Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 149 (2003), 1807-1818; DOI  10.1099/mic.0.26099-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buendía-Clavería, A. M.
Right arrow Articles by Ruiz-Sainz, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buendía-Clavería, A. M.
Right arrow Articles by Ruiz-Sainz, J. E.
Agricola
Right arrow Articles by Buendía-Clavería, A. M.
Right arrow Articles by Ruiz-Sainz, J. E.
Microbiology 149 (2003), 1807-1818; DOI  10.1099/mic.0.26099-0
© 2003 Society for General Microbiology

A purL mutant of Sinorhizobium fredii HH103 is symbiotically defective and altered in its lipopolysaccharide

Ana M. Buendía-Clavería1, Ahmed Moussaid1, F. Javier Ollero1, José M. Vinardell1, Antonio Torres1, Javier Moreno2, Antonio M. Gil-Serrano3, Miguel A. Rodríguez-Carvajal3, Pilar Tejero-Mateo3, Jan L. Peart4, Nicholas J. Brewin4 and José E. Ruiz-Sainz1

1 Departamento de Microbiología, Facultad de Biología, Universidad de Sevilla, Apdo 1095, 41080 Sevilla, Spain
2 Departamento de Biología Celular, Facultad de Biología, Universidad de Sevilla, Av. Reina Mercedes s/n, 41012 Sevilla, Spain
3 Departamento de Química Orgánica, Facultad de Química, Universidad de Sevilla, Apdo 553, 41071 Sevilla, Spain
4 Department of Molecular Microbiology, John Innes Centre, Norwich NR4 7UH, UK

Correspondence
José E. Ruiz-Sainz
rsainz{at}us.es


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The pleiotropic phenotype of an auxotrophic purL mutant (SVQ295) of Sinorhizobium fredii HH103 has been investigated. SVQ295 forms colonies that are translucent, produce more slime and absorb less Congo red than those of wild-type strain HH103. SVQ295 did not grow in minimal medium unless the culture was supplemented with thiamin and adenine or with thiamin and AICA-riboside (5-aminoimidazole-4-carboxamide 1-{beta}-D-ribofuranoside), an intermediate of purine biosynthesis. Bacterial cultures supplemented with AICA-riboside or adenine reached the same culture density, although the doubling time of SVQ295 cultures containing AICA-riboside was clearly longer. S. fredii SVQ295 induced pseudonodules on Glycine max and failed to nodulate six different legumes. On Glycyrrhiza uralensis, however, nodules showing nitrogenase activity and containing infected plant cells were formed. SVQ295 showed auto-agglutination when grown in liquid TY medium and its lipopolysaccharide (LPS) electrophoretic profile differed from that of its parental strain HH103-1. In addition, four monoclonal antibodies that recognize the LPS of S. fredii HH103 failed to recognize the LPS produced by SVQ295. In contrast, 1H-NMR spectra of K-antigen capsular polysaccharides (KPS) produced by SVQ295 and the wild-type strain HH103 were similar. Co-inoculation of soybean plants with SVQ295 and SVQ116 (a nodA mutant derivative of HH103) produced nitrogen-fixing nodules that were only occupied by SVQ116.


Abbreviations: AICA-riboside, 5-aminoimidazole-4-carboxamide 1-{beta}-D-ribofuranoside; AICAR, 5-aminoimidazole-4-carboxamide ribonucleotide; KPS, K-antigen capsular polysaccharide; LCO, lipo-chitin oligosaccharide

The GenBank accession number for the sequence determined in this work is AF275718.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The interaction between rhizobia and legumes to form nitrogen-fixing root nodules involves several communication steps to coordinate gene expression and nodule development. The initial exchange of signals activates rhizobial nod gene expression by plant-produced flavonoid compounds. The nod gene products are responsible for the production of host-specific lipooligosaccharide signal molecules that cause root hair curling and nodule meristem initiation (Fisher & Long, 1992Down; Day et al., 2000Down).

Unlike the bacterial signals specified by nod genes, signal molecules that may be required to initiate and maintain infection thread development are poorly understood. Studies with rhizobial mutants defective in exopolysaccharide, lipopolysaccharide (LPS) or K-antigen capsular polysaccharides (KPS) indicate that these polysaccharides are important for infection of a variety of legumes (Becker & Pühler, 1998Down; Kannenberg et al., 1998Down; Kannenberg & Carlson, 2001Down). Interestingly, Sinorhizobium fredii and S. meliloti produce structurally conserved LPS but strain-specific KPS, indicating that the conserved LPS lack the structural information necessary to influence host specificity while the variable KPS may affect strain–cultivar interactions (Reuhs et al., 1998Down). Moreover, studies using a panel of anti-S. meliloti monoclonal antibodies that recognizes LPS or KPS have revealed changes of these polysaccharides during symbiosis (Reuhs et al., 1999Down).

The phenotypes of different Rhizobium auxotrophs have also provided interesting clues to the physiology of nodule development. By analysing the symbiotic behaviour of auxotrophic mutants, it has been demonstrated that some metabolic pathways of Rhizobium bacteria are important for an efficient symbiotic interaction (Pain 1979Down; Noel et al., 1988Down). In some legume–Rhizobium associations, the host plant can supply the auxotrophic symbiont with the required nutrient(s) (Djordjevic et al., 1988Down). However, the success of this physiological complementation will depend on the host plant, the rhizobial strain, and the nature of the auxotrophy (Beringer et al., 1980Down). One intriguing type of finding is that in some biosynthetic pathways, intermediates, rather than endproducts, may be required for the bacteria to elicit nodule development or infection. For example, studies with S. meliloti tryptophan auxotrophs suggest that anthranilate synthesis is important for bacteroid development symbiosis with alfalfa (Barsomian et al., 1992Down).

One of the most universally deleterious symbiotic defects is purine auxotrophy. Purine auxotrophs of most rhizobial species are unable to nodulate their host plants effectively (Pankhurst & Schwinghamer, 1974Down; Denarié et al., 1976Down; Pain, 1979Down). S. meliloti purine auxotrophs have been reported to induce ineffective nodules on alfalfa (Denarié et al., 1976Down). Several purine auxotrophs of Rhizobium leguminosarum bv. viciae were described as noninfective or even being unable to induce nodule formation (Pain, 1979Down). Similarly, a purine auxotroph of the broad-host-range Rhizobium sp. NGR234 elicited root hair curling and nodule meristem initiation on Macroptilium atropurpureum, but no infection threads were observed (Djordjevic et al., 1988Down). On soybean, S. fredii purine auxotrophs induced pseudonodules that did not contain bacteria (Kim et al., 1988Down).

Purine auxotrophs (Pur-) of R. etli CFN42 elicited pseudonodules on bean plants (Noel et al., 1988Down). These mutants caused root hair curling and nodule meristem initiation but did not elicit infection threads. Supplementation of the root medium with 0·1 mM purine, or purine nucleosides, did not enhance nodulation ability of R. etli pur mutants. However, the addition of 0·1 mM 5-aminoimidazole-4-carboxamide 1-{beta}-D-ribofuranoside (AICA-riboside, an intermediate in the biosynthetic purine pathway) to the plant nutritive solution significantly enhanced nodule development (Noel et al., 1988Down; Newman et al., 1994Down). Nodules induced by the mutants in the presence of AICA-riboside resembled those formed by the wild-type, but were unpigmented and lacked nitrogenase activity. Examination of these nodules by light microscopy revealed the presence of infection threads filled with bacteria, but infected plant cells were not observed. Time-course experiments showed that the addition of AICA-riboside to Phaseolus vulgaris roots within the first 6 days after inoculation with a R. etli pur mutant allowed the formation of vascular bundles in the nodule cortex. Beyond this time, AICA-riboside supplementation produced nodules that contained their vascular bundles in a central position (Newman et al., 1992Down). AICA-riboside also promotes Rhizobium leguminosarum bv. viciae and Sinorhizobium fredii pur mutants for the formation of root nodules in Pisum sativum and Glycine max, respectively (Newman et al., 1994Down). All these results have led to the hypothesis that rhizobia might convert AICA riboside into AICAR (5-aminoimidazole-4-carboxamide ribonucleotide) to initiate and/or sustain infection thread development, possibly by using this substance in the production of a signal molecule.

We report here the isolation and characterization of a purL mutant (SVQ295) of S. fredii HH103 that requires the addition of adenine and thiamin to grow on minimal medium and forms pseudonodules on Glycine max roots. We demonstrate that the symbiotic phenotype of SVQ295 varies depending on the legume assayed. In Macrotyloma axyllare no nodules were formed, while in Glycyrrhiza uralensis, nodules containing infected cells were observed. Furthermore, the LPS profile of mutant SVQ295 is different from that shown by its wild-type parent HH103, and monoclonal antibodies raised against the HH103 LPS failed to recognize the LPS of SVQ295.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Strains, plasmids and media.
The bacterial strains and plasmids used in this work are listed in Table 1Down. Sinorhizobium strains were grown in TY medium (Beringer, 1974Down), yeast mannitol (YM) medium (Vincent, 1970Down), B- medium (Spaink et al., 1992Down) or MMB (Bergensen, 1961Down) at 28 °C. To screen for auxotrophic strains the minimal medium (MMB) was solidified with agarose at 1·5 % (w/v). Escherichia coli was cultured in Luria–Bertani (LB) medium (Maniatis et al., 1982Down) at 37 °C. When required, the media were supplemented with the appropriate antibiotics as described by Lamrabet et al. (1999)Down. When required, MMB medium was supplemented with adenine (12 µg ml-1), AICA-riboside (0·1 or 0·5 mM) and/or thiamin (0·8 µg ml-1).


View this table:
[in this window]
[in a new window]
 
Table 1. Bacterial strains and plasmids

 
Genetic manipulations.
Plasmids were transferred by conjugation as described by Simon (1984)Down. Random transposon Tn5-Mob mutagenesis of Sinorhizobium fredii strain HH103-1 was carried out by using the suicide plasmid pSUP5011 as described by Simon (1984)Down. Transconjugants were selected on TY medium containing kanamycin and streptomycin. Single colonies with altered morphology on solid TY or YM media were tested for auxotrophy by using a modification of the Holliday test (Beringer et al., 1984Down).

Total genomic DNA and plasmid isolations were carried out as described by Maniatis et al. (1982)Down. DNA manipulation, including restriction analyses, ligation, bacterial transformation and electrophoresis were performed according to the general protocols of Maniatis et al. (1982)Down.

The suicide rhizobial plasmid pSUP202 (Simon et al., 1983Down) was used to clone the rhizobial DNA that is adjacent to the Tn5-Mob insertion in mutant S. fredii SVQ295. Briefly, plasmid pSUP202 was transferred from E. coli S17-1 to mutant SVQ295, and TcR transconjugants were selected. Since this plasmid cannot replicate in S. fredii, the only possible inheritance of pSUP202 is by homologous recombination between the Mob site of transposon Tn5-Mob and the Mob region of plasmid pSUP202. This recombination will lead to the integration of plasmid pSUP202 inside transposon Tn5-Mob. Plasmid pSUP202 has a unique EcoRI site (inside the CmR gene) and this enzyme does not cut the Tn5-Mob transposon. Hence, EcoRI digestion of total DNA isolated from SVQ295 : : pSUP202 generates an EcoRI fragment that contains the tetracycline-resistance gene, the OriV of pSUP202, the Mob site, part of the transposon including the IS50R and a fragment of rhizobial DNA adjacent to the inserted transposon. EcoRI-digested SVQ295 : : pSUP202 total DNA was subjected to self-ligation and E. coli HB101 TcR transformants were selected.

An oligonucleotide (pdad2: 5'-AGATTTAGCCCAGTCG-3') was designed from the IS50R DNA sequence of transposon Tn5-Mob and used as a primer to sequence the rhizobial DNA that is adjacent to the right arm of Tn5-Mob in mutant strain SVQ295. DNA sequence was carried out by the dideoxy chain-termination method (Sanger et al., 1977Down). Computer analysis of the sequences was performed by using the GCG program (University of Wisconsin; Devereux et al., 1984Down).

Plant assays.
The nodulation ability of strain SVQ295 was tested on Glycine max (L.) Merr. cv. Williams, Cajanus cajan (L.) Millsp., Macroptilium atropurpureum (Moc. & Sessé ex DC) Urb., Vigna radiata (L.) Wilczek, Indigofera tinctoria (L.), Macrotyloma axillare (E. Mey.) Verdc., Albizia lebbek (L.) Benth., Kummerowia stipulacea (Maxim.) Makino, Neonotonia wightii (Arn.) Lackey and Glycyrrhiza uralensis (L.) as described by Buendía-Clavería et al. (1989)Down. Germinated seeds were transferred to Leonard jars containing sterilized vermiculite supplemented with Fåhraeus nutrient solution (Vincent, 1970Down). When required, the Fåhraeus plant nutritive solution was supplemented with adenine at 12 µg ml-1, thiamin at 0·8 µg ml-1 and AICA-riboside at 0·1 or 0·5 mM. Plants were grown for at least 5 weeks with a 16 h photoperiod at 25 °C in the light and 18 °C in the dark. Nitrogenase activity of soybean (Glycine max) nodules was determined by acetylene reduction assays as previously reported (Buendía-Clavería et al., 1986Down). Plant tops were dried at 70 °C for 48 h and weighed. Bacteria were isolated from surface-sterilized nodules as described by Buendía-Clavería et al. (1986)Down.

In double-inoculation experiments, soybean plants cv. Williams were inoculated with 3x108 bacteria per plant of each co-inoculant, SVQ116 (Rifr Kmr, prototrophic) and SVQ295 (Strr Kmr, Ade- Thi-). Plants were harvested 82 days after co-inoculation. To determinate nodule occupancy, isolates from soybean nodules were tested for antibiotic resistance and auxotrophic markers.

Radiolabelling of lipo-chitin oligosaccharide (LCO).
Bacteria were grown in 5 ml B- medium in the presence of the inducer naringenin (3·6 µM) and N-acetyl[14C]glucosamine. The 14C-labelled LCOs were analysed by TLC as described by Spaink et al. (1992)Down.

SDS-PAGE analysis of lipopolysaccharide.
Bacterial cultures were grown on solid TY medium or on solid MMB medium supplemented with adenine (or AICA-riboside) and thiamin. Bacterial cells were washed in 0·9 % NaCl and pelleted by centrifugation. The bacterial pellet was resuspended and lysed by heating at 100 °C in 125 µl 60 mM Tris/HCl (pH 6·8) containing 2 % (w/v) SDS and 1 mM EDTA for 5 min and then diluted to 1 ml with the same buffer without SDS. The bacterial crude extract was treated with RNase, DNase and proteinase K as described by Köpling et al. (1993)Down. The electrophoresis of crude bacterial extracts was performed on a 16·5 % (w/v) polyacrylamide gel with the Tricine buffer system described by Lesse et al. (1990)Down. For the detection of LPS, gels were stained with silver as described by Kittelberger & Hilbink (1993)Down.

Monoclonal antibodies (mAbs) and immunoblotting.
Production of mAbs against free-living cultures of HH103 or nodule-derived bacteroids followed previously published procedures (Lucas et al., 1996Down). Spleen cells derived from immunized male rats (Line LOU/IAP) were fused to the myeloma line IR983F. For immunoblotting experiments, mAbs that recognize HH103 LPS were derived from four culture supernatants. NB3-4.72 and NB3-4.79 (class IgG 2c) were two clones derived from the same hybridoma line originating from a rat immunized with a preparation of HH103 bacteroids, NB6-228.22 (Class IgG 2b) was also obtained following immunization with a bacteroid preparation, while NB7-242.33 (Class IgG 2c) was obtained following immunization with free-living cultures of HH103.

Polyacrylamide gels were electroblotted onto nitrocellulose sheets, using a Bio-Rad Semi-dry transblot apparatus at 20 V for 1 h at room temperature. Transfer buffer was 48 mM Tris/HCl, 39 mM glycine, containing 20 % (v/v) methanol and 0·0375 % (w/v) SDS (pH 8·0). Western-blotted sheets were immunostained with the appropriate mAb, using as the secondary antibody a goat anti-rat IgG conjugated to alkaline phosphatase.

NMR analyses of KPS.
KPS were isolated from S. fredii HH103 and its mutant SVQ295 as described by Gil-Serrano et al. (1999)Down. The samples containing KPS were deuterium-exchanged several times by freeze-drying from 2H2O and then examined in solution (4 mg ml-1) in 99·98 % 2H2O. Spectra were recorded at 303 K on a Bruker AMX 500 spectrometer operating at 500·13 MHz. Chemical shifts are given in p.p.m., using the 2H2O signal (4·75 p.p.m.) as reference.

Microscopic studies.
Small fragments of nodules and pseudonodules were fixed in 4 % (v/v) glutaraldehyde prepared in 0·1 M cacodylate buffer, pH 7·2, for 3 h at 4 °C and post-fixed in 1 % OsO4 for 2 h at 4 °C. Samples were dehydrated in an acetone series and embedded in Epon (epoxy embedding medium). Toluidine-blue-stained semi-thin sections (0·5 µm thick) were viewed in a Leitz (Aristoplan) light microscope.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation of Tn5-Mob mutants showing altered colony morphology
S. fredii HH103-1 was mutagenized with Tn5-Mob (Simon, 1984Down) and 80 000 NmR transconjugants were screened for alterations in colony morphology. One mutant, called SVQ295, was further investigated. SVQ295 harbours only one copy of Tn5-Mob, as indicated by hybridization experiments using a 0·9 kb PstI internal fragment of the kanamycin-resistance gene of Tn5-Mob as a probe (data not shown). It forms colonies that are translucent, produce more slime and absorb less Congo red than those of wild-type strain HH103-1. SVQ295 auto-agglutinates when grown in liquid TY, an indication that this mutant might be altered in its LPS, as reported for R. leguminosarum LPS mutants (Priefer, 1989Down). PAGE showed that the LPS I and LPS II regions of SVQ295 cultures grown on solid TY medium contain bands that migrate faster than those of its parental strain HH103-1 (Fig. 1DownA, lanes 2 and 1 respectively). On the other hand, the 1H-NMR spectra obtained for the KPS from S. fredii HH103 and from its mutant derivative SVQ295 appear to be very similar (Fig. 2Down). The LCO and plasmid profiles of mutant strain SVQ295 were also identical to those of its parental strain HH103-1 (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. LPS profiles of strains grown in TY medium, unless otherwise indicated. (A) Lane 1, HH103-1; lane 2, SVQ295; lane 3, SVQ295(pMUS509); lane 4, SVQ295(pJN382A); lane 5, SVQ295; lane 6, SVQ295(pCOS110). (B) Lane 1, HH103-1; lane 2, SVQ295; lane 3, SVQ295 (MMB medium supplemented with 0·5 mM AICA-riboside and thiamin); lane 4, SVQ295 (MMB medium supplemented with 0·1 mM AICA-riboside and thiamin); lane 5, SVQ295 (MMB medium supplemented with adenine and thiamin); lane 6, SVQ295 (TY medium supplemented with 0·5 mM AICA-riboside); lane 7, SVQ295 (TY medium supplemented with 0·1 mM AICA-riboside). (C) Lane 1, SVQ295; lane 2, SVQ526; lane 3, HH103-1.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. 1H-NMR spectra (500 MHz) obtained for the capsular polysaccharide from S. fredii HH103 (A) and SVQ295 (B).

 
Mutant SVQ295 does not grow in minimal medium (MMB) unless the bacterial culture is supplemented with thiamin and adenine or with thiamin and AICA-riboside, an intermediate of purine biosynthesis.

Although the doubling time of SVQ295 cultures grown in the presence of AICA-riboside is longer (approx. 9 h) than that in the presence of adenine (approx. 5 h), both bacterial cultures (with AICA-riboside or adenine) reached the same OD660 after 6 days of incubation (5x108 bacteria ml-1). Inoculation of MMB medium supplemented with adenine or AICA-riboside with SVQ295 previously grown in the presence of AICA-riboside showed again that bacteria grew faster in the presence of adenine than in the presence of AICA-riboside (data not shown). Mutant SVQ295 and its parental strain HH103-1 showed the same doubling time (135 min) in complete TY medium. The presence of adenine or AICA-riboside in SVQ295 cultures did not restore the wild-type LPS electrophoretic profile (Fig. 1BUp).

Identification of the mutated gene in SVQ295
Plasmid pSUP202 was used to clone the SVQ295 DNA region that is adjacent to the IS50R of transposon Tn5-Mob. Following the strategy described in Methods, a plasmid (pMUS375) that contained about 16 kb of the SVQ295 DNA that is adjacent to the IS50R of transposon Tn5-Mob was isolated. A XhoI fragment of pMUS375 that contains 485 bp of the IS50R and about 4 kb of SVQ295 DNA was subcloned into plasmid pBluescript. By using primer pdad2, a DNA fragment containing the last 120 bp of the IS50R and 500 bp of the adjacent rhizobial DNA was sequenced. Computer analysis of this sequence indicates homology with the purL gene of S. meliloti, which encodes a 5'-phosphoribosylformylglycinamidine synthase (FGAR amidotransferase, EC 6.3.5.3). This enzyme catalyses the step from FGAR (5'-phosphoribosyl-N-formylglycinamide) to FGAM (5'-phosphoribosyl-N-formylglycinamidine) in the biosynthetic purine pathway and it is essential for biosynthesis of both adenine and thiamin. These results are in accordance with the auxotrophic phenotype exhibited by mutant SVQ295.

Symbiotic properties of mutant SVQ295
SVQ295 induces Fix- pseudonodules on soybean cv. Williams. Microscopic analysis showed that plant cells of these pseudonodules were devoid of bacteria. Nodulation assays were carried out to investigate whether the addition of thiamin and/or adenine or AICA-riboside to the plant nutrient solution restored soybean nodulation ability of mutant SVQ295. Adenine, thiamin, or both together, did not enhance the symbiotic properties of mutant strain SVQ295 whereas 0·1 or 0·5 mM AICA-riboside enabled SVQ295 to form infected nodules that did not fix nitrogen and were smaller than those formed by HH103. Bacteria isolated from these nodules had the appropriate antibiotic resistance (StrR NmR) and were auxotrophic for adenine and thiamin.

The symbiotic properties of SVQ295 were also studied in other leguminous plants that establish nitrogen-fixing symbioses with the wild-type strain HH103-1. Mutant SVQ295 failed to nodulate Cajanus cajan, Indigofera tinctoria, Macrotyloma axillare, Albizia lebbek, Kummerowia stipulacea and Neonotonia wightii. It formed small ineffective nodules on Macroptilium atropurpureum. Although infected nodule cells were observed (Fig. 3DownD, E), bacteria were not recovered from these nodules. In contrast, SVQ295 was able to form nitrogen-fixing nodules on Glycyrrhiza uralensis (Fig. 3ADown) as demonstrated by acetylene reduction assays. G. uralensis nodules contained infected plant cells with a large centrally positioned vacuole (Fig. 3B, CDown) and bacteria isolated from these nodules showed the markers of SVQ295.



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 3. Nodulation phenotype of SVQ295. (A) Morphology of nodules induced by SVQ295 on Glycyrrhiza uralensis. Bar, 1 cm (B–E) Light microscopy of sections of nodules induced on G. uralensis by HH103-1 (B) and SVQ295 (C), and on Macroptilium atropurpureum by HH103-1 (D) and SVQ295 (E). Magnification: 63x in (B–D); 16x in (E).

 
Isolation and characterization of the purL gene of S. fredii HH103-1
For unknown reasons, it is often difficult to isolate cosmid clones that complement HH103 mutants by conjugational transfer of the HH103 genomic library to the recipient mutant. Because of this difficulty, an HH103 gene library, constructed in cosmid pLAFR1, was transferred to R. etli CE382, a derivative of CE3 containing Tn5 in purL (Newman et al., 1995Down). CE382 TcR KmR transconjugants were selected on MMB agar and a cosmid named pMUS509 was isolated from one of them. Cosmid pMUS509 was transferred (by transformation) to E. coli S17-1 and from this donor strain it was reintroduced (by conjugation) into R. etli CE382. Transconjugants carrying pMUS509 did not require the presence of adenine and thiamin to grow on MMB medium and were able to form nitrogen-fixing nodules on Phaseolus vulgaris.

Cosmids pMUS509, pCOS110 and pJN382A were transferred to S. fredii SVQ295. Cosmid pCOS110 carries the purYQL region of R. etli and pJN382A is a derivative of pCOS110 carrying Tn5 in purL. SVQ295 transconjugants carrying pMUS509 or pCOS110 were able to grow on MMB, demonstrating that the R. etli purL gene can complement the purL mutation of S. fredii HH103-1. SVQ295 carrying pMUS509, pCOS110 or pJN382A was tested for nodulation ability on soybean cv. Williams. Plants were grown in the presence or absence of thiamin. Soybean plants inoculated with SVQ295(pCOS110) or SVQ295(pMUS509) induced nitrogen-fixing nodules, while those inoculated with SVQ295(pJN382A) only formed Fix- pseudonodules. These results demonstrated that the mutation on the purL gene is responsible for the symbiotic-defective phenotype of mutant SVQ295. The presence of thiamin in the plant nutrient solution did not have any significant effect on bacterial nodulation.

A 3·2 kb BamHI fragment of cosmid pMUS509, which positively hybridized to a probe containing 0·5 kb of the SVQ295 DNA that is adjacent to the transposon IS50R in plasmid pMUS375, was subcloned into pBluescript. From the resultant plasmid a KpnI–BamHI 2870 bp fragment was sequenced (accession number AF275718). By matching this sequence with that obtained from the partial sequencing of pMUS375 using the IS50R primer pdad2, it was possible to position the transposon at nucleotide 832 of the final 2870 bp sequence.

The sequenced fragment contains one ORF with a high probability of encoding protein, as indicated by the Testcode algorithm. This ORF encodes a protein that is homologous to several PurL proteins of different organisms such as S. meliloti, Mesorhizobium loti and Agrobacterium tumefaciens (Table 2Down). purL begins at position 461 and extends for 2129 bp, encoding a deduced polypeptide of 743 amino acids with a predicted size of 79·1 kDa. The ORF is preceded by a putative ribosome-binding site, GAAGGA, at positions -19/-14. The sequence AGCGGCCGAACCGGCT at positions -229/-214 of the putative ATG start codon of the S. fredii purL gene shows similarities to the PurBox reported in Lactococcus lactis (Kilstrup et al., 1998Down). In addition, the sequence CGCAAAGCGCCCCCTGTTTGTGTTGCGGTTC at positions -90/-59 from the ATG codon resembles the E. coli PurBox (GGCAAACGGTTTCGTC) as defined by Sampei & Mizobuchi (1989)Down. DNA sequences upstream and downstream of the identified ORF do not show clear homology to any known gene. The abundance of stop codons in these two regions indicates that they should not contain any coding region.


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of HH103 PurL protein with PurL proteins from different organisms.

 
Serological studies on the LPS produced by S. fredii SVQ295
PAGE showed that SVQ295 carrying cosmid pMUS509 has an LPS profile that is indistinguishable from that of HH103-1 (Fig. 4DownA, lanes 3 and 1 respectively).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 4. Silver staining (A) and immunostaining (B–E) of LPS profiles from S. fredii strains using the mAbs NB3-4.72 (B), NB3-4.79 (C), NB-6-228.22 (D) and NB7-242.33 (E). Lanes: 1, HH103-1; 2, SVQ295; 3, SVQ295(pMUS509); 4, SVQ295(pCOS110).

 
Four mAbs raised against free-living cultures of HH103 (NB7-242.33) or nodule-derived bacteroids (NB3-4.72; NB3-4.79 and NB6-228.22) and that recognize the same pattern of bands that are visible in silver-stained LPS gels of S. fredii HH103 were tested for their reactivity against the LPS of mutant SVQ295. Fig. 4Up shows that the four mAbs reacted with the HH103-1 LPS bands corresponding to the LPS I and LPS II regions (lane 1 of panels B–E) but failed to recognize any LPS band in mutant strain SVQ295 (lane 2 of panels B–E). SVQ295 carrying pMUS509 or pCOS110 produced LPS that were fully recognized by all the assayed mAbs (lanes 3 and 4 of panels B–E).

Co-inoculation experiments
We investigated the effect of co-inoculating soybean plants with SVQ295 and the S. fredii HH103 nodA mutant SVQ116, which cannot produce nodulation factors (LCOs) (Buendía-Clavería et al., 1996Down). Hence, the inoculum mixture was composed of a mutant (SVQ295) that produces LCOs but is unable to infect soybean roots and another one (SVQ116) that should be infective but is totally unable to trigger nodule development. Soybean plants growing in a plant nutritive solution containing adenine were also inoculated with SVQ295 or with SVQ295 and SVQ116.

As expected, single inoculation with SVQ295 only induced pseudonodules on soybean. In this experiment, however, SVQ295 was able to induce non-nitrogen-fixing nodules on soybean when adenine was added to the plant nutritive solution. Soybean plants inoculated with both mutants (in the presence or absence of adenine) formed a mixture of pseudonodules and true nitrogen-fixing nodules (Table 3Down). No colonies were formed when nodules were directly crushed on TY medium containing streptomycin (chromosomal marker of SVQ295). All bacterial isolates (900 colonies tested) from nodules crushed on TY medium showed the markers of SVQ116 (Rifr, Kmr, Strs and prototrophy). These results demonstrate that, regardless of the presence or absence of adenine, only the prototrophic LCO- mutant SVQ116 was able to penetrate into the plant cells.


View this table:
[in this window]
[in a new window]
 
Table 3. Co-inoculation of soybean plants cv. Williams with S. fredii mutants SVQ116 and SVQ295 in the presence or absence of adenine

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous reports have clearly shown that purine auxotrophic mutants of (Sino)Rhizobium are symbiotically defective, forming Fix- pseudonodules that show centrally located vascular bundles (Pankhurst & Schwinghamer 1974Down; Denarié et al., 1976Down; Pain, 1979Down; Noel et al., 1984Down, 1988Down; Newman et al., 1992Down, 1995Down; Djordjevic et al., 1996Down).

A possible explanation for the linking of purine auxotrophy and symbiotic deficiency is that, during nodule formation, adenine might act as a precursor for cytokinins, which are N-6 substituted derivatives of adenine (Pankhurst & Schwinghamer, 1974Down; Pain, 1979Down). This possibility does not exclude that adenine auxotrophs might suffer other alterations that, for any reason, could prevent normal nodule development. In fact, purine auxotrophs usually exhibit pleiotropic phenotypes that indicate the occurrence of multiple alterations of the bacterial physiology. For instance, R. etli purine auxotrophs expressed, in free-living conditions, higher levels of the fixNOQP operon, which codes for the symbiotic cytochrome terminal oxidase ccb3 (Soberon et al., 1997Down). Moreover, Rhizobium sp. NGR234 purY and purF mutants exhibited multiple differences in gene expression when compared to the parental wild-type strain (Guerreiro et al., 1998Down).

In this investigation we have studied an auxotrophic mutant of S. fredii HH103 that was isolated in a screen for the appearance of alterations in colony morphology. Mutant SVQ295 requires adenine and thiamin for growth in minimal media, which is in agreement with the fact that the reaction catalysed by the PurL enzyme occurs before AICAR in the biosynthetic pathway for purines (Neuhard & Nygaard, 1987Down). In addition, SVQ295 can also grow in minimal media if the supplementation with adenine is replaced by the purine precursor AICA-riboside. Although SVQ295 cultures grown in the presence of 0·5 mM AICA-riboside showed a longer doubling time than that observed in MMB medium with adenine, the final optical density was the same in both bacterial cultures (with AICA-riboside or adenine). Fully grown SVQ295 cultures in the presence of AICA-riboside did not contain ade+ revertants, since bacterial subcultures failed to grow in MMB medium devoid of adenine or AICA-riboside. Hence, we conclude that AICA-riboside can indeed act as a purine source for pur mutants. Previous reports showed that pur mutants of S. fredii HH303 and R. leguminosarum bv. viciae 128C53 grew poorly 18 h after the addition of AICA-riboside (Newman et al., 1994Down). Our results also support this observation, since an initial population of approximately 4x105 bacteria ml-1 in MMB supplemented with AICA-riboside did not show any increase after 5 h incubation and only increased to 7x105 bacteria ml-1 after 18 h. Hence, the latency period exhibited by SVQ295 cultures in the presence of AICA-riboside and their long doubling time may explain the poor growth of these pur mutants during their first hours of incubation in the presence of AICA-riboside. However, after 18 h incubation, a purF mutant of R. etli did not show poor growth in minimal medium supplemented with AICA-riboside (Newman et al., 1994Down).

Mutant SVQ295 failed to nodulate six different legumes (see Results), and formed pseudonodules on G. max. On Macroptilium atropurpureum, small ineffective nodules were formed. Bacterial release in M. atropurpureum nodules was only observed in a few clustered plant cells (Fig. 3EUp). In Glycyrrhiza uralensis, however, bacterial release was much more extended through the nodule tissue and nitrogenase activity was detected (Fig. 3CUp). This variable symbiotic phenotype of SVQ295 might be due to the differential ability of each legume host in supplying purine, or purine precursors, to the bacteria during the nodulation process. The fact that G. uralensis forms indeterminate nodules (Fig. 3AUp) is not relevant to the ability of SVQ295 to infect nodule cells, since Albizia lebbek also forms indeterminate nodules (with the parental strain HH103) but fails to nodulate with the purL mutant.

Previous reports have clearly shown that the addition of AICA-riboside to the plant nutritive solution promotes nodulation ability of different rhizobial pur mutants (Newman et al., 1994Down, 1995Down; Djordjevic et al., 1996Down). In addition to supporting these observations our results also show that, in long-term experiments (82 days), the addition of adenine can also promote the formation of small soybean nodules by mutant SVQ295. This late nodulation appears to be the consequence of the exogenous addition of adenine to the plant root medium because, in the absence of adenine, soybean plants inoculated with SVQ295 only formed pseudonodules (Table 3Up).

Mutant SVQ295 carries a transposon Tn5-Mob insertion between nucleotides 831 and 832 of the sequenced DNA fragment, which corresponds to the 5' end of a 2690 bp ORF showing homology to the purL gene of S. meliloti. This ORF would encode a putative polypeptide of 743 amino acids, clearly shorter than the E. coli PurL protein (1295 amino acids). The assumption that SVQ295 is mutated in its purL gene is supported by the fact that the mutant was complemented by cosmid pCOS110 (it carries R. etli purYQL genes), but not by cosmid pJN382A (a derivative of pCOS110 carrying a Tn5 insertion in the purL gene).

In E. coli, the purL gene encodes a 5'-phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) that catalyses the conversion of 5'-phosphoribosyl-N-formylglycinamide into 5'-phosphoribosyl-N-formylglycinamidine (Sampei & Mizobuchi, 1989Down). In Bacillus subtilis and Lactobacillus casei, however, this enzyme is formed by the products of two different genes, purQ and purL (Ebbole & Zalkin, 1989Down; Peltonen & Mäntsälä, 1999Down). The PurL enzyme in E. coli has three different domains, I, II and III, which have been assigned as potential ATPase, triosephosphate-isomerase-like isomerase, and glutaminase, respectively (Sampei & Mizobuchi, 1989Down). The E. coli PurL domain III aligns with the B. subtilis and L. casei PurQ protein, while domains I and II align with the PurL protein of B. subtilis, L. casei and S. fredii HH103. This indicates that S. fredii HH103 might also need at least two different genes for the formation of a functional FGAR amidotransferase. Other bacteria, such as Methanococcus jannaschii, Mycobacterium tuberculosis and Synechocystis sp. also appear to have a multi-subunit form of the FGAR amidotransferase enzyme (Bult et al., 1996Down; Jackson et al., 1996Down; Kaneko et al., 1996Down). In all these cases, in which the enzyme appears to be composed of different subunits, the ORF defined as purL encodes a polypeptide of 705–777 amino acids, which is clearly shorter than the FGAR amidotransferase (1295 amino acids) encoded by the purL gene of E. coli (Table 2Up).

The L. casei and B. subtilis purQ and purL genes belong to an operon composed of a cluster of other purine genes, while the E. coli purL gene constitutes a single transcriptional unit which is independent of other purine genes. The purL of S. fredii HH103 also appears to constitute a single transcriptional unit, since putative ORFs were not found upstream (460 bp) or downstream (178 bp) of the purL gene.

The fact that colonies produced by mutant SVQ295 in complete TY medium differ in morphology from those formed by its prototrophic parental strain HH103-1 prompted us to investigate the existence of possible alterations in surface polysaccharides. S. fredii HH103 produces a capsular homopolysaccharide (also called K-antigen polysaccharide, or KPS) in which the repeating unit is a derivative of the pseudaminic acid (Gil-Serrano et al., 1999Down). NMR analyses of the KPS produced by mutant SVQ295 showed a spectrum that was similar to that previously reported for its parental strain HH103 (Fig. 2Up). Hence, we conclude that a major change in the structure has not occurred, although other changes (such as subtle alterations or differences in the level of polymerization) cannot be discarded.

In contrast, the LPS electrophoretic profile of mutant SVQ295 is distinct from that shown by HH103-1 (Fig. 1Up), a clear indication that the purL mutation has affected the bacterial LPS structure. This possible alteration in the LPS produced by SVQ295 was further confirmed by the finding that four mAbs that react against the HH103 LPS failed to recognize the LPS produced by the pur mutant. The presence of cosmids pMUS509 and pCOS110 in SVQ295 restored the wild-type LPS electrophoretic profile and also the presence of epitopes recognized by the four mAbs (Figs 1 and 4UpUp). Since these two cosmids also corrected the purine auxotrophy and restored effective nodulation on soybean, we conclude that the purL mutation is actually responsible for the pleiotropic phenotype exhibited by mutant SVQ295. The fact that cosmid pJN382A (a derivative of cosmid pCOS110 carrying a Tn5 insertion in the purL gene) failed to correct the LPS profile of mutant SVQ295 supports this hypothesis. The PurL protein acts in the purine biosynthetic pathway before the formation of AIR (5'-phosphoribosyl-5-aminoimidazole), an intermediate compound from which a pathway for thiamin biosynthesis emerges. This fact explains why purL mutants require the presence of adenine and thiamin to grow in minimal medium. We have isolated another HH103 derivative (SVQ526) that forms Fix- pseudonodules on Glycine max and requires the presence of adenine, but not thiamin, to grow in minimal medium. The gene mutated in SVQ526 has not been identified. The LPS profile of mutant SVQ526 is clearly different from that shown by mutant SVQ295 (Fig. 1CUp, lane 2). Although the LPS profile of SVQ526 appears similar to that of its wild-type parent HH103 (Fig. 1CUp, lanes 2 and 3), some differences can be observed, suggesting that the LPS of mutant SVQ526 has also suffered some alterations. Alterations of the SVQ295 and SVQ526 LPS were detected in bacteria cultures grown on complete TY medium; therefore a functional purine biosynthetic pathway appears to be necessary for the production of LPS showing the wild-type electrophoretic profile and for the expression of epitopes recognized by the mAbs assayed.

Previous reports have shown that a purY mutant (ANU2866) of Rhizobium sp NGR234 does not show any apparent alteration in the electrophoretic profile of its LPS. However, a purM mutant of NGR234 (ANU2861) produces a LPS that differs from that of the wild-type strain (Djordjevic et al., 1996Down). The presence of AICA-riboside in ANU2861 cultures eliminated these differences, in contrast to our observation that AICA-riboside does not restore the wild-type LPS electrophoretic profile in S. fredii SVQ295. All these results show that although the mentioned pur genes (purM and purY of NGR234 and purL of S. fredii) code for enzymes acting before the formation of AICAR, their respective mutants exhibit differences in their pleiotropic phenotypes. It is also possible that the effect of pur mutations on rhizobial surface polysaccharides varies among different strains even if they are closely related, such as S. fredii and Rhizobium sp. NGR234.

LPS-defective mutants of R. leguminosarum triggered a host defence response in pea and induced ineffective nodules (Perotto et al., 1994Down). Similarly, the LPS defective purM mutant of NGR234 also induced on Macroptilium atropurpureum a reaction analogous to a hypersensitive response at the site of infection (Djordjevic et al., 1988Down). These facts suggest that it is possible that the defective symbiotic response of SVQ295 on soybean and other legumes might be due to a combinative effect of the purine auxotrophy and bacterial LPS alterations.

In general, co-inoculation of legume plants with Exo- and Nod- mutants results in the formation of nodules that are always occupied by both bacterial strains (Klein et al., 1988Down; Müller et al., 1988Down; Kapp et al., 1990Down). These results led to the notion that the successful formation of nodules required the cooperation of both co-inoculants during the whole nodulation process. However, Djordjevic et al. (1996)Down described that M. atropurpureum plants co-inoculated with purM and exoY mutants of NGR234 (ANU2861 and ANU2811, repectively) formed Fix- nodules that only contained the exoY co-inoculant. In addition, no nodules were formed when ANU2861 and ANU265 (a pSym- derivative of NGR234) were used as co-inoculants.

In this report we show that co-inoculation of soybean plants with mutants SVQ295 and SVQ116 (a nodA derivative of S. fredii HH103) produced nodules that were only occupied by the non-nodulating nodA mutant. Although the results presented in Table 3Up correspond to soybean plants analysed 82 days after inoculation, it is not a requisite to grow soybean plants for such a long time to find nodules formed by co-inoculation with SVQ295 and SVQ116. In additional experiments we have found that a few nodules can be formed 24 days after inoculation (data not shown). Although pur mutants can enable exo or nod mutants to penetrate inside the root and to invade plant cells, the former appears to be outcompeted by the prototrophic co-inoculant. This circumstance makes pur mutants a very suitable ‘launcher strain’ for introducing into legume nodules certain rhizobial mutants that, by themselves, are not able to infect plant roots. In general, rhizobial mutants affected at very early events of the nodulation process cannot be investigated for their behaviour at late nodulation stages. Since the ‘pur-mutant launchers' appear to be absent inside the nodules, the behaviour of the non-infective co-inoculant can be studied inside the nodules.


    ACKNOWLEDGEMENTS
 
This work was supported by the Comisión Interministerial de Ciencia y Tecnología grant BIO99-0614-C03 and the PAI-II scientific programme of the Andalusian government. We are grateful to Teresa Cubo for providing strain SVQ116 and to Rocío Gutiérrez for technical assistance with the LPS work. We also thank Josep Casadesús for critical reading of the manuscript.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Barsomian, G. D., Urzainqui, A., Lohman, K. & Walker, G. C. (1992). Rhizobium meliloti mutants unable to synthesize anthranilate display a novel symbiotic phenotype. J Bacteriol 174, 4416–4426.[Abstract/Free Full Text]

Becker, A. & Pühler, A. (1998). Production of exopolysaccharides. In The Rhizobiaceae: Molecular Biology of Model Plant-associated Bacteria, pp. 97–118. Edited by H. P. Spaink, A. Kondorosi & P. J. J. Hooykaas. Dordrecht: Kluwer.

Bergensen, F. J. (1961). The growth of Rhizobium in synthetic media. Aust J Biol Sci 14, 349–360.

Beringer, J. E. (1974). R factor transfer in Rhizobium leguminosarum. J Gen Microbiol 84, 188–198.[Abstract/Free Full Text]

Beringer, J. E., Brewin, N. J. & Johnston, A. W. B. (1980). The genetic analysis of Rhizobium in relation to symbiotic nitrogen fixation. Heredity 45, 161–186.[CrossRef]

Beringer, J. E., Ruiz-Sainz, J. E. & Johnston, A. W. B. (1984). Methods for the genetic manipulation of Rhizobium. In Microbiological Methods for Environmental Biotechnology, pp. 79–94. Edited by J. M. Grainger & J. M. Lynch. Orlando, FL: Academic Press.

Boyer, H. W. & Roulland-Dussoix, D. (1969). Complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41, 459–472.[CrossRef][Medline]

Buendía-Clavería, A. M., Ruiz-Sainz, J. E., Cubo-Sánchez, T. & Pérez Silva, J. (1986). Studies of symbiotic plasmids in Rhizobium trifolii and fast-growing bacteria that nodulate soybean. J Appl Bacteriol 17, 155–160.

Buendía-Clavería, A. M., Chamber, M. & Ruiz-Sainz, J. E. (1989). A comparative study of the physiological characteristics, plasmid content and symbiotic properties of different Rhizobium fredii in European soils. Syst Appl Bacteriol 17, 155–160.

Buendía-Clavería, A. M., Moussaid, A., Moreno, F. J., Cubo, T., Torres, A., Pueppke, S. & Ruiz-Sainz, J. E. (1996). Características fisiológicas y simbióticas de un mutante de Rhizobium fredii auxótrofo para la adenina y la tiamina. In Avances en la Investigación sobre Fijación Biológica de Nitrógeno, pp. 233–235. Edited by A. Chordi Corbo, E. Martínez Molina, P. F. Mateos González & M. E. Velázquez Pérez. Excma. Diputación Provincial de Salamanca. ISBN 84-7797-113-7.

Bult, C. J., White, O., Olsen, C. J. & 20 other authors (1996). Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273, 1058–1073.[Abstract]

Day, B. R., Loh, J. T., Cohn, J. & Stacey, G. (2000). Signal exchange involved in the establishment of the Bradyrhizobium legume symbiosis. In Prokaryotic Nitrogen Fixation: a Model System for the Analysis of a Biological Process, pp. 385–415. Edited by E. W. Triplett. Wymondham, UK: Horizon Scientific Press.

Denarié, J., Truchet, G. & Bergeron, B. (1976). Effects of some mutations on symbiotic properties of Rhizobium. In Symbiotic Nitrogen Fixation in Plants, pp. 47–61. Edited by P. S. Nutman. Cambridge: Cambridge University Press.

Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12, 387–395.

Djordjevic, S. P., Ridge, R. W., Chen, H., Redmond, J. W., Batley, M. & Rolfe, B. G. (1988). Induction of pathogenic-like responses in the legume Macroptilium atropurpureum by a transposon-induced mutant of the fast-growing, broad-host-range Rhizobium strain NGR234. J Bacteriol 170, 1848–1857.[Abstract/Free Full Text]

Djordjevic, S. P., Weinman, J. J., Redmond, J. W., Djordjevic, M. A. & Rolfe, B. G. (1996). The addition of 5-aminoimidazole-4-carboxamide-riboside to nodulation-defective purine auxotrophs of NGR234 restores bacterial growth but leads to novel root outgrowths on siratro. Mol Plant–Microbe Interact 9, 114–124.

Ebbole, D. J. & Zalkin, H. (1989). Bacillus subtilis pur operon expression and regulation. J Bacteriol 171, 2136–2141.[Abstract/Free Full Text]

Fisher, R. F. & Long, S. R. (1992). Rhizobium–plant signal exchange. Nature 357, 655–660.[CrossRef][Medline]

Gil-Serrano, A. M., Rodríguez-Carvajal, M. A., Tejero-Mateo, P., Espartero, J. L., Menéndez, M., Corzo, J., Ruiz-Sainz, J. E. & Buendía-Clavería, A. M. (1999). Structural determination of a 5-acetamido-3,5,7,9-tetradeoxy-7-(3-hydroxybutyramido)-L-glycero-L-manno-nonulosonic acid-containing homopolysaccharide isolated from Sinorhizobium fredii HH103. Biochem J 342, 527–535.

Guerreiro, N., Worland, S., Djordjevic, M. A. & Rolfe, B. G. (1998). Pleiotrophic alterations in the cellular protein synthesis of Tn5-induced Rhizobium mutants as revealed by two-dimensional gel electrophoresis. In Biological Nitrogen Fixation for the 21st Century, p. 285. Edited by C. Elmerich, A. Kondorosi & W. E. Newton. Dordrecht: Kluwer.

Jackson, M., Berther, F. X., Otal, I., Rauzier, J., Martin, C., Gicquel, B. & Guilhot, C. (1996). The Mycobacterium tuberculosis purine biosynthetic pathway: isolation and characterization of the purC and purL genes. Microbiology 14, 2439–2447.

Kaneko, T., Sato, S., Kotani, H. & 21 other authors (1996). Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3, 109–136.[Abstract]

Kannenberg, E. L. & Carlson, R. W. (2001). Lipid A and O-chain modifications cause Rhizobium lipopolysaccharides to become hydrophobic during bacteroid development. Mol Microbiol 39, 379–391.[CrossRef][Medline]

Kannenberg, E. L., Reuhs, B. L., Fosberg, L. S. & Carlson, R. W. (1998). Lipopolysaccharide and K-antigens: their structures, biosynthesis and functions. In The Rhizobiaceae: Molecular Biology of Model Plant-associated Bacteria, pp. 119–154. Edited by H. P. Spaink, A. Kondorosi & P. J. J. Hooykaas. Dordrecht: Kluwer.

Kapp, D., Niehaus, K., Quandt, J., Müller, P. & Pühler, A. (1990). Cooperative action of Rhizobium meliloti nodulation and infection mutants during the process of forming mixed infected alfalfa nodules. Plant Cell 2, 139–151.[Abstract/Free Full Text]

Kilstrup, M., Jessing, S. G., Wichmand-Jorgensen, S. B., Madsen, M. & Nilsson, D. (1998). Activation control of pur gene expression in Lactococcus lactis: proposal for a consensus activator binding sequence based on deletion analysis and site-directed mutagenesis of purC and purD promoter regions. J Bacteriol 180, 3900–3906.[Abstract/Free Full Text]

Kim, C. H., Kuykendall, L. D., Shah, K. S. & Keister, D. L. (1988). Induction of symbiotically defective auxotrophic mutants of Rhizobium fredii HH303 by transposon mutagenesis. Appl Environ Microbiol 54, 423–427.[Abstract/Free Full Text]

Kittelberger, R. & Hilbink, F. (1993). Sensitive silver-staining detection of bacterial lipopolysaccharides in polyacrylamide gels. J Biochem Biophys Methods 26, 81–86.[CrossRef][Medline]

Klein, S., Hirsch, A. M., Smith, C. A. & Signer, E. R. (1988). Interaction of nod and exo Rhizobium meliloti in alfalfa nodulation. Mol Plant–Microbe Interact 1, 94–100.[Medline]

Köplin, R., Wang, G., Hötte, B., Priefer, U. B. & Pühler, A. (1993). A 3·9-kb DNA region of Xanthomonas campestris pv campestris that is necessary for lipopolysaccharide production encodes a set of enzymes involved in the synthesis of dTDP-rhamnose. J Bacteriol 175, 7786–7792.[Abstract/Free Full Text]

Lamrabet, Y., Bellogín, R. A., Cubo, T. & 11 other authors (1999). Mutation in GDP-fucose synthesis genes of Sinorhizobium fredii alters Nod factors and significantly decreases competitiveness to nodulate soybeans. Mol Plant–Microbe Interact 12, 207–217.[Medline]

Lesse, A. J., Campagnari, A. A., Bittner, W. E. & Apicella, M. A. (1990). Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulfate-polyacrylamide gel-electrophoresis. J Immunol Methods 126, 109–117.[CrossRef][Medline]

Lucas, M. M., Peart, J. L., Brewin, N. J. & Kannenberg, E. L. (1996). Isolation of monoclonal antibodies reacting with the core component of lipopolysaccharide from Rhizobium leguminosarum strain 3841 and mutant derivatives. J Bacteriol 178, 2727–2733.[Abstract/Free Full Text]

Madinabeitia, N., Bellogín, R. A., Buendía-Clavería, A. M. & 11 other authors (2002). Sinorhizobium fredii HH103 has a truncated nolO gene due to a -1 frameshift mutation that is conserved among other geographically distant S. fredii strains. Mol Plant–Microbe Interact 15, 150–159.[Medline]

Maniatis, T. A., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Müller, P., Hynes, M., Kapp, D., Niehaus, K. & Pühler, A. (1988). Two classes of Rhizobium meliloti infection mutants differ in exopolysaccharide production and in coinoculation properties with nodulation mutants. Mol Gen Genet 211, 17–26.[CrossRef]

Neuhard, J. & Nygaard, P. (1987). Purines and pyrimidines. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, pp. 445–473. Edited by F. C. Neidhardt and others. Washington, DC: American Society for Microbiology.

Newman, J. D., Schultz, B. W. & Noel, K. D. (1992). Dissection of nodule development by supplementation of Rhizobium leguminosarum biovar phaseoli purine auxotrophs with 4-aminoimidazole-5-carboxamide riboside. Plant Physiol 99, 401–408.[Abstract/Free Full Text]

Newman, J. D., Diebold, R. J., Schultz, B. W. & Noel, K. D. (1994). Infection of soybean and pea nodules by Rhizobium spp. purine auxotrophs in the presence of 5-aminoimidazole-4-carboxamide riboside. J Bacteriol 176, 3286–3294.[Abstract/Free Full Text]

Newman, J. D., Rosovitz, M. J. & Noel, K. D. (1995). Requirement for rhizobial production of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) for infection of bean. Mol Plant–Microbe Interact 8, 407–414.

Noel, K. D., Sánchez, A., Fernández, L., Leemans, J. & Cevallos, M. A. (1984). Rhizobium phaseoli symbiotic mutants with transposon Tn5 insertions. J Bacteriol 158, 148–155.[Abstract/Free Full Text]

Noel, K. D., Diebold, R. J., Cava, J. R. & Brink, B. A. (1988). Rhizobial purine and pyrimidine auxotrophs: nutrient supplementation, genetic analysis, and the symbiotic requirement for de novo purine biosynthesis. Arch Microbiol 149, 499–506.[CrossRef]

Pain, A. N. (1979). Symbiotic properties of antibiotic-resistant and auxotrophic mutants of Rhizobium leguminosarum. J Appl Bacteriol 47, 53–64.

Pankhurst, C. E. & Schwinghamer, E. A. (1974). Adenine requirement for nodulation of pea by an auxotrophic mutant of Rhizobium leguminosarum. Arch Microbiol 100, 219–238.[CrossRef]

Peltonen, T. & Mäntsälä, P. (1999). Isolation and characterization of a purC(orf)QLF operon from Lactococcus [correction of Lactobacillus] lactis MG1614. Mol Gen Genet 261, 31–41.[CrossRef][Medline]

Perotto, S., Brewin, N. J. & Kannenberg, E. L. (1994). Cytological evidence for a host defense response that reduces cell and tissue invasion in pea nodules by lipopolysaccharide-defective mutants of R. leguminosarum strain 3841. Mol Plant–Microbe Interact 7, 99–112.

Priefer, U. B. (1989). Genes involved in lipopolysaccharide production and symbiosis are clustered on the chromosome of Rhizobium leguminosarum biovar viciae VF39. J Bacteriol 171, 6161–6168.[Abstract/Free Full Text]

Reuhs, B. L., Geller, D. P., Kim, J. S., Fox, J. E., Kumar Kolli, V. S. & Pueppke, S. G. (1998). Sinorhizobium fredii and Sinorhizobium meliloti produce structurally conserved lipopolysaccharides and strain-specific K antigens. Appl Environ Microbiol 64, 4930–4938.[Abstract/Free Full Text]

Reuhs, B. L., Stephens, S. B., Geller, D. P., Kim, J. S., Glenn, J., Przytycki, J. & Ojanen-Reuhs, T. (1999). Epitope identification for a panel of anti-Sinorhizobium meliloti monoclonal antibodies and application to the analysis of K antigens and lipopolysaccharides from bacteroids. Appl Environ Microbiol 65, 5186–5191.[Abstract/Free Full Text]

Sampei, G. & Mizobuchi, K. (1989). The organization of the purL gene encoding 5'-phosphoribosylformylglycinamide amidotransferase of Escherichia coli. J Biol Chem 264, 21230–21238.[Abstract/Free Full Text]

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 74, 5463–5467.[Abstract/Free Full Text]

Simon, R. (1984). High frequency mobilization of gram-negative bacterial replicons by the in vivo constructed Tn5-Mob transposon. Mol Gen Genet 196, 413–420.[CrossRef][Medline]

Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1, 784–791.[CrossRef]

Soberon, M., Lopez, O., Miranda, J., Tabche, M. L. & Morera, C. (1997). Genetic evidence for 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) as a negative effector of cytochrome terminal oxidase cbb3 production in Rhizobium etli. Mol Gen Genet 254, 665–673.[CrossRef][Medline]

Spaink, H. P., Aarts, A., Stacey, G., Bloemberg, G. V., Lugtenberg, B. J. J. & Kennedy, E. P. (1992). Detection and separation of Rhizobium and Bradyrhizobium Nod metabolites using thin-layer chromatography. Mol Plant–Microbe Interact 5, 72–80.[Medline]

Vincent, J. M. (1970). A Manual for the Practical Study of Root Nodule Bacteria. Oxford, UK: Blackwell Scientific Publications.

Received 5 November 2002; revised 13 March 2003; accepted 18 March 2003.


This article has been cited by other articles:


Home page
MicrobiologyHome page
F. J. Lopez-Baena, J. M. Vinardell, F. Perez-Montano, J. C. Crespo-Rivas, R. A. Bellogin, M. d. R. Espuny, and F. J. Ollero
Regulation and symbiotic significance of nodulation outer proteins secretion in Sinorhizobium fredii HH103
Microbiology, June 1, 2008; 154(6): 1825 - 1836.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Okazaki, Y. Hattori, and K. Saeki
The Mesorhizobium loti purB Gene Is Involved in Infection Thread Formation and Nodule Development in Lotus japonicus
J. Bacteriol., November 15, 2007; 189(22): 8347 - 8352.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
B. W. Davies and G. C. Walker
Identification of Novel Sinorhizobium meliloti Mutants Compromised for Oxidative Stress Protection and Symbiosis
J. Bacteriol., March 1, 2007; 189(5): 2110 - 2113.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buendía-Clavería, A. M.
Right arrow Articles by Ruiz-Sainz, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buendía-Clavería, A. M.
Right arrow Articles by Ruiz-Sainz, J. E.
Agricola
Right arrow Articles by Buendía-Clavería, A. M.
Right arrow Articles by Ruiz-Sainz, J. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2003 Society for General Microbiology.