BglII site underlined]). Plasmid pCbglF was obtained by inserting a 1·9 kb PCR product containing the promoterless bglF coding sequence with preceding ribosome-binding site (RBS) into pCRA1 digested with KpnI and BamHI. The PCR was carried out with pRbglFAG as a template and primers FKF (5'-TACGGTACCGGTAGATGCACACGAGC-3' [plus strand]) and FBB (5'-TTGGATCCTTAAGGTTCCATACGCATC-3' [minus strand]), which introduced artificial KpnI and BamHI restriction sites (underlined), respectively, facilitating cloning. The PCR with the pRbglFAG template and primers ABF (5'-GATAGATCTTAAAAGGTTTCATCGC-3' [plus strand]) and ABB (5'-TTGGATCCACCGAGGTGACACCTCC-3' [minus strand]) provided a 1·5 kb product which contained bglA with RBS and BglII and BamHI restriction sites (underlined in primers) engineered at the 3' and 5' ends, respectively. This DNA fragment was ligated into BglII/BamHI restriction sites of pCRA1, giving rise to plasmid pCbglA. A 3·4 kb DNA fragment containing the promoterless bglFA cluster produced from pRbglFAG with primers FBF (5'-GATAGATCTGGTAGATGCACACGAGC-3' [plus strand; BglII restriction site underlined]) and ABB (see above) was cloned into pCRA1 as a fragment bordered with BglII and BamHI sites at the 3' and 5' ends, respectively. The resulting plasmid was pCbglFA.

Construction of bgl replacement mutants.
The bgl mutants were constructed by replacing the bgl promoter region and 1·6 kb of bglF with a Kmr cassette (npt) using homologous recombination. To achieve this, the 4·1 kb fr-FA (SalI) was first inserted into plasmid pHSG396 (Takara), which confers Cm resistance (Cmr) and does not replicate in C. glutamicum. The resulting plasmid, pHSG-SB2, was then digested with ApaLI to liberate a 1·9 kb DNA fragment from fr-FA and it was replaced with npt (Fig. 1AUp). The 1·2 kb npt gene bordered with ApaLI was obtained by PCR with primers NAF (5'-CATGTGCACGGAAAGCCACGTTGTGTC-3' [plus strand]) and NAB (5'-CATGTGCACTGAGGTCTGCCTCGTGAAG-3' [minus strand]) and pUC4K (Amersham Pharmacia Biotech) as a template (the ApaLI sites are underlined). The resulting plasmid, pDbglPF, with npt reading in the opposite direction to the former bglFAG was electroporated into C. glutamicum R and R-CEL and integrants were selected on AR plates with Km. The bgl : : npt strains resulting from two simultaneous crossover events were distinguished from Cmr Kmr integrants in which the pDbglPF integrated via a Campbell-like mechanism as those of Cms Kmr phenotype. Correct insertion of npt in selected strains was confirmed by Southern hybridization (not shown).

Analyses of mRNA by dot-blotting.
Total RNA was isolated from cells growing exponentially (OD590 about 3) in AA medium supplemented with 0·5 % carbon source by using the Qiagen RNA Mini Kit. Equal amounts of total RNA (1·5 µg each) in 10x SSC (1·5 M NaCl, 0·15 M sodium citrate, pH 7·0) were denatured at 90 °C for 10 min and spotted onto nylon membranes soaked in 10x SSC. After baking at 80 °C for 2 h, the membranes were prehybridized for 2 h, hybridized overnight at 42 °C and then washed at high stringency as described by Sambrook et al. (1989)Down. The 1·9 kb DNA fragment covering bglF and the 1·5 kb fragment covering bglA were labelled with digoxigenin-dUTP (Roche Diagnostics) by PCR with primers ABF plus ABB and FKF plus FBB (see above), respectively, and used as a mixed hybridization probe. Detection was performed by using the Gene Images detection kit (Amersham Pharmacia Biotech) according to the recommended protocol. The signal was scanned in a luminescent image analyser model LAS-1000 CH (Fuji).

Analysis of sugar in culture media and in vitro assay of PTS activity.
For sugar uptake studies, the culture samples were removed at stated intervals and filtered through 0·2 µm filters (Millipore). Sugar concentrations were determined by HPLC using the model 8020 apparatus from TOSOH (Japan) with a 600 mm OA PAK-A TSK-GEL column (TOSOH). The chromatography was performed at 40 °C with 0·75 mM H2SO4 as a mobile phase (1·0 ml min-1) and sugars were detected with a refraction index detector.

The combined {beta}-glucoside phosphorylation and phospho-{beta}-glucosidase activities were determined essentially by the method of Kricker & Hall (1987)Down. The cells from a culture that had reached the desired OD590 were harvested by centrifugation (6000 g, 5 min, 4 °C), washed in ice-cold 50 mM NaKHPO4 buffer (pH 7·2) and resuspended in the same buffer to an OD590 of 200. Cells were disrupted for 2 min with 0·1 mm Al2O3 beads in a Mini-Beadbeater device (BioSpec) set to the maximum speed. Crude cell-free extracts were assayed at 33 °C in 50 mM NaKHPO4 buffer (pH 7·2) containing 5 mM MgCl2, 2 mM p-nitrophenyl {beta}-D-1,4-glucopyranoside (PNPG) and 2 mM PEP. The unit of activity was defined as the amount (pmol) of p-nitrophenol released from PNPG per second per mg of total protein. Formation of p-nitrophenol was monitored by measuring the A410 at 30 s intervals in a period of 15 min. The protein content was determined by using the Bradford Reagent Kit (Bio-Rad).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of bgl genes of C. glutamicum R
Alignments of {beta}-glucoside-specific PTS permeases from different bacteria revealed several conserved regions (Fig. 2Down). Two of these conserved regions were used to design degenerate primers PBG1 and PBG8 (see Methods). These were used in a PCR with chromosomal DNA from C. glutamicum R as a template in a trial to amplify a portion of sequence encoding the respective permease. The reaction yielded a product of the expected size of 1·1 kb. Analysis of the polypeptide deduced from the nucleotide sequence suggested that it originated from a gene encoding {beta}-glucoside-specific Enzyme IIBgl. This PCR product was labelled and used to screen the C. glutamicum R {lambda} FIX library by plaque hybridization.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2. Comparative analysis of the predicted bglF product and its mutant variants from C. glutamicum R. (A) Diagrammatic representation of IIBCABgl (BglF) of C. glutamicum R. The numbers at the extremes of the putative IIC domain represent the first and last amino acid residues of the putative transmembrane region. Residues corresponding by homology to those important for phosphoryl transfer (Schnetz et al., 1990Down) and the putative disaccharide-binding site (Lai et al., 1997Down) with an important glutamate residue (Saraceni-Richards & Jacobson, 1997Down) are indicated. The regions around conserved residues are shown together with consensus sequence derived from 10 {beta}-glucoside-specific PTS permeases of the glucose–glucoside family. Residues conserved in at least nine permeases are shown in capital letters whilst those found in more than five permeases are shown in small letters. Indicated primers PBG1 and PBG8 were used to clone bgl genes. (B) Consensus around the site of bglF accumulating mutations. Highly conserved residues are boxed. An arrowhead points to the V317 of BglF that was a target for adaptive mutations, which resulted in V317A (BglFA) and V317M (BglFM). IIBCA proteins: BglF (Cgl), C. glutamicum R; BglF (Eco), E. coli (Schnetz et al., 1987Down); BglP (Lpl), L. plantarum (Marasco et al., 2000Down); BglP (Smu), S. mutans (Cote et al., 2000Down); AbgF (Clo), C. longisporum (Brown & Thomson, 1998Down); ArbF (Ech), E. chrysanthemi (el Hassouni et al., 1992Down); BglP (Bsu), B. subtilis (Krüger & Hecker, 1995Down); BvrB (Lmo), L. monocytogenes (Brehm et al., 1999Down); CasA (Kox), K. oxytoca (Lai et al., 1997Down). IICB protein: AscF (Eco), E. coli (Hall & Xu, 1992Down).

 
A 4·1 kb SalI fragment (fr-FA) from a positive phage hybridized to the probe (data not shown) and analysis of its nucleotide sequence revealed the presence of one complete open reading frame, orf2, and partial orf1 and orf3 at the 5' and 3' ends, respectively. Based on the similarity of the deduced polypeptides with known proteins, the missing part from orf3 was found on the 1·7 kb SalI fragment (fr-AG) from the same phage, where it was followed by orf4 (Fig. 1AUp). Notable similarity of translated orf2, orf3 and orf4 with proteins associated with transport and utilization of {beta}-glucosides (see below) suggested their designation as bgl genes. The polypeptide predicted from orf1 displayed 50 % similarity to periplasmic binding protein involved in iron transport in E. coli (Elkins & Earhart, 1989Down).

Identification of bgl genes by analysis of DNA sequence and homology search
Analysis of the nucleotide sequence revealed that the coding sequences of all three bgl genes, named bglF (orf2), bglA (orf3) and bglG (orf4), were in the same translational reading frame. The DNA sequence spanning approximately 200 bp upstream of bglF contains several characteristic elements (Fig. 1BUp). The hexamers TTGCTT and CATAAT separated by 18 nucleotides corresponded well with consensus -35 and -10 promoter sequences, respectively. Downstream from the putative promoter was found a region of dyad symmetry with the potential to form a stable RNA stem–loop structure (-28·9 kcal mol-1, -120·9 kJ mol-1) which, followed by a T-rich stretch of nucleotides, resembled a factor-independent transcription terminator. Partially overlapping this region at the 5' end, a putative ribonucleic antiterminator (RAT) sequence was recognized. A comparison of this sequence with known RAT sequences (Fig. 1CUp), and its position relative to the putative terminator, suggested a strong relationship of this element to regulatory features characteristic of operons controlled by antiterminators of the BglG/SacY family (Stülke et al., 1998Down).

The choice of the translational start codons for putative bgl products was based on the position of a potential ribosome-binding site and on similarities to known proteins. The first bgl gene, bglF, encoded a 64·8 kDa protein, 618 amino acids long. It was highly similar to other Enzymes IIBgl containing IIA, IIB and IIC domains fused in one polypeptide. The highest scores found were with BglF from E. coli (36 % identity and 50 % similarity: Schnetz et al., 1987Down), BglP from L. plantarum (35 % identity and 52 % similarity: Marasco et al., 2000Down) and CasA from K. oxytoca (33 % identity and 51 % similarity: Lai et al., 1997Down). The observed homologies and pattern of hydrophobicity (not shown) suggested a central membrane-spanning IIC domain flanked by hydrophilic IIB and IIA domains located in the N terminus and C terminus of BglF, respectively (Fig. 2AUp).

The translational start of the protein encoded by bglA is located 60 bp downstream from bglF (Fig. 1AUp). The deduced 52·7 kDa BglA of 469 amino acids has, throughout the full length of the protein, extensive homology to phospho-{beta}-glucosidases, having 65 %, 64 % and 57 % identity to BglA from Streptococcus mutans (Cote et al., 2000Down), AbgA from C. longisporum (Brown et al., 1998Down) and BglB from E. coli (Schnetz et al., 1987Down), respectively.

Assuming that the GTG codon positioned 39 bp downstream from bglA represents a translation initiation codon, a protein of 289 amino acids could be deduced from bglG. The predicted 31·7 kDa protein shares 53 % similarity with LicT from B. subtilis (Schnetz et al., 1996Down) and BglG from E. coli (Schnetz et al., 1987Down), the transcriptional antiterminators belonging to the BglG/SacY family. The similarities were particularly significant for three distinct regions. The first 56 amino acid residues resembled the so-called co-antiterminator RNA binding domain, which was 75 % similar to that of LicT from B. subtilis (Schnetz et al., 1996Down). Two other regions (amino acids 93–169 and 208–280) might, by similarity, represent duplicated PTS regulatory domains PRD-I and II (Stülke et al., 1998Down).

The presence of a single promoter preceding the bgl genes which encode closely related activities, and the gene spacing and putative regulatory features, which are similar to those of other PTSs, suggested that bglFAG represents the {beta}-glucoside PTS operon. The inverted repeats with a putative stable RNA stem–loop structure (-18·91 kcal mol-1, 79·12 kJ mol-1) located immediately (9 bp) downstream from the bglG translation termination codon may allow factor-independent termination of the putative tricistronic transcript.

Induction of bgl genes and utilization of different sugars in parental strains and bgl disruptant mutants
The induction of bglF and bglA was explored by using hybridization of total RNA from cells grown on various carbon sources with probes corresponding to these genes (Fig. 3DownA). The in vivo bgl transcripts were detected in C. glutamicum R grown on methyl {beta}-glucoside, salicin and arbutin but not on acetate, glucose or cellobiose. Cellobiose induced transcription of bgl genes only in an adaptive Cel+ mutant of C. glutamicum R, named R-CEL (Table 1Up), which is capable of cellobiose utilization.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. Induction of bgl-specific mRNA synthesis in vivo and sugar utilization in C. glutamicum strains. (A) Dot-blot analyses of RNA isolated from cells grown in AA medium with 0·5 % of the carbon sources indicated. A 1·5 µg sample of total RNA isolated from cells in the mid-exponential phase of growth was dot-blotted and probed with the DNA fragments covering bglF and bglA genes (x, no RNA spotted). (B, C) Growth and sugar utilization by parental and bgl-disruptant strains of C. glutamicum. Growth of the cultures in minimal BT medium (as OD590; top of each panel) and consumption of simultaneously supplemented carbohydrates (bottom) were monitored throughout growth. (B) C. glutamicum R (open symbols) and R(bgl : : npt) (solid symbols) grown in medium containing 0·2 % salicin (triangles) and 0·3 % glucose (circles). (C) C. glutamicum R-CEL (open symbols) and R-CEL(bgl : : npt) (solid symbols) grown in medium containing 0·2 % cellobiose (triangles) and 0·3 % glucose (circles).

 
We further assessed the significance of the bglFAG system in the {beta}-glucoside PTS through its disruption by replacement recombination. For this purpose, the plasmid pDbglPF was constructed, which contained the Kmr npt gene flanked by DNA regions located upstream and downstream from bglF (see Methods). The integration of npt from plasmid pDbglPF into the chromosomes of C. glutamicum R and R-CEL (Fig. 1AUp) via a double crossover event yielded strains R(bgl : : npt) and R-CEL(bgl : : npt), respectively. In spite of the apparent absence of salicin-inducible bglFA transcripts in R(bgl : : npt) (Fig. 3AUp), the pattern of salicin consumption from minimal BT medium supplemented additionally with glucose remained unchanged (Fig. 3BUp). We were also unable to detect any change of phenotype in this strain grown on salicin, arbutin and methyl {beta}-glucoside alone (data not shown). The R-CEL(bgl : : npt) strain also retained its ability to grow on these {beta}-glucosides. However, it failed to utilize cellobiose (Fig. 3CUp), which led us to conclude that the bgl genes play an indispensable role in utilization of this sugar in the R-CEL strain.

Functional analysis of bgl genes in C. glutamicum ATCC 13869
To further examine whether bgl genes confer the potential for utilization of {beta}-glucosides, we subcloned promoterless bglFA (plasmid pCbglFA) and individual bglF and bglA genes (plasmids pCbglF and pCbglA, respectively) to provide their constitutive transcription from the lac promoter of the vector pCRA1 in C. glutamicum ATCC 13869-C (Fig. 4DownA). Unlike C. glutamicum R, C. glutamicum ATCC 13869 does not grow on methyl {beta}-glucoside, salicin or arbutin. Southern hybridization further revealed the absence of the bglFA genes from the chromosome of this strain (data not shown). Phosphorylation and cleavage of {beta}-glucoside analogue PNPG were also not detected under any conditions tested (Table 2Down). The PTS and {beta}-glucosidase (PTS/{beta}-glucosidase) activities were evaluated as combined activities in vitro. The transformation of strain ATCC 13869-C with pCbglFA resulted in constitutive, carbohydrate-independent expression of PTS/{beta}-glucosidase activity (Table 2Down) and transformants grew on methyl {beta}-glucoside and salicin (Fig. 4ADown) or arbutin (data not shown). Regardless of the high constitutive PTS/{beta}-glucosidase activity in ATCC 13869-C harbouring pCbglFA, this strain failed to grow on cellobiose (Figs 4A and 5BDownDown), thereby suggesting that wild-type bglFA genes alone do not support cellobiose utilization.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4. Functional analysis of bgl genes by complementing the {beta}-glucoside-negative phenotype in C. glutamicum ATCC 13869-C. (A) Organization of plasmids used to constitutively express bgl genes and utilization of {beta}-glucosides by the corresponding transformants. PCR-amplified genes were inserted into the multi-cloning site (MCS) of pCRA1 behind the lac promoter of the vector (the Plac-MCS-lacZ region originated from the pHSG298 part of the shuttle vector) as described in Methods. Sugar utilization was assayed on minimal BT medium supplemented with 0·5 % {beta}-glucoside. For PTS/{beta}-glucosidase activities see Table 2Up. (B) Utilization of {beta}-glucosides in transformants harbouring wild-type and mutant bgl genes. The wild-type bglFAG was restored from fr-FA and fr-AG (Fig. 1AUp) in pCRA1 as decribed in Methods. Plasmids pRbglFAAG and pRbglFMAG are those which accumulated adaptive point mutations in codon 317 of bglF that resulted in V317A and V317M, respectively.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Functional expression of bgl genes in C. glutamicum ATCC 13869-C

Cells were grown in AA medium supplemented with the carbon source indicated. Activities were measured in crude cell extracts from mid-exponential-phase cultures with PNPG as a substrate and expressed as pmol p-nitrophenol formed s-1 (mg total protein)-1. The 50 % inhibition of the rate of p-nitrophenyl formation was achieved at a PNPG-to-salicin ratio of 1 : 1. Three independent sets of experiments were carried out and representative results are shown. {beta}-MG, methyl {beta}-D-glucopyranoside; ND, not determined.

 


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Growth and cellobiose utilization in C. glutamicum strains. The cultures were grown in minimal BT medium supplemented with sugars as indicated below. Growth (as OD590; top of each panel) and sugar consumption (bottom) were monitored throughout growth. (A) Comparison of C. glutamicum R-CEL (open symbols) and R-CEL2 (solid symbols) in media containing either 0·5 % glucose (growth, diamonds; sugar consumption not shown) or 0·5 % cellobiose (growth, squares; sugar, triangles). (B) Growth and sugar consumption of C. glutamicum ATCC 13869-C transformed with pCbglFA (open symbols) or pCbglFAA (solid symbols) in medium supplemented with glucose (circles) and cellobiose (triangles). For genetic organization of pCbglFA see Fig. 4(A)Up. Plasmid pCbglFAA is the same as pCbglFA but harbours a mutant bglF(V317A). It should be noted here that the PTS/{beta}-glucosidase activities reported in Table 2Up for ATCC 1369-C transformed with pCbglFA and values found in similar experiments with pCbglFAA-transformant (data not shown) were essentially identical.

 
C. glutamicum ATCC 13869-C harbouring individual bglF or bglA genes did not exhibit PTS/{beta}-glucosidase activity and failed to grow on {beta}-glucosides (Fig. 4AUp). It thus appeared that both BglF PTS permease and phospho-{beta}-glucosidase were essential for utilization of {beta}-glucosides in recombinant cells. To demonstrate their function in vitro, we combined crude extracts from strains transformed with pCbglF and pCbglA. As shown in Table 2Up, the PTS/{beta}-glucosidase activity was restored to the level found in pCbglFA-transformed ATCC 13869-C. Interestingly, the phospho-{beta}-glucosidase (bglA) alone allowed pCbglA transformants to utilize methyl {beta}-glucoside. This sugar seemingly entered the cell via another (glucose-specific?) PTS permease. It is noteworthy that methyl {beta}-glucoside can also be a substrate for the glucose PTS in E. coli (Schaefler, 1967Down).

To examine whether bglG, encoding a putative transcriptional regulator, is required for induction of bgl genes, we compared growth and PTS/{beta}-glucosidase activities in C. glutamicum ATCC 13869-C transformed with plasmids containing the entire bglFAG sequence including the regulatory features (plasmid pRbglFAG) and its bglG deletion variant (plasmid pRbglFA). Whilst transformation with pRbglFAG resulted in utilization of methyl {beta}-glucoside, salicin and arbutin, these {beta}-glucosides were not utilized in cells harbouring pRbglFA (data not shown). As illustrated in Table 2Up, methyl {beta}-glucoside and salicin induced PTS/{beta}-glucosidase activity in pRbglFAG-transformed ATCC 13869-C, but not in pRbglFA transformants, thereby suggesting that bglG product acts as a positive regulator.

Mutations that occur in Cel+ strains
A possible explanation for the occurrence of Cel+ strains was that a mutation within bglF and/or bglA was required to convert bglFAG into a cellobiose PTS. To test this hypothesis, we incubated C. glutamicum ATCC 13869-C transformed with pRbglFAG and pCbglFA on minimal BT medium supplemented with 0·5 % cellobiose. Cel+ colonies appeared with both transformants at a frequency of 10-7. Sequence analysis of plasmids isolated from 15 independent Cel+ mutants showed that all contained one of two different single-nucleotide mutations in codon 317 of bglF, which caused an amino acid exchange. The point mutation GTG->GCG resulted in substitution V317A and GTG->ATG in V317M. bglF genes carrying V317A (bglF317A) and V317M (bglF317M) were the only mutated alleles identified and we did not find any mutations within bglA or bglG in the isolated plasmids. The respective mutant plasmids were named pRbglFAAG or pCbglFAA and pRbglFMAG or pCbglFMA. These plasmids were used to transform C. glutamicum R and ATCC 13869-C. All transformants harbouring the mutant plasmids grew on {beta}-glucosides, including cellobiose (Fig. 4BUp), indicating that further mutations are not required for the Cel+ phenotype. We also constitutively expressed bglF317AA and bglF317MA in the Enzyme I-deficient mutant of C. glutamicum R (strain R-PDI5; data not shown). The observation that pCbglFAA and pCbglFMA did not support growth of R-PDI5 on cellobiose was in good agreement with the idea that the transport of cellobiose is coupled to its phosphorylation.

Finally, to investigate whether a mutation in bglF is also responsible for the Cel+ phenotype in C. glutamicum R-CEL, we amplified the bgl locus from this strain in a PCR using VentR DNA polymerase and chromosomal DNA as a template. Sequencing of the products from three independent reactions showed that R-CEL carried the bglF317AAG genes. We were also able to isolate and, by sequencing of the bgl locus, identify a spontaneous Cel+ mutant of C. glutamicum R, which harboured mutation V317M. This newly identified mutant was designated R-CEL2. Both R-CEL and R-CEL2 strains grew equally well in minimal BT medium with glucose (as well as methyl {beta}-glucoside and salicin; data not shown) with a growth rate (µ) of about 0·65 h-1, but evaluation of growth on 0·5 % cellobiose revealed significant differences between strains (Fig. 5UpA). The R-CEL strain both consumed cellobiose and grew (µ 0·23 h-1) faster than R-CEL2 (µ 0·10 h-1), indicating that mutations V317A and V317M do not provide an equally well-performing cellobiose PTS.

Effect of different carbon sources on PTS/{beta}-glucosidase activity
To investigate the {beta}-glucoside PTS and its regulation in more detail we measured the combined PTS and {beta}-glucosidase activity in crude cell extracts from strains grown in AA medium supplemented with 0·4 % sodium acetate, 0·4 % glucose, 0·1 % methyl {beta}-glucoside, 0·1 % salicin or 0·05 % cellobiose (Table 3Down). Compared to the control (acetate), the presence of methyl {beta}-glucoside and salicin resulted in a 20- to 30-fold increase of PTS/{beta}-glucosidase activity in C. glutamicum R, R-CEL and R-CEL2. This activity was induced by the same spectrum of {beta}-glucosides in bgl-deficient mutants also, suggesting the presence of another PTS responsible for the observed Bgl+ phenotype of bgl : : npt strains. The levels of the PTS/{beta}-glucosidase activity were actually similar in wild-type and R(bgl : : npt) strains, suggesting that a second system may fully complement the bgl genes to provide sufficient activity for maximum (as compared to glucose) growth. Cellobiose induced the PTS/{beta}-glucosidase activity only in R-CEL (28-fold) and R-CEL2 (9-fold).


View this table:
[in this window]
[in a new window]
 
Table 3. Influence of different carbon sources on activity of {beta}-glucoside PTS

Cells were grown to OD590 2±0·5 in AA medium supplemented with the carbon source indicated. The combined PTS and {beta}-glucosidase activities were measured as described in the legend to Table 2Up [1 U is 1 pmol p-nitrophenol formed from PNPG s-1 (mg total protein)-1]. Three independent sets of experiments were performed and representative results are shown. {beta}-MG, methyl {beta}-D-glucopyranoside; ND, not determined.

 
We further explored the PTS/{beta}-glucosidase activity in C. glutamicum R and its variants grown on mixtures of glucose and {beta}-glucosides to test whether a favoured carbon source would repress the {beta}-glucoside PTS. The PTS/{beta}-glucosidase activities were then only about 10 % of those induced by {beta}-glucosides alone (Table 3Up), thereby attesting that both {beta}-glucoside utilization systems present in C. glutamicum R are subject to carbon catabolite repression and that {beta}-glucosides should be considered alternative carbon sources in this bacterium. The finding that constitutive expression of bglF317AA resulted in simultaneous utilization of glucose and cellobiose (Fig. 5BUp) indicated that bgl-dependent utilization of {beta}-glucosides is negatively regulated at the transcription level.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Analysis of sugar utilization in different strains of C. glutamicum revealed that C. glutamicum strain R can utilize several {beta}-glucosides as sole carbon and energy sources (Kotrba et al., 2001Down). The evidence that transport of {beta}-glucosides depends, in this strain, on the PTS prompted our efforts towards cloning of the respective PTS permease that ultimately led to isolation of the {beta}-glucoside phosphotransferase and utilization system which is described here. The system isolated comprises three genes, bglF, bglA and bglG, which, considering their genetic organization, may constitute an operon. Independent transcription of bglG cannot be ruled out, however. The respective genes encode (i) PTS permease BglF, which is a {beta}-glucoside-specific Enzyme II with all three functional domains synthesized as one IIBCA protein; (ii) phospho-{beta}-glucosidase BglA; and (iii) putative transcription regulator BglG. The system isolated shares significant homology with {beta}-glucoside PTS operons with permeases belonging to the glucose–glucoside family of PTS transporters (Robillard & Broos, 1999Down) reported from Gram-positive and Gram-negative bacteria. The PTS permeases specific for cellobiose, which have been identified in, for example, Bacillus stearothermophilus (Lai & Ingram, 1993Down) or B. subtilis (Tobisch et al., 1997Down) are of the lactose–cellobiose family and do not have significant similarity to BglF.

Functional analysis of bglF and bglA performed in Bgl- C. glutamicum ATCC 13869-C confirmed that BglF permease, along with the BglA hydrolase, supports transport and breakdown of methyl {beta}-glucoside, salicin and arbutin in vivo and that the system isolated in this study is specific for these {beta}-glucosides. The bglFA genes are absent from both C. glutamicum ATCC 13869 and ATCC 13032, which cannot grow at the expense of {beta}-glucosides (Kotrba et al., 2001Down) and thus apparently also lack a functional homologue of the second, as yet unidentified, {beta}-glucoside system of C. glutamicum R. Taking advantage of the available genome sequence of C. glutamicum ATCC 13032 (GenBank accession no. NC003450) and probing it with the bglFAG sequence in silico, we obtained the only positive hit in the DNA region which was identical with part of the bglG coding sequence corresponding to amino acids 96–289 of BglG (data not shown). It is noteworthy that in strain ATCC 13032 this sequence is located 3 kb upstream of an insertion element designated ISCg2 (Quast et al., 1999Down). It is, therefore, tempting to speculate that the bgl homologue in strain ATCC 13032 was knocked out due to DNA rearrangements related to the transposition event.

In addition to {beta}-glucosides transported by wild-type BglF, the permease that accumulated mutations V317A and V317M in strains R-CEL and R-CEL2, respectively, can also transport cellobiose, a disaccharide that is not normally utilized in C. glutamicum R. Considering that only phosphorylated {beta}-glucosides can be hydrolysed by BglA, and given the fact that constitutive expression of mutant permeases along with phospho-{beta}-glucosidase in the PTS-deficient ptsI : : npt strain R-PDI5 did not support growth on cellobiose, it appears that mutants BglF317A and BglF317M act on cellobiose as phosphorylating PTS Enzymes II. Our experiments did not fully exclude the possibility that phosphorylated cellobiose was hydrolysed by an as yet unidentified {beta}-glucosidase in C. glutamicum strains. An examination of the amino acid sequence surrounding the V317 of BglF revealed that the site accumulating mutations is situated only three residues from H313. This histidine residue is highly conserved in all Enzymes IIBgl (Fig. 2BUp) and may be considered a potential phosphotransferase-acting determinant. The corresponding H306 of the homologous BglF from E. coli was reported as being indispensable for phosphorylation of transported {beta}-glucosides (Schnetz et al., 1990Down). From the close proximity of H313 and V317, it is tempting to speculate that substitution of V317 with a residue having either smaller (Ala) or larger (Met) side chains causes a local conformational change affecting the side chain of H313, such that it may participate in phosphorylation of incoming cellobiose. Intriguingly, residues corresponding to position 317 of BglF are also different from valine in the other three permeases (Fig. 2BUp) which recognize cellobiose as a substrate, namely BvrB from L. monocytogenes (Brehm et al., 1999Down), CasA from K. oxytoca (Lai et al., 1997Down) and AscF from E. coli (Hall & Xu, 1992Down). Conversely, the valine residue is conserved in those Enzymes IIBgl, which do not transport cellobiose.

In view of the identification of the RAT/terminator overlap in the bgl sequence, and BglG, which may be regarded as a transcription antiterminator from the BglG/SacY family, and considering that bglG was confirmed as being indispensable for induction of the PTS/{beta}-glucosidase activity in C. glutamicum ATCC 13969-C (Table 2Up), it appears that transcription of bgl genes is regulated via a transcription antitermination mechanism (Stülke et al., 1998Down; Görke & Rak, 1999Down). Accordingly, the RNA hybridization analysis demonstrated that the bgl genes are induced in C. glutamicum R and R-CEL by methyl {beta}-glucoside, salicin and arbutin, and in the latter strain also by cellobiose. The availability of glucose further repressed PTS/{beta}-glucosidase activity in C. glutamicum R and R-CEL (Table 3Up), and the {beta}-glucosides salicin and cellobiose, respectively, were appreciably taken up from the medium only after all the glucose was consumed (Fig. 3B, CUp). It should be also noted that mutations V317A and V317M did not have equivalent phenotypes. Induction of bgl-borne PTS/{beta}-glucosidase activity by cellobiose and the response to glucose availability was more pronounced in the R-CEL mutant. Accordingly, growth of R-CEL2 was slower on cellobiose than that of R-CEL, which was also reflected by the lower rate of cellobiose consumption. Our approach did not fully address the influence of V317A and V317M on transport of other {beta}-glucosides, as these mutations are masked in C. glutamicum R-CEL and R-CEL2 by a complementary {beta}-glucoside PTS. It is worth noting, however, that we did not observe any significant differences in growth and PTS/{beta}-glucosidase activities in C. glutamicum ATCC 13869-C transformed with plasmids harbouring wild-type or mutant bglFAG when salicin or methyl {beta}-glucoside was supplied as the only carbon and energy source (data not shown). This suggested that the reported substitutions at residue 317 only extended the substrate specificity towards cellobiose. The experimental data represented here encourage the concept that it is the IIC domain that is responsible for substrate specificity of Enzyme II and suggest that a specific PTS may adopt new substrates under unfavourable environmental conditions to support the growth and survival of bacteria.


    ACKNOWLEDGEMENTS
 
We are grateful to Roy H. Doi for critical remarks on the manuscript. We also thank Crispinus Omumasaba for suggestions during preparation of the manuscript. Peter Kos is acknowledged for construction and generous sharing of pCRA1. This work was supported by a grant from the Ministry of Economy, Trade and Industry (METI). P. K. was also in part supported by grant LN 00A079 from the Ministry of Education, Youth and Sports of the Czech Republic.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Begley, G. S., Warner, K. A., Arents, J. C., Postma, P. W. & Jacobson, G. R. (1996). Isolation and characterization of a mutation that alters the substrate specificity of the Escherichia coli glucose permease. J Bacteriol 178, 940–942.[Abstract/Free Full Text]

Brehm, K., Ripio, M. T., Kreft, J. & Vazquez-Boland, J. A. (1999). The bvr locus of Listeria monocytogenes mediates virulence gene repression by {beta}-glucosides. J Bacteriol 181, 5024–5032.[Abstract/Free Full Text]

Brown, G. D. & Thomson, J. A. (1998). Isolation and characterisation of an aryl-{beta}-D-glucoside uptake and utilization system (abg) from the gram-positive ruminal Clostridium species C. longisporum. Mol Gen Genet 257, 213–218.[CrossRef][Medline]

Buhr, A., Daniels, G. A. & Erni, B. (1992). The glucose transporter of Escherichia coli. Mutants with impaired translocation activity that retains phosphorylation activity. J Biol Chem 267, 3847–3851.[Abstract/Free Full Text]

Cote, C. K., Cvitkovich, D., Bleiweis, A. S. & Honeyman, A. L. (2000). A novel {beta}-glucoside-specific PTS locus from Streptococcus mutans that is not inhibited by glucose. Microbiology 146, 1555–1563.[Abstract/Free Full Text]

Crutz, A. M. & Steinmetz, M. (1992). Transcription of the Bacillus subtilis sacX and sacY genes, encoding regulators of sucrose metabolism, is both inducible by sucrose and controlled by the DegS-DegU signaling system. J Bacteriol 174, 6087–6095.[Abstract/Free Full Text]

Dominguez, H., Rollin, C., Guyonvarch, A., Guerquin-Kern, J. L., Cocaign-Bousquet, M. & Lindley, N. D. (1998). Carbon-flux distribution in the central metabolic pathways of Corynebacterium glutamicum during growth on fructose. Eur J Biochem 254, 96–102.[Medline]

el Hassouni, M., Henrissat, B., Chippaux, M. & Barras, F. (1992). Nucleotide sequence of the arb genes, which control {beta}-glucoside utilization in Erwinia chrysanthemi: comparison with the Escherichia coli bgl operon and evidence for a new {beta}-glycohydrolase family including enzymes from Eubacteria, Archebacteria, and humans. J Bacteriol 174, 765–777.[Abstract/Free Full Text]

Elkins, M. F. & Earhart, C. F. (1989). Nucleotide sequence and regulation of the Escherichia coli gene for ferrienterobactin transport protein FepB. J Bacteriol 171, 5443–5451.[Abstract/Free Full Text]

Görke, B. & Rak, B. (1999). Catabolite control of Escherichia coli regulatory protein BglG activity by antagonistically acting phosphorylations. EMBO J 18, 3370–3379.[CrossRef][Medline]

Goyal, D., Wachi, M., Kijima, N., Kobayashi, M., Yukawa, H. & Nagai, K. (1996). A cryptic plasmid pBL1 from Brevibacterium lactofermentum causes growth inhibition and filamentation in Escherichia coli. Plasmid 36, 62–66.[CrossRef][Medline]

Hall, B. G. & Xu, L. (1992). Nucleotide sequence, function, activation and evolution of the cryptic asc operon of Escherichia coli K12. Mol Biol Evol 9, 688–706.[Abstract]

Innis, M. A., Gelfand, D. H., Sninski, J. J. & White, T. J. (1990). PCR Protocols, a Guide to Methods and Applications. San Diego, CA: Academic Press.

Kinoshita, S. (1985). Glutamic acid bacteria. In Biology of Industrial Microorganisms, pp. 115–146. Edited by A. L. Demain & N. A. Solomon. London: Benjamin Cummings.

Kornberg, H. L., Lambourne, L. T. & Sproul, A. A. (2000). Facilitated diffusion of fructose via the phosphoenolpyruvate/glucose phosphotransferase system of Escherichia coli. Proc Natl Acad Sci U S A 97, 1808–1812.[Abstract/Free Full Text]

Kotrba, P., Inui, M. & Yukawa, H. (2001). The ptsI encoding Enzyme I of the phosphotransferase system of Corynebacterium glutamicum. Biochem Biophys Res Commun 289, 1307–1313.[CrossRef][Medline]

Kricker, M. & Hall, B. G. (1987). Biochemical genetics of the cryptic gene system for cellobiose utilization in Escherichia coli K12. Genetics 115, 419–429.[Abstract/Free Full Text]

Krüger, S. & Hecker, M. (1995). Regulation of the putative bglPH operon for aryl-{beta}-glucoside utilization in Bacillus subtilis. J Bacteriol 177, 5590–5597.[Abstract/Free Full Text]

Kurusu, Y., Kainuma, M., Inui, M., Satoh, Y. & Yukawa, H. (1990). Electroporation-transformation system for coryneform bacteria by auxotrophic complementation. Agric Biol Chem 54, 443–447.[Medline]

Lai, X. & Ingram, L. O. (1993). Cloning and sequencing of a cellobiose operon from Bacillus stearothermophilus XL-65-6 and functional expression in Escherichia coli. J Bacteriol 175, 6441–6450.[Abstract/Free Full Text]

Lai, X., Davis, F. C., Hespell, R. B. & Ingram, L. O. (1997). Cloning of cellobiose phosphoenolpyruvate-dependent phosphotransferase genes: functional expression in recombinant Escherichia coli and identification of a putative binding region for disaccharides. Appl Environ Microbiol 63, 355–363.[Abstract]

Lee, J.-K., Sung, M.-H., Yoon, K.-H., Yu, J.-H. & Oh, T.-K. (1994). Nucleotide sequence of the gene encoding the Corynebacterium glutamicum mannose enzyme II and analyses of the deduced protein sequence. FEMS Microbiol Lett 119, 137–146.[Medline]

Lessard, P. A., Guillouet, S., Willis, L. B. & Sinskey, A. J. (1999). Corynebacteria, Brevibacteria. In Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis and Bioseparation, pp. 729–740. Edited by M. C. Flickinger & S. W. Drew. New York: Wiley.

Malin, G. M. & Bourd, G. I. (1991). Phosphotransferase-dependent glucose transport in Corynebacterium glutamicum. J Appl Bacteriol 71, 517–523.

Marasco, R., Salatiello, I., De Felice, M. & Sacco, M. (2000). A physical and functional analysis of the newly-identified bglGPT operon of Lactobacillus plantarum. FEMS Microbiol Lett 186, 269–273.[CrossRef][Medline]

Mori, M. & Shiio, I. (1987). Phosphoenolpyruvate : sugar phosphotransferase systems and sugar metabolism in Brevibacterium flavum. Agric Biol Chem 51, 2671–2678.

Notley-McRobb, L. & Ferenci, T. (2000). Substrate specificity and signal transduction pathways in the glucose-specific enzyme II (EIIGlc) component of the Escherichia coli phosphotransferase system. J Bacteriol 182, 4437–4442.[Abstract/Free Full Text]

Oh, H., Park, Y. & Park, C. (1999). A mutated PtsG, the glucose transporter, allows uptake of D-ribose. J Biol Chem 274, 14006–14011.[Abstract/Free Full Text]

Parche, S., Burkowski, A., Sprenger, G. A., Weil, B., Krämer, R. & Titgemeyer, F. (2001). Corynebacterium glutamicum: a dissection of the PTS. J Mol Microbiol Biotechnol 3, 423–428.[Medline]

Plumbridge, J. (2000). A mutation which affects both the specificity of PtsG sugar transport and the regulation of ptsG expression by Mlc in Escherichia coli. Microbiology 146, 2655–2663.[Abstract/Free Full Text]

Postma, P. W., Lengeler, J. W. & Jacobson, G. R. (1993). Phosphoenolpyruvate : carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57, 543–594.[Abstract/Free Full Text]

Quast, K., Bathe, B., Pühler, A. & Kalinowski, J. (1999). The Corynebacterium glutamicum insertion sequence ISCg2 prefers conserved target sequences located adjacent to genes involved in aspartate and glutamate metabolism. Mol Gen Genet 262, 568–578.[CrossRef][Medline]

Robillard, G. T. & Broos, J. (1999). Structure/function studies on the bacterial carbohydrate transporters, enzymes II, of the phosphoenolpyruvate-dependent phosphotransferase system. Biochim Biophys Acta 1422, 73–104.[Medline]

Ruijter, G. J., van Meurs, G., Verwey, M. A., Postma, P. W. & van Dam, K. (1992). Analysis of mutations that uncouple transport from phosphorylation in enzyme IIGlc of the Escherichia coli phosphoenolpyruvate-dependent phosphotransferase system. J Bacteriol 174, 2843–2850.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Saraceni-Richards, C. A. & Jacobson, G. R. (1997). A conserved glutamate residue, Glu-257, is important for substrate binding and transport by the Escherichia coli mannitol permease. J Bacteriol 179, 1135–1142.[Abstract/Free Full Text]

Schaefler, S. (1967). Inducible system for the utilization of {beta}-glucosides in Escherichia coli. I. Active transport and utilization of {beta}-glucosides. J Bacteriol 93, 254–263.[Abstract/Free Full Text]

Schnetz, K., Toloczyki, C. & Rak, B. (1987). {beta}-Glucoside (bgl) operon of Escherichia coli K12: nucleotide sequence, genetic organization, and possible evolutionary relationship to regulatory components of two Bacillus subtilis genes. J Bacteriol 169, 2579–2590.[Abstract/Free Full Text]

Schnetz, K., Sutrina, S. L., Saier, M. H., Jr & Rak, B. (1990). Identification of catalytic residues in the {beta}-glucoside permease of Escherichia coli by site-specific mutagenesis and demonstration of interdomain cross-reactivity between the {beta}-glucoside and glucose systems. J Biol Chem 265, 13464–13471.[Abstract/Free Full Text]

Schnetz, K., Stülke, J., Gertz, S., Krüger, S., Krieg, M., Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator protein of the BglG family. J Bacteriol 178, 1971–1979.[Abstract/Free Full Text]

Stülke, J., Arnaud, M., Rapoport, G. & Martin-Verstraete, I. (1998). PRD – a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol 28, 865–874.[CrossRef][Medline]

Tobisch, S., Glaser, P., Krüger, S. & Hecker, M. (1997). Identification of a new {beta}-glucoside utilization system in Bacillus subtilis. J Bacteriol 179, 496–506.[Abstract/Free Full Text]

Vertès, A. A., Inui, M., Kobayashi, M., Kurusu, Y. & Yukawa, H. (1993). Presence of mrr- and mcr-like restriction systems in coryneform bacteria. Res Microbiol 144, 181–185.[Medline]

Zeppenfeld, T., Larisch, C., Lengeler, J. W. & Jahreis, K. (2000). Glucose transporter mutants of Escherichia coli K-12 with changes in substrate recognition of IICBGlc and induction behavior of the ptsG gene. J Bacteriol 182, 4443–4452.[Abstract/Free Full Text]

Received 14 October 2002; revised 12 February 2003; accepted 17 February 2003.


This article has been cited by other articles:


Home page
Appl. Environ. Microbiol.Home page
D. Rittmann, S. N. Lindner, and V. F. Wendisch
Engineering of a Glycerol Utilization Pathway for Amino Acid Production by Corynebacterium glutamicum
Appl. Envir. Microbiol., October 15, 2008; 74(20): 6216 - 6222.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
Y. Tanaka, N. Okai, H. Teramoto, M. Inui, and H. Yukawa
Regulation of the expression of phosphoenolpyruvate : carbohydrate phosphotransferase system (PTS) genes in Corynebacterium glutamicum R
Microbiology, January 1, 2008; 154(1): 264 - 274.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
H. Yukawa, C. A. Omumasaba, H. Nonaka, P. Kos, N. Okai, N. Suzuki, M. Suda, Y. Tsuge, J. Watanabe, Y. Ikeda, et al.
Comparative analysis of the Corynebacterium glutamicum group and complete genome sequence of strain R
Microbiology, April 1, 2007; 153(4): 1042 - 1058.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Sakai, Y. Tsuchida, S. Okino, O. Ichihashi, H. Kawaguchi, T. Watanabe, M. Inui, and H. Yukawa
Effect of Lignocellulose-Derived Inhibitors on Growth of and Ethanol Production by Growth-Arrested Corynebacterium glutamicum R
Appl. Envir. Microbiol., April 1, 2007; 73(7): 2349 - 2353.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
H. Kawaguchi, A. A. Vertes, S. Okino, M. Inui, and H. Yukawa
Engineering of a Xylose Metabolic Pathway in Corynebacterium glutamicum.
Appl. Envir. Microbiol., May 1, 2006; 72(5): 3418 - 3428.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kotrba, P.
Right arrow Articles by Yukawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kotrba, P.
Right arrow Articles by Yukawa, H.
Agricola
Right arrow Articles by Kotrba, P.
Right arrow Articles by Yukawa, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2003 Society for General Microbiology.