|
|
||||||||

1 Département de Génétique et Microbiologie, CMU, 9, Avenue de Champel, CH-1211 Genève, Switzerland
2 Departement für Chemie und Biochemie, Freiestrasse 3, Universität Bern, CH-3012, Bern, Switzerland
3 Arpida AG, Dammstrasse 36, CH-4142, Münchenstein, Switzerland
Correspondence
Seema Mukhija
smukhija{at}arpida.ch
| ABSTRACT |
|---|
|
|
|---|
Present address: Department of Research Policy, Erasmus University Medical Center Rotterdam, PO Box 1738, 3000 DR Rotterdam, The Netherlands.
| INTRODUCTION |
|---|
|
|
|---|
|
| METHODS |
|---|
|
|
|---|
|
ptsI was constructed as follows. A lysate of bacteriophage P22 was prepared on Sal. typhimurium PP1591 and used to transduce the ptsI421 : : Tn10 allele into the mouse-pathogenic strain ATCC 14028. Transductants were selected on mineral salts agar supplemented with 10 µg tetracycline ml-1 and 1 % glycerol. Sal. typhimurium ATCC 14028
ptsI formed yellow colonies on MacConkey indicator plates supplemented with glucose, mannose and N-acetylglucosamine, indicating that it had lost PTS sugar transport activity.
Sta. aureus SA70
ptsI was constructed as follows. A 5' DNA fragment of ptsI (SWISS-PROT accession no. P51183) was PCR-amplified from genomic DNA with primers AATGGATCCTAGGTGCTATAATAGTTTT and CCTTGTACGAATTCTTTATTTAATTGAG (restriction sites are underlined). A 3' fragment was similarly amplified with primers GTATCTGCAGATATAGAACTGAGTTTTTAT and GCACAGTCGACTGCACGGTTAGCAAGTT. The two fragments were sequentially inserted into the multiple cloning site of the E. coliStaphylococcus shuttle vector pBT2 (Bruckner, 1997
). The erythromycin resistance cassette isolated by digestion of plasmid pEC7 (Bruckner, 1997
) with EcoRI and PstI was then inserted between the cloned 5' and 3' fragments of ptsI in pBT2 (Fig. 2
). Sta. aureus SA70 was electroporated with the recombinant shuttle plasmid (Gibco-BRL Cell Porator capacitance; 60 µF and voltage booster at 2 k
) and transformants were selected on LB agar plates supplemented with 20 µg chloramphenicol ml-1. Cells from a single colony were grown at 30 °C to late-stationary phase in TSB containing 10 µg erythromycin ml-1. The culture was then diluted 1 : 100 into 500 ml fresh TSB containing 2·5 µg erythromycin ml-1 and incubated at 40 °C until stationary phase. This enrichment culture was repeated once more in the presence of erythromycin and then one time in the absence of erythromycin always at 40 °C. Cells from the stationary-phase culture were plated on TSA plates supplemented with 2·5 µg erythromycin ml-1 and incubated at 37 °C. Colonies were gridded on plates supplemented with 2·5 µg erythromycin ml-1 and 20 µg chloramphenicol ml-1, respectively. Of the erythromycin-resistant colonies, 5 % were chloramphenicol-sensitive and scored as ptsI knockouts. Sugar utilization ability of the wild-type and ptsI mutant was checked by acid production on dehydrocholic acid/neutral red medium as described by Morse et al. (1958)
. The interruption of the ptsI by the erythromycin cassette was confirmed by PCR.
|
ptsI was constructed as follows. A 1·6 kb 5' DNA fragment of the ptsHIcrr operon (SWISS-PROT P43921, P43922) was PCR-amplified from genomic DNA with primers GGGGGGGAATTCAATCAAATAATGCGAAAACAT and GGGGGGGGATCCTGCGTCAATTTGATCATCA (restriction sites are underlined). A 1·2 kb 3' fragment was similarly amplified with primers GGGGGGGTCGACTGCAGAAATTGATCAATTAAT and GGGGGGCATGCGAAGATTGTTGCTAATGCA. The kanamycin-resistance gene from plasmid pACYC177 was PCR-amplified with primers GGGGGGGATCCTCAACTCAGCAAAAGTTC and GGGGGGGTCGACGTGATCTGATCCTTCAAC. The PCR primers were designed based on the DNA sequence of ptsI (Fleischmann et al., 1995
ptsI : : kan. H. influenzae ATCC 10211 was made competent in M-IV medium and transformed with pJF
ptsI : : kan by glycerol stimulation (Stuy & Walter, 1986
Mice and infection procedures.
Wild-type and mutant strains were passaged three times and recovered from the spleens of infected mice, prior to virulence tests. Three-week-old female BALB/c mice (University of Geneva Hospital) were inoculated in quintuplicate intraperitoneally (i.p.) with 0·5 ml of the serially diluted bacterial suspensions. The exact dose (c.f.u. ml-1) was measured by serial dilution and plating of the bacterial suspensions which were used for injection. Mice were inspected regularly for signs of disease and death over 214 days (dependent on the model) and were killed thereafter. These experiments were performed in accordance with the institutional guidelines for animal care.
Sal. typhimurium was grown overnight at 37 °C in 5 ml LB medium, diluted 1 : 100 in 30 ml fresh prewarmed LB medium supplemented with 100 mM NaCl medium and grown to OD600 of 1. Bacteria were collected by centrifugation (4000 g, 5 min at room temperature), resuspended and serially diluted in PBS.
Sta. aureus was grown overnight at 37 °C on LuriaBertani (LB) to approximately 3x108 c.f.u. ml-1, collected by centrifugation and resuspended to 8x109 c.f.u. ml-1 in PBS at room temperature. The bacterial suspensions were diluted in PBS and mixed 1 : 1 with 4 % sterile porcine stomach mucin (Sigma) just before injection.
H. influenzae were grown overnight at 37 °C on BHI plates containing 10 µg haemin ml-1, 2 µg NAD ml-1 and 1 : 100 IsoVitaleX (Becton Dickinson). After 24 h incubation at 37 °C, bacteria were collected by washing of the plates with PBS, serially diluted in PBS and mixed with an equal volume containing 4 % sterile porcine stomach mucin and 4 % haemoglobin (Sigma) just before injection (Brodeur et al., 1986
).
Macrophage infection in vitro.
Intracellular survival of Sal. typhimurium and Sal. typhimurium
ptsI were compared in the macrophage-like mouse cell line P388D1 (ATCC). We had previously observed that infection of these, and other cells was enhanced up to fivefold if the bacteria had been grown under microaerobic conditions. Therefore, bacteria were grown in standing cultures at 37 °C to an OD600 of 0·6, collected by centrifugation and diluted in prewarmed RPMI (Gibco-BRL) to approximately 4x106 c.f.u. ml-1; 100 µl bacterial suspension was added to approximately 5x105 macrophages in 900 µl RPMI medium with 10 % fetal calf serum (Gibco-BRL) in 24-well microtitre plates. The plates were centrifuged briefly (100 g, 5 min) to stimulate bacterial adherence to the macrophages. Invasion was allowed to take place for 15 min at 37 °C, after which the extracellular bacteria were killed by the addition of 100 µg gentamicin ml-1. After 3 h at 37 °C internalized bacteria were released by lysis of the macrophages with 0·05 % Triton X-100, diluted in 15 mM MgCl2 and plated. This procedure was repeated after 24 h at 37 °C and the c.f.u. value was calculated. All experiments were performed at least three times in quadruplicate. Survival and growth in macrophages is expressed as the intracellular growth index which equals the bacterial counts at 24 h divided by the bacterial counts at 3 h. The intracellular survival of the pts mutant, the virulent wild-type and three avirulent 14028S-derived strains bearing mutations in the phoP, phoQ and thyA genes were compared.
| RESULTS |
|---|
|
|
|---|
ptsI was constructed by P22 transduction of the ptsI allele from Sal. typhimurium PP1591. The Tn10 insertion in ptsI is weakly polar and reduces the expression of downstream encoded IIAGlc (crr) to 20 % of wild-type level (P. Postma, personal communication). This small reduction of IIAGlc activity does not affect glucose metabolism (Van der Vlag et al., 1995Sal. typhimurium ptsI : : Tn10 was unable to ferment glucose, mannose and other PTS carbohydrates on MacConkey indicator plates, grew well on mineral medium containing maltose and arabinose, but slowly in the presence of citrate and succinate as carbon source. Exponential growth rates in liquid cultures of the wild-type parent strain and the ptsI mutant were virtually identical in a number of different synthetic and complex media. Interestingly however, the observed lag times to reach the exponential growth rate after overnight starvation were invariably longer (in the order of 13 h) for the ptsI mutant, suggesting a regulatory defect in switching from one growth state to the other. The Sal. typhimurium ptsI : : Tn10 strains did not revert (frequency<10-8) after growth to saturation in LB medium and starvation in 15 mM MgCl2 for 24 h.
Sta. aureus
ptsI lost the ability to utilize fructose as indicated by the loss of acid production on dehydrocholic acid/neutral red medium. The growth rates on cysteine-supplemented Luria broth were similar. Similar to Sal. typhimurium, the Sta. aureus pts mutant recovered very slowly from nutrient starvation, differences in lag times varying between 2 and 6 h.
H. influenzae
ptsI formed red colonies when spread on Phenol Red Agar supplemented with 0·5 % fructose, whereas the wild-type parent formed yellow colonies as expected if H. influenzae has only a single PTS transporter specific for fructose. The exponential growth rate of H. influenzae
ptsI in liquid cultures was virtually identical to its virulent parent strain; lag times, when recovering from starvation, were 02 h longer.
Virulence of mutant strains in mice
Virulence of
ptsI strains and the wild-type parents were compared in mice infected with different numbers of bacteria. Five BALB/c mice per group were injected i.p. with graded doses of bacteria and their condition was followed on a daily basis (Table 2
). LD50 was calculated according to Reed & Muench (1938)
. Virulence of Sal. typhimurium was further characterized in a macrophage infection assay in vitro.
|
|
H. influenzae is a Gram-negative facultative anaerobe which depends on sources of haem and nicotinamide nucleotides for growth and survival. Surface structures such as fimbriae, polysaccharide capsules and enzymes which neutralize reactive oxygen species are the major components known to be associated with H. influenzae virulence (Bishai et al., 1994
; Sharples, 1996
). The capsule has been shown to be the dominant virulence factor with a tendency to mask other virulence factors (Moxon & Kroll, 1988
). H. influenzae colonizes the nasopharynx from where it spreads into sinuses and the upper and lower respiratory tract. In rare events systemic infections may evolve after invasion of the respiratory epithelium. Bacteraemia may culminate in meningitis and septic arthritis. Mice were infected with between 1x103 and 1x106 c.f.u. of virulent mouse-passaged H. influenzae ATCC 10211 and with the isogenic ptsI mutant and observed regularly for signs of morbidity and mortality for 3 days post-infection. The results (Table 3
) indicate that the LD50 of 1·3x104 for wild-type H. influenzae and 1x105 for the ptsI mutant differ substantially. It is noteworthy that not only was the time of death earlier for the mice challenged with the wild-type strain, but these mice also showed signs of severe infection earlier than those infected with the mutant (results not shown).
| DISCUSSION |
|---|
|
|
|---|
The log(attenuation) of the Sta. aureus ptsI versus wild-type was 1·4. For comparison, attenuations varied between 1·5 and 4·7 logs in Sta. aureus mutants bearing insertion mutations in in vivo-induced genes in a murine renal abscess model (Coulter et al., 1998
; Lowe et al., 1998
). Except for one gene with similarity to a maltose permease, no further genes associated with sugar utilization were observed in this screen. ATP-binding cassette (ABC) transporters (for peptides and nickel) formed the largest class in a total of 237 Sta. aureus mutants identified by signature tag mutagenesis (Coulter et al., 1998
).
No systematic screens for H. influenzae virulence factors have been published to date, and the observed attenuation by 0·9 logs of ptsI mutants cannot be compared with the effects of in vivo-induced genes. In the mouse model used in this study, the ptsI mutant showed an effect similar to that of a tonB mutant (unpublished results) which has previously been shown to reduce virulence in the infant rat model (Jarosik et al., 1994
), and an arcA mutant, both tested in the same animal model used in this study (De Souza-Hart et al., 2003
).
In spite of extensive in vivo screening for virulence factors, genes associated with sugar utilization have not been found (Mahan et al., 1995
). A mutation in a gene encoding a protein similar to the IIC subunit of the mannose transporter of the PTS turned up in a screen aimed at the identification of genes required for the colonization of the chicken alimentary tract. However, the phenotype was lost after transduction of the mutated allele into fresh Sal. typhimurium (Turner et al., 1998
), making the initial observation difficult to interpret. The bgl operon encoding the
-glucoside transporter of the PTS was expressed in E. coli infecting the mouse liver, but not when the bacteria were grown in vitro (Khan & Isaacson, 1998
), suggesting that sugar utilization may indeed be of importance to bacterial survival and multiplication in vivo. The physiological basis for attenuation by the ptsI deletion remains to be determined, however. The observation that Sal. typhimurium, Sta. aureus and H. influenzae were impaired in recovery from starvation conditions in vitro suggests that a similar physiological problem may impair their ability to multiply in vivo under the rapidly changing conditions typical of a bacterial infection pathway. On the other hand, the limited ability to utilize simple nutrients may be responsible for the observed virulence effects as well. Oral infection might be an alternative to intraperitoneal infection for testing of ptsI mutants because Sal. typhimurium ptsI mutants are severely impaired in the utilization of sugars and carboxylic acids, which are abundant nutrients in the intestine, but may be less relevant in the intracellular state.
In conclusion, enzyme I of the PTS and/or the more recently detected homologous proteins involved in linking carbon and nitrogen assimilation in bacteria are proteins necessary for the full deployment of pathogenic effects by many bacterial species and should therefore be considered as potential targets of new anti-infective compounds.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bishai, W. R., Howard, N. S., Winkelstein, J. A. & Smith, H. O. (1994). Characterization and virulence analysis of catalase mutants of Haemophilus influenzae. Infect Immun 62, 48554860.
Brodeur, B. R., Tsang, P. S., Hamel, J., Larose, Y. & Montplaisir, S. (1986). Mouse models of infection for Neisseria meningitidis B, 2b and Haemophilus influenzae type b diseases. Can J Microbiol 32, 3337.[Medline]
Bruckner, R. (1997). Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol Lett 151, 18.[Medline]
Buchmeier, N. A., Lipps, C. J., So, M. Y. & Heffron, F. (1993). Recombination-deficient mutants of Salmonella typhimurium are avirulent and sensitive to the oxidative burst of macrophages. Mol Microbiol 7, 933936.[Medline]
Chang, A. C. & Cohen, S. N. (1978). Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134, 11411156.
Chatfield, S. N., Dorman, C. J., Hayward, C. & Dougan, G. (1991). Role of ompR-dependent genes in Salmonella typhimurium virulence: mutants deficient in both ompC and ompF are attenuated in vivo. Infect Immun 59, 449452.
Coulter, S. N., Schwan, W. R., Ng, E. Y. W. & 7 other authors (1998). Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments. Mol Microbiol 30, 393404.[CrossRef][Medline]
Curtiss, R., III & Kelly, S. M. (1987). Salmonella typhimurium deletion mutants lacking adenylate cyclase and cyclic AMP receptor protein are avirulent and immunogenic. Infect Immun 55, 30353043.
De Souza-Hart, J. A., Blackstock, W., Di Modugno, V., Holland, I. B. & Kok, M. (2003). Two-component systems in Haemophilus influenzae: a regulatory role for ArcA in serum resistance. Infect Immun 71, 163172.
Edelstein, P. H., Edelstein, M. A., Higa, F. & Falkow, S. (1999). Discovery of virulence genes of Legionella pneumophila by using signature tagged mutagenesis in a guinea pig pneumonia model. Proc Natl Acad Sci U S A 96, 81908195.
Erni, B., Zanolari, B. & Kocher, H. P. (1987). The mannose permease of Escherichia coli consists of three different proteins: amino-acid sequence and function in sugar transport, sugar phosphorylation, and penetration of phage lambda DNA. J Biol Chem 262, 52385247.
Fleischmann, R. D., Adams, M. D., White, O. & 37 other authors (1995). Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269, 496512.
Fomenkov, A., Valiakhmetov, A., Brand, L. & Roseman, S. (1998). In vivo and in vitro complementation of the N-terminal domain of enzyme I of the Escherichia coli phosphotransferase system by the cloned C-terminal domain. Proc Natl Acad Sci U S A 95, 84918495.
Furste, J. P., Pansegrau, W., Frank, R., Blocker, H., Scholz, P., Bagdasarian, M. & Lanka, E. (1986). Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene 48, 119131.[CrossRef][Medline]
Hava, D. & Camilli, A. (2002). Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol Microbiol 45, 13891406.[Medline]
Jarosik, G. P., Sanders, J. D., Cope, L. D., Muller-Eberhard, U. & Hansen, E. J. (1994). A functional tonB gene is required for both utilization of heme and virulence expression by Haemophilus influenzae type b. Infect Immun 62, 24702477.
Jones, A. L., Knoll, K. M. & Rubens, C. E. (2000). Identification of Streptococcus agalactiae virulence genes in the neonatal rat sepsis model using signature-tagged mutagenesis. Mol Microbiol 37, 14441455.[CrossRef][Medline]
Khan, M. A. & Isaacson, R. E. (1998). In vivo expression of the
-glucoside (bgl) operon of Escherichia coli occurs in mouse liver. J Bacteriol 180, 47464749.
Lau, G. W., Haataja, S., Lonetto, M., Kensit, S. E., Marra, A., Bryant, A. P., McDevitt, D., Morrison, D. A. & Holden, D. W. (2001). A functional genomic analysis of type 3 Streptococcus pneumoniae virulence. Mol Microbiol 40, 555571.[CrossRef][Medline]
LiCalsi, C., Crocenzi, T. S., Freire, E. & Roseman, S. (1991). Sugar transport by the bacterial phosphotransferase system. Structural and thermodynamic domains of Enzyme I of Salmonella typhimurium. J Biol Chem 266, 1951919527.
Lowe, A. M., Beattie, D. T. & Deresiewicz, R. L. (1998). Identification of novel staphylococcal virulence genes by in vivo expression technology. Mol Microbiol 27, 967976.[CrossRef][Medline]
Lowy, F. D. (1998). Staphylococcus aureus infections. N Engl J Med 339, 520532.
Lycheva, T. A., Bondarenko, V. M., Burd, G. I., Umiarov, A. M. & Bol'shakova, T. N. (1980). Characteristics of attenuated immunogenic mutants of Shigella flexneri selected from phosphomycin-resistant clones. Zh Mikrobiol Epidemiol Immunobiol June, 5863 (in Russian).
Mahan, M. J., Tobias, J. W., Slauch, J. M., Hanna, P. C., Collier, R. J. & Mekalanos, J. J. (1995). Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host. Proc Natl Acad Sci U S A 92, 669673.
Miller, S. I. & Mekalanos, J. J. (1990). Constitutive expression of the phoP regulon attenuates Salmonella virulence and survival within macrophages. J Bacteriol 172, 24852490.
Morse, M. L. & Alire, M. L. (1958). An agar medium indicating acid production. J Bacteriol 177, 61446152.
Moxon, E. R. & Kroll, J. S. (1988). Type b capsular polysaccharide as a virulence factor of Haemophilus influenzae. Vaccine 6, 113115.[CrossRef][Medline]
Paulsen, I. T., Sliwinski, M. K. & Saier, M. H. (1998). Microbial genome analyses: global comparisons of transport capabilities based on phylogenies, bioenergetics and substrate specificities. J Mol Biol 277, 573592.[CrossRef][Medline]
Postma, P. W., Lengeler, J. W. & Jacobson, G. R. (1996). Phosphoenolpyruvate : carbohydrate phosphotransferase systems. In Escherichia coli and Salmonella: Cellular and Molecular Biology, pp. 11491174. Edited by F. C. Neidhardt and others. Washington, DC: American Society for Microbiology.
Powell, B. S., Court, D. L., Inada, T., Nakamura, Y., Michotey, V., Cui, X., Reizer, A., Saier, M. H. & Reizer, J. (1995). Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J Biol Chem 270, 48224839.
Priefer, U. B., Simon, R. & Puhler, A. (1985). Extension of the host range of Escherichia coli vectors by incorporation of RSF1010 replication and mobilization functions. J Bacteriol 163, 324330.
Reed, L. J. & Muench, H. (1938). A simple method of estimating fifty percent endpoints. Am J Hyg 27, 493497.
Saier, M. H., Jr & Chin, A. M. (1990). Energetics of the bacterial phosphotransferase system in sugar transport and regulation of carbon metabolism. In Bacterial Energetics, pp. 273299. Edited by T. A. Krulwich. San Diego, CA: Academic Press.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sharples, G. J. (1996). Haemophilus virulence. Microbiology 142, 717.[Medline]
Stuy, J. H. & Walter, R. B. (1986). Homology-facilitated plasmid transfer in Haemophilus influenzae. Mol Gen Genet 203, 288295.[CrossRef][Medline]
Turner, A. K., Lovell, M. A., Hulme, S. D., Zhang-Barber, L. & Barrow, P. A. (1998). Identification of Salmonella typhimurium genes required for colonization of the chicken alimentary tract and for virulence in newly hatched chicks. Infect Immun 66, 20992106.
Van der Vlag, J., Van't Hof, R., Van Dam, K. & Postma, P. W. (1995). Control of glucose metabolism by the enzymes of the glucose phosphotransferase system in Salmonella typhimurium. Eur J Biochem 230, 170182.[Medline]
Received 8 April 2003;
revised 27 May 2003;
accepted 28 May 2003.
This article has been cited by other articles:
![]() |
A. Duggirala, P. Kenchappa, S. Sharma, J. K. Peeters, N. Ahmed, P. Garg, T. Das, and S. E. Hasnain High-Resolution Genome Profiling Differentiated Staphylococcus epidermidis Isolated from Patients with Ocular Infections and Normal Individuals Invest. Ophthalmol. Vis. Sci., July 1, 2007; 48(7): 3239 - 3245. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Seggewiss, K. Becker, O. Kotte, M. Eisenacher, M. R. K. Yazdi, A. Fischer, P. McNamara, N. Al Laham, R. Proctor, G. Peters, et al. Reporter Metabolite Analysis of Transcriptional Profiles of a Staphylococcus aureus Strain with Normal Phenotype and Its Isogenic hemB Mutant Displaying the Small-Colony-Variant Phenotype J. Bacteriol., November 15, 2006; 188(22): 7765 - 7777. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen Role of Gluconeogenesis and the Tricarboxylic Acid Cycle in the Virulence of Salmonella enterica Serovar Typhimurium in BALB/c Mice Infect. Immun., February 1, 2006; 74(2): 1130 - 1140. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Baltes and G. F. Gerlach Identification of Genes Transcribed by Actinobacillus pleuropneumoniae in Necrotic Porcine Lung Tissue by Using Selective Capture of Transcribed Sequences Infect. Immun., November 1, 2004; 72(11): 6711 - 6716. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |