|
|
||||||||
1 Department of Pathology and Infectious Diseases, Royal Veterinary College, London NW1 0TU, UK
2 Tuberculosis Research, Veterinary Laboratories Agency, New Haw, Addlestone, Surrey KT15 3NB, UK
3 Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA
Correspondence
N. G. Stoker
nstoker{at}rvc.ac.uk
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
|
| METHODS |
|---|
|
|
|---|
fbp287), JLD2402 (glpX : : SpcR
fbp287), and JB108 (BL21[
DE3 (lacUV5-T7 gene1)]
fbp287) have been described before (Donahue et al., 2000
E. coli culture conditions.
Strains were grown in Luria broth (LB) supplemented with antibiotics as needed or in M9 minimal media (Sambrook et al., 1989
) containing 0·2 % glucose or 0·4 % glycerol. E. coli DH5
(Life Technologies) was used for all plasmid constructions.
Cloning of Rv1099c.
M. tuberculosis Rv1099c was cloned into expression vectors using the Tuberculist-predicted start codon (position 35 in Fig. 2
). The Rv1099c coding sequence was amplified by PCR using primers Rv1099c-NdeI (GGAATTCCATATGGAGCTGGTCCGGGT) and Rv1099c-XhoI (TGACTCGAGGGCAATGGGTACACG). These primers introduced an NdeI site at the 5' end and an XhoI at the 3' end to allow the gene to be cloned in-frame into the expression vector pET-15b. Primers Rv1099c-PvuII (GGATCAGCTGATGGAGCTGGTCCGGGT) and Rv1099c-EcoRI (CGGAATTCGGGCAATGGGTACACG) were used to introduce a PvuII site at the 5' end and an EcoRI at the 3' end to allow the gene to be cloned in-frame into the expression vector pGEX-KG. The primers were each used at 300 nM final concentration. PCR was carried out using the Expand High Fidelity PCR system (Boehringer Mannheim) with M. tuberculosis DNA as the template and DMSO at 2 %. The temperature cycle used was: an initial 3 min at 94 °C to denature high-G+C DNA; 10 cycles of 45 s at 94 °C, 1 min at 63 °C and 1 min at 72 °C; 25 cycles of 45 s at 94 °C, 1 min at 63 °C and 1 min at 72 °C (this last increasing by 20 s per cycle); and finally an extension step of 7 min at 72 °C to complete primer extension. The PCR products were cleaved with the appropriate restriction enzymes and cloned into the vectors pET-15b or pGEX-KG. In this way, plasmids expressing the M. tuberculosis Rv1099c gene were generated, as both His-tag and GST-fusion constructs.
|
To estimate the Km, the concentration of fructose 1,6-bisphosphate was varied from 2 mM (the concentration routinely used elsewhere; see Rashid et al., 2002
) down to 3 µM. Fructose 1,6-bisphosphate was used at 20 µM in all experiments designed to test for potential inhibitors, including LiCl, that were included at the concentrations mentioned in Results. The potential inhibitors were mixed with extracts and incubated for 5 min before adding substrate to start the reaction.
Quantitative PCR.
RNA was prepared from an exponential (7-day) rolling culture of M. tuberculosis H37Rv (Betts et al., 2002
), and cDNA synthesis was carried out using Superscript II (Invitrogen) according to the manufacturer's protocol. Real-time quantitative PCR (RTq-PCR) reactions were set up using the DyNAmo SYBR Green qPCR kit (MJ Research) and RTq-PCR was performed using the DNA Engine Opticon 2 System (Genetic Research Instrumentation). Reactions containing 1x DNA Master SYBR Green I mix, 1 µl cDNA product and 0·4 µM of each primer in 20 µl were set up on ice. Samples were heated to 95 °C for 10 min before cycling for 35 cycles of 95 °C for 30 s, 60 °C (Rv1099c) or 62 °C (sigA) for 20 s, and 72 °C for 20 s. Fluorescence was captured at the end of each cycle after heating to 80 °C to ensure the denaturation of primer-dimers. The experiment was repeated three times using cDNA from each of two independent RNA preparations.
| RESULTS |
|---|
|
|
|---|
Rv1099c is the first gene in a cluster of three genes that we predict is an operon (see Fig. 3
). The second gene, fum (30 bp downstream), encodes the only predicted fumarase in the genome, which is presumed to function in the citric acid cycle (Fig. 1
). Its location next to Rv1099c is conserved in all the sequenced mycobacterial genomes, and suggests a functional relationship between these two genes. Rv1097c, the start of which overlaps the end of fum in M. tuberculosis, is a putative Gly/Pro-rich membrane protein with unknown function that is not conserved in other species. A conserved hypothetical gene, Rv1100, is transcribed divergently from this putative operon, and its conserved synteny in other genomes is suggestive of a related function.
|
This reassignment of the start of M. tuberculosis Rv1099c affects the predicted start for the divergently transcribed Rv1100, as it overlaps the newly assigned start codon for Rv1099c. While it is possible that both promoters lie within coding sequences, it is more likely that there is an intergenic gap. The corynebacterial Rv1100 homologues are located further upstream of glpX (
200 bp), and have only one potential start site upstream of conserved regions (C. glutamicum: VAEK...). M. tuberculosis Rv1100 has a potential GTG start codon in a similar position in the aligned proteins; this aligns with the likely start in M. smegmatis (MTTQ...), and we propose that this is the genuine start codon. This would leave the intergenic gap between Rv1099c and Rv1100 at 57 bp. We suggest new translational starts for the M. leprae homologues using similar logic: glpX (ML1946) will start 81 bp upstream of the current assignment at base 2332629 (old start, MELV...; new start, MTAE...), and the Rv1100 orthologue ML1945 will start 84 bp of the current assignment at base 2332549 downstream (old start, MVND...; new start, VTFE...).
Complementation of E. coli mutants
It is possible to test for FBPase activity by genetic complementation, as an E. coli fbp mutant is unable to grow on medium with glycerol as sole carbon source (Donahue et al., 2000
). We therefore cloned Rv1099c into two expression vectors, so that it would be expressed either with a short N-terminal His-tag (pFM142), or fused to the C-terminal end of GST (pFM149). These constructs were introduced into E. coli strains JLD2402, which lacks both fbp and glpX, and JLD2404, which lacks only fbp. Antibiotic-resistant transformants were selected and then plated onto minimal agar plates containing glucose or glycerol as carbon source, and IPTG to induce expression of Rv1099c. All of these strains grew on glucose agar, whereas the control strains only grew on glycerol agar (results with JLD2402 and pFM149 are shown in Fig. 4
). Complementation was not expected from the pET15b-based clone pFM142, because of the lack of a host T7 polymerase gene, but was detected; our experience is that this can occur due to read-through from other promoters. These results confirm that Rv1099c has FBPase activity. For historical reasons, the clones were made using the start site predicted by Tuberculist. The fact we obtained activity indicates that if the protein does have an extended N-terminus as we predict, this region is not critical for function.
|
DE3)-based strain that lacks fbp, and allows both pGEX and pET15-b-based constructs to be expressed. A spectrophotometric coupled-enzyme assay was used to measure the FBPase activity in cell-free extracts (Table 1
fbp) host gave low background levels, and introduction of pFM142 or pFM149 resulted in elevated levels of FBPase. Note that although strain JB108 has a functional chromosomal glpX gene, we showed that FBPase levels in strain JLD2402 (
fbp
glpX) were not significantly different from those in strain JLD2404 (
fbp) (Table 1
|
Gene expression levels in M. tuberculosis
We carried out RTq-PCR experiments to determine the level of expression of Rv1099c mRNA in exponential cultures of M. tuberculosis in Middlebrook 7H9 medium containing OADC supplement and Tween 80. Expression levels were normalized to those of sigA mRNA, and calculated based on the RNA used for reverse transcription. We showed that in mid-exponential-phase growth in supplemented Middlebrook 7H9 medium (which contains both glucose and Tween 80 as carbon sources), the level of Rv1099c mRNA is 0·49 (95 % confidence interval 0·390·63) that of sigA.
| DISCUSSION |
|---|
|
|
|---|
We show here that M. tuberculosis Rv1099c has FBPase activity with saturable kinetics, and a Km at 15 µM that is similar to the affinity of bacterial class II FBPases for fructose bisphosphate. For example, the C. glutamicum enzyme has a Km of 14 µM and the E. coli GlpX has a Km of 35 µM. Lithium inhibits by interfering with the Mg2+ binding site of sugar phosphatases (Chen & Roberts, 1998
), so its effect on the M. tuberculosis FBPase activity is consistent with this. The lack of effect of any of the intermediates is surprising as it is expected that GlpX needs to be regulated, for instance to avoid futile cycling when phosphofructokinase is active. However, their effects need to be investigated further on purified, possibly cleaved fusion protein before drawing any firm conclusions about regulation.
We suggest that Rv1099c may be the major FBPase of M. tuberculosis; this is supported by the recent report where the GlpX homologue of C. glutamicum was characterized (Rittmann et al., 2003
). The authors showed that it contained FBPase activity, and demonstrated that a mutant lacked any detectable FBPase activity. The corynebacterial glpX mutant was incapable of growth on gluconeogenic substrates, which substantiates the observation that no other FBPase is predicted by the genome sequence of this organism. The C. glutamicum gene was accordingly named fbp; we, however, propose that Rv1099c be called glpX in order to avoid the implication that it is orthologous to the E. coli fbp gene; the glpX name is also used in the COGs database.
Interestingly, all the mycobacterial class II FBPases shown in Fig. 2
have a near-perfect Prosite (http://www.expasy.ch/prosite) inositol monophosphate phosphatase IMP1 motif (PS00629), although they have no IMP2 motif (PS00630). This may suggest a closer homology of the mycobacterial class II FBPases to IMPases than other members of the family. No activity with inositol 1-phosphate could be attributed to Rv1099c under the conditions examined (data not shown).
We demonstrated that Rv1099c is expressed in the cell. mRNA levels approximately half of the level of sigA, the major sigma factor of the cell, were detected. The fact that it is expressed is also indicated by the identification of the protein in 2D-PAGE analysis (http://www.mpiib-berlin.mpg.de/2D-PAGE/EBP-PAGE/index.html).
Support for a key biological role for the M. tuberculosis glpX gene comes from independent concurrent research using a genome-wide transposon-based method (TraSH) for identifying genes that are required for growth in different conditions (Sassetti et al., 2001
; Sassetti & Rubin, 2003
). The data suggest that the fum gene (Figs 1 and 3![]()
) is an essential gene for axenic growth in the presence of both glycolytic (glucose) and gluconeogenic (oleic acid) carbon sources together (Middlebrook 7H9+OADC+Tween 80). Mutants deficient in Rv1100 (which is conserved syntenically with Rv1099c in mycobacteria and corynebacteria) grew slowly, but it appeared that mutants deficient in Rv1099c grew normally. However, a comparison between axenic and in vivo growth showed that mutants in Rv1099c were among the most severely attenuated in a mouse model. This was confirmed in separate experiments showing that an Rv1099c transposon mutant is highly attenuated in vivo (Sassetti & Rubin, 2003
). The extreme attenuation of the glpX mutant is consistent with the essential role of gluconeogenesis for conversion of lipid carbon into cell wall glycan (Fig. 1
). These data, together with the demonstration that a C. glutamicum fbp mutant has lost all detectable FBPase activity, suggest that glpX encodes the major FBPase in M. tuberculosis.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Cerdeno-Tarraga, A. M., Efstratiou, A., Dover, L. G. & 23 other authors (2003). The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129. Nucleic Acids Res 31, 65166523.
Chen, L. & Roberts, M. F. (1998). Cloning and expression of the inositol monophosphatase gene from Methanococcus jannaschii and characterization of the enzyme. Appl Environ Microbiol 64, 26092615.
Cole, S. T., Brosch, R., Parkhill, J. & 39 other authors (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537544.[CrossRef][Medline]
Donahue, J. L., Bownas, J. L., Niehaus, W. G. & Larson, T. J. (2000). Purification and characterization of glpX-encoded fructose 1,6-bisphosphatase, a new enzyme of the glycerol 3-phosphate regulon of Escherichia coli. J Bacteriol 182, 56245627.
Dubnau, E., Fontan, P., Manganelli, R., Soares-Appel, S. & Smith, I. (2002). Mycobacterium tuberculosis genes induced during infection of human macrophages. Infect Immun 70, 27872795.
Fujita, Y., Yoshida, K., Miwa, Y., Yanai, N., Nagakawa, E. & Kasahara, Y. (1998). Identification and expression of the Bacillus subtilis fructose-1,6-bisphosphatase gene (fbp). J Bacteriol 180, 43094313.
Garnier, T., Eiglmeier, K., Camus, J. C. & 19 other authors (2003). The complete genome sequence of Mycobacterium bovis. Proc Natl Acad Sci U S A 100, 78777882.
Garton, N. J., Christensen, H., Minnikin, D. E., Adegbola, R. A. & Barer, M. R. (2002). Intracellular lipophilic inclusions of mycobacteria in vitro and in sputum. Microbiology 148, 29512958.
Goodstadt, L. & Ponting, C. P. (2001). CHROMA: consensus-based colouring of multiple alignments for publication. Bioinformatics 17, 845846.
Liu, K., Yu, J. & Russell, D. G. (2003). pckA-deficient Mycobacterium bovis BCG shows attenuated virulence in mice and in macrophages. Microbiology 149, 18291835.
McKinney, J. D., Honer zu Bentrup, K., Munoz-Elias, E. J. & 7 other authors (2000). Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature 406, 735738.[CrossRef][Medline]
Rashid, N., Imanaka, H., Kanai, T., Fukui, T., Atomi, H. & Imanaka, T. (2002). A novel candidate for the true fructose-1,6-bisphosphatase in archaea. J Biol Chem 277, 3064930655.
Rittmann, D., Schaffer, S., Wendisch, V. F. & Sahm, H. (2003). Fructose-1,6-bisphosphatase from Corynebacterium glutamicum: expression and deletion of the fbp gene and biochemical characterization of the enzyme. Arch Microbiol 180, 285292.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sassetti, C. M. & Rubin, E. J. (2003). Genetic requirements for mycobacterial survival during infection. Proc Natl Acad Sci U S A 100, 1298912994.
Sassetti, C. M., Boyd, D. H. & Rubin, E. J. (2001). Comprehensive identification of conditionally essential genes in mycobacteria. Proc Natl Acad Sci U S A 98, 1271212717.
Sedivy, J. M., Daldal, F. & Fraenkel, D. G. (1984). Fructose bisphosphatase of Escherichia coli: cloning of the structural gene (fbp) and preparation of a chromosomal deletion. J Bacteriol 158, 10481053.
Tamoi, M., Ishikawa, T., Takeda, T. & Shigeoka, S. (1996). Molecular characterization and resistance to hydrogen peroxide of two fructose-1,6-bisphosphatases from Synechococcus PCC 7942. Arch Biochem Biophys 334, 2736.[CrossRef][Medline]
Tatusov, R. L., Natale, D. A., Garkavtsev, I. V. & 7 other authors (2001). The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acids Res 29, 2228.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.
Verhees, C. H., Akerboom, J., Schiltz, E., de Vos, W. M. & van der Oost, J. (2002). Molecular and biochemical characterization of a distinct type of fructose-1,6-bisphosphatase from Pyrococcus furiosus. J Bacteriol 184, 34013405.
Wheeler, P. R. & Ratledge, C. (1988). Use of carbon sources for lipid biosynthesis in Mycobacterium leprae: a comparison with other pathogenic mycobacteria. J Gen Microbiol 134, 21112121.
Received 1 April 2004;
revised 17 June 2004;
accepted 12 July 2004.
This article has been cited by other articles:
![]() |
M. Jules, L. Le Chat, S. Aymerich, and D. Le Coq The Bacillus subtilis ywjI (glpX) Gene Encodes a Class II Fructose-1,6-Bisphosphatase, Functionally Equivalent to the Class III Fbp Enzyme J. Bacteriol., May 1, 2009; 191(9): 3168 - 3171. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Brown, A. Singer, V. V. Lunin, M. Proudfoot, T. Skarina, R. Flick, S. Kochinyan, R. Sanishvili, A. Joachimiak, A. M. Edwards, et al. Structural and Biochemical Characterization of the Type II Fructose-1,6-bisphosphatase GlpX from Escherichia coli J. Biol. Chem., February 6, 2009; 284(6): 3784 - 3792. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Hines, H. J. Fromm, and R. B. Honzatko Structures of Activated Fructose-1,6-bisphosphatase from Escherichia coli: COORDINATE REGULATION OF BACTERIAL METABOLISM AND THE CONSERVATION OF THE R-STATE J. Biol. Chem., April 20, 2007; 282(16): 11696 - 11704. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. G. Rison, J. Mattow, P. R. Jungblut, and N. G. Stoker Experimental determination of translational starts using peptide mass mapping and tandem mass spectrometry within the proteome of Mycobacterium tuberculosis Microbiology, February 1, 2007; 153(2): 521 - 528. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |