|
|
||||||||
1 The Institute of Biochemistry and Physiology of Micro-organisms, Nauki Avenue, 5, Pushchino, 142292 Russia
2 Waksman Institute for Microbiology, Rutgers, The State University of New Jersey, 190 Frelinghuysen Road, Piscataway, NJ 08854, USA
3 Pushchino State University, Nauki Avenue, 5, Pushchino, 142292 Russia
Correspondence
Konstantin Severinov
severik{at}waksman.rutgers.edu
Alexander S. Solonin
solonin{at}ibpm.pushchino.ru
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Haemolysin II, HlyII, is one of several cytotoxic proteins produced by B. cereus. B. cereus is a soil bacterium and an opportunistic human pathogen that causes sometimes-lethal food poisoning (Granum, 1997
). Based on its deduced amino acid sequence, HlyII is a member of the family of oligomeric
-barrel toxins (Baida et al., 1999
; Gouaux, 1998
). This family also includes a number of Staphylococcus aureus cytolysins (
-toxin, leukocidins,
-haemolysin), Clostridium perfringens
-toxin (Gouaux, 1998
) and B. cereus cytotoxin K (CytK) (Lund et al., 2000
). These toxins are secreted in a soluble form and cause their cytotoxic effect by assembling into a transmembrane pore.
The synthesis of
-barrel toxins is subject to genetic regulation. The synthesis of the prototypical member of the family, S. aureus
-toxin, occurs at the end of the exponential phase of growth and is regulated in a complex fashion by the agr (accessory gene regulator) (Recsei et al., 1986
) and sar (Staphylococcus accessory regulator) loci. The products of agr genes are involved in positive regulation of
-toxin gene transcription. SarA, a pleiotropic regulator of S. aureus virulence genes, interacts directly with AT-rich sequences upstream of its target genes, which include the
-toxin gene; SarA also negatively controls expression of the agr genes (Chakrabarti & Misra, 2000
). In the much less well-understood case of B. cereus CytK, putative binding sites for PlcR, a pleiotropic regulator of extracellular virulence factor gene expression in B. thuringiensis, have been identified (Lund et al., 2000
), suggesting that cytK expression is subject to positive regulation.
HlyII is most closely related to CytK of B. cereus and to the
-toxin of S. aureus. Up to now, no regulatory system for the hlyII gene has been described. hlyII-like genes have been found in a number of B. cereus strains, in most of the B. thuringiensis strains tested (Budarina et al., 1994
), and most recently in B. anthracis (Read et al., 2002
). The extent of haemolytic activity in these bacilli varies both between these closely related species and between different strains of the same species; however, the reasons for such variation are not known.
We have previously reported the cloning of a fragment of B. cereus VKM-B771 genomic DNA containing the hlyII gene and adjacent sequences (Sinev et al., 1993
). This fragment, when introduced on a plasmid into E. coli, led to a haemolytic phenotype (Sinev et al., 1993
; Baida et al., 1999
). A perfect 22 bp inverted repeat has been found 222 bp upstream of the hlyII ORF initiating ATG codon, and it was hypothesized that it could be required for transcription regulation of hlyII (Baida et al., 1999
). However, no molecular mechanism for this regulation was proposed. In this paper, we describe a B. cereus ORF, hlyIIR, located downstream of hlyII. Sequence analysis revealed that HlyIIR (for HlyII Regulator) belongs to the Tet/AcrA family of DNA binding transcription regulators. When hlyIIR was introduced into E. coli cells harbouring hlyII plasmids, the haemolytic phenotype and hlyII transcription levels were decreased. In vitro, recombinant HlyIIR specifically interacted with the 22 bp inverted repeat which is centred 48 bp upstream from the hlyII promoter transcription initiation point. HlyIIR binding to promoter DNA did not affect promoter recognition by RNA polymerase (RNAP), but decreased the number of catalytically active open promoter complexes. Thus, our results indicate that HlyII synthesis is the subject of negative regulation by HlyIIR.
| METHODS |
|---|
|
|
|---|
(lac-proAB),
(srl-recA), hsdR, supE, Tn10(Tcr), (F', traD, proAB, lacI,
M15)] was used in haemolytic phenotype detection experiments and as a host for plasmid DNA. The hlyIIR protein was expressed in E. coli strain M15pRep4 (Kmr, lac, ara, gal, mtl, F). Both strains were grown in LB liquid medium (10 g bactotryptone, 5 g yeast extract, 5 g sodium chloride l1) at 37 °C. For growth on plates, the LB medium was supplemented with 15 g agar l1.
Haemolytic phenotype detection.
The haemolytic phenotype of recombinant cells was tested by the appearance of haemolytic zones (clearance zones) around colonies grown on LB agar containing a 1 % suspension of human erythrocytes. Cells were grown at 37 °C overnight and were then incubated for an additional 812 hours at 20 °C.
To measure the haemolytic phenotype quantitatively, cells were grown in LB medium at 20 °C with vigorous aeration until the onset of stationary phase. Haemolytic activity in cultured medium was measured as described by Baida et al. (1999)
.
Plasmids and DNA manipulations.
Molecular cloning was performed using standard protocols. Sequencing reactions were carried out using the FemtoMol sequencing kit (Promega).
Previously described plasmids pUJ1 and pUJ2 (Sinev et al., 1993
) contain the 2·9 kb EcoRI fragment of B. cereus VKM-B771 genomic DNA containing the hlyII gene cloned in opposing orientation in a pUC19 vector. For construction of the pH2 plasmid, the hlyII gene was PCR amplified using 5' primer ACGTTGTAAAACGACGGCCAGTG (anneals to the pUC19 vector part of pUJ1, upstream of the EcoRI site used for the cloning of the 2·9 kb fragment of B. cereus DNA) and 3' primer AATAAAGCTTTTATACTCATATTTG complementary to DNA 3863 nt downstream of the hlyII termination codon and carrying an engineered HindIII site (underlined). The amplified product was treated with EcoRI and HindIII and cloned into the pUC19 vector. For construction of the pRH2 plasmid, the hlyIIR gene was amplified with the same 5' primer as for the hlyII amplification together with 3' primer GATGGATCCTTATTTCATCAAAAT, which anneals to B. cereus DNA 2444 nt downstream of the hlyII termination codon and carries an engineered BamHI site (underlined), using the pUJ2 plasmid as a template. The amplified product was treated with EcoRI and BamHI and cloned into the p15KS vector. For construction of the pFH1Lac plasmid, the 2420 bp BamHIHindIII fragment of pUJ1 was replaced with the 3070 bp BamHIHindIII lacZ fragment from plasmid pCL471 (Zabeau & Stanley, 1982
). Plasmid pHR, expressing hexahistidine-tagged HlyIIR, was obtained by cloning the PCR-amplified hlyIIR ORF between the BamHI and HindIII sites of the pQE30 expression vector.
-Galactosidase assays.
The amounts of
-galactosidase in E. coli cell extracts were determined with a quantitative colorimetric assay using ONPG as a substrate, as described elsewhere (Nikolaev et al., 1992
).
Primer extension reactions.
Total RNA was extracted either from E. coli Z85 cells transformed with appropriate hlyII plasmids and grown in LB medium overnight or from cells scraped from the surface of LB plates containing 1 % human erythrocytes. RNA was purified with the RNeasy RNA isolation mini kit (Qiagen), following the manufacturer's instructions. RNA samples were then treated with RNase-free DNase and repurified using the Qiagen RNeasy protocol. Total RNA (5 µg) was analysed by electrophoresis in 1 % agarose gels to ascertain that the rRNA was intact. For primer extension experiments, 10 µg of total RNA was reverse transcribed with 5 U AMV Reverse Transcriptase (Roche) for 40 minutes at 42 °C in 1x AMV Reverse Transcriptase buffer, supplied by the manufacturer, in the presence of 1 pmol of the 32P-end-labelled primer CGGACGCTACGGCAACACTTTTAGCTATTCCC, which is complementary to hlyII ORF positions 1546. A side-by-side sequencing reaction was performed with the same end-labelled primer and the pUJ1 plasmid as a template, using the Cycle Sequencing system (Promega) according to manufacturer's protocol. Primer extension reactions were terminated by the addition of 50 µl RNase solution (100 U) (Qiagen), incubated for 15 minutes at room temperature and phenol/chloroform extracted, after which nucleic acids were precipitated with ethanol. The pellet was dissolved in formamide-containing loading buffer, and products were resolved on a 6 % sequencing gel and visualised using a PhosphoImager (Molecular Dynamics).
Proteins.
E. coli M15pREP4 transformed with the pHR plasmid was inoculated into 200 ml LB medium containing 60 mg ampicillin l1 and 10 mg kanamycin l1. When the OD600 of the culture reached 0·50·7, cells were induced by the addition of 4 mM IPTG. After 3 h induction, cells were harvested and resuspended in 5 ml Buffer A (40 mM Tris/HCl, pH 7·5, 50 mM NaCl). Cells were lysed by sonication, cell debris was removed by centrifugation and the cell extract was loaded onto a Ni-NTA agarose column equilibrated with Buffer A. The column was washed and HlyIIR was eluted with 250 mM imidazole in buffer A. HlyIIR-containing fractions were pooled and dialysed into buffer B (40 mM Tris/HCl, pH 7·5, 50 mM NaCl, 1 mM EDTA, 1 mM
-mercaptoethanol). The protein was then loaded onto a 1 ml MonoQ column equilibrated in the same buffer. The column was developed with a linear gradient of NaCl concentration (501000 mM) in buffer B. Fractions containing homogeneous HlyIIR were pooled, concentrated and stored under 50 % (v/v) glycerol at 20 °C.
E. coli RNAP core and
70 holoenzymes, and recombinant
70 and
565 were purified as described by Minakhin et al. (2003)
. B. cereus RNAP
A holoenzyme was partially purified from B. cereus VKM-B771 by performing polyethyleneimine P fractionation and heparin agarose affinity chromatography, using the standard procedure for E. coli RNAP purification. The resultant enzyme was
75 % pure.
DNA binding assays, footprinting and in vitro transcription.
The standard HlyIIRDNA binding reaction contained, in 20 µl buffer (10 mM Tris/HCl, pH 7·5, 10 mM NaCl, 1 mM MgCl2), various amounts of HlyIIR, 200 ng radioactively labelled DNA or 1 µg unlabelled DNA, and 1 µg BSA. Complexes were allowed to form for 20 min at 37 °C. Reactions were then loaded on 4 % or 12 % polyacrylamide gels, or on 0·8 % agarose gels. DNA complexes separated on polyacrylamide gels were revealed by autoradiography; complexes resolved by agarose gel electrophoresis were stained by ethidium bromide and visualized with UV irradiation. Where indicated, 0·5, 1 and 2 µg of pUC19 competitor DNA was added to samples prior to electrophoresis.
The hlyII promoter-containing DNA fragments used in in vitro transcription and footprinting reactions were created by PCR, using pUJ1 as a template. The standard, wild-type fragment corresponded to positions 94 to +214 relative to the hlyII transcription initiation start point. Mutant fragments, lacking B. cereus sequences 27 and 47 bases upstream of the hlyII promoter initiation start point, were created by PCR.
To form open promoter complexes, 3 pmol E. coli RNAP
70 holoenzyme or B. cereus RNAP
A holoenzyme (purified as described by Kashlev et al., 1996
) was preincubated in 10 µl transcription buffer (20 mM Tris/HCl, pH 7·9, 40 mM KCl, 10 mM MgCl2) with 1 pmol of hlyII promoter DNA fragment for 10 min at 37 °C. HlyIIR (50 pmol) was added to the reaction either before or after RNAP addition and open complex formation. After the HlyIIR addition, the reaction mixture was incubated for 10 min at 37 °C. Transcription complexes were next subjected to native gel analysis or footprinting, or were supplemented with 500 µM GTP, 50 µM ATP and CTP, and [
-32P]UTP (30 Ci mmol1) to analyse in vitro transcription products. Transcription reactions were allowed to proceed for 10 min at 37 °C, and were terminated by the addition of an equal volume of formamide-containing gel loading buffer. Reaction products were separated on a 20 % polyacrylamide, 6 M urea gel and revealed by PhosphoImager analysis. For native gel and footprinting analysis, the DNA fragment containing the hlyII promoter was 3'-end-labelled at the non-template strand with Klenow enzyme, using standard procedures. Samples containing hlyII promoter complexes were loaded directly on a 4 % (37·5 : 1) polyacrylamide native gel, footprinted with DNase I or probed with KMnO4, as described by Severinova et al. (1998)
. The samples were then analysed on a 6 % sequencing gel and revealed on a PhosphoImager.
For primer extension analysis of in vitro transcribed RNA, promoter complexes were formed during a 10 min 37 °C incubation of 10 pmol E. coli or B. cereus RNAP and 5 pmol hlyII promoter-containing fragment in 100 µl transcription buffer. NTP (500 µM) was added and the reaction continued for 30 min at 37 °C. Reactions were extracted with chloroform, and nucleic acids were precipitated with ethanol, dissolved in water and subjected to the primer extension assay. In vitro transcribed RNA was reverse-transcribed with 100 U Super Script III enzyme (Invitrogen) in the presence of 1 pmol 32P-end-labelled primer complementary to nucleotide positions 158182 of the hlyII gene. Primer extension reactions were carried out for 50 min at 50 °C and terminated by a 5 min incubation at 85 °C. RNA was removed by RNase H treatment. Reaction products were extracted with chloroform, precipitated with ethanol and dissolved in formamide-containing loading buffer. As a reference, sequencing reactions were performed on a hlyII promoter-containing DNA fragment using the same end-labelled primer as the one used in the primer extension reaction. The fmol DNA Cycle Sequencing System (Promega) was used for sequencing, according to the manufacturer's protocol. The extension products were resolved on an 8 % sequencing gel, together with the sequencing reactions, and visualised using a PhosphorImager.
| RESULTS |
|---|
|
|
|---|
2·9 1kb EcoRI fragment of B. cereus VKM-B771 DNA cloned in pUC19, allowed E. coli cells to lyse erythrocytes (Sinev et al., 1993
The hlyII gene (412 codons) is much shorter than the B. cereus DNA fragment of pUJ1. We determined the sequence of the entire 2·9 kb EcoRI fragment of pUJ1 and identified an additional, 201-codon-long ORF downstream of hlyII. The new ORF has an appropriately positioned ShineDalgarno sequence. The new ORF is transcribed in the same direction as hlyII; it is preceded by a putative promoter and is followed by a putative
-independent transcription terminator, suggesting that it is expressed independently of hlyII.
To determine whether the product of the additional ORF is involved in haemolysis or not, E. coli expression plasmids containing either hlyII or the new gene were created (Fig. 1
a), and their ability to impart haemolytic activity to E. coli was tested. As expected, the pUC19-based hlyII plasmid pH2 imparted haemolytic activity to E. coli (data not shown; see also Fig. 1b
). In contrast, plasmid pRH2, which carried the downstream ORF with its putative regulatory elements cloned in the p15KS vector, did not impart haemolytic activity to E. coli, thus excluding the possibility that the product of the second gene is involved in haemolysis directly (data not shown; see also Fig. 1b
).
|
Comparisons of the deduced HlyIIR sequence with protein sequences in public databases revealed that HlyIIR is similar through much of its length to a number of oligomeric DNA-binding bacterial transcriptional regulators. An NCBI Conserved Domain Search revealed that HlyIIR amino acids 1166 aligned with the AcrR conserved domain, while amino acids 1258 also gave significant alignment with the TetR conserved domain, which contains a helixturnhelix DNA-binding element. HlyIIR has the most similarity to other proteins in its N-terminal TetR domain. The C-terminal portion of HlyIIR is more divergent. A similar trend has been observed with other proteins of this class (see, for example, Namwat et al., 2001
). This likely reflects the fact that the C-terminal portions of AcrR/TetR family proteins are involved in homomultimerization and interactions with cofactors, which are highly diverse, while the architecture of the compact N-terminal domain is constrained by its essential DNA-binding function.
HlyIIR inhibits transcription from the hlyII promoter
The similarity between HlyIIR and the AcrR/TetR family of DNA-binding transcriptional regulators strongly suggests that HlyIIR affects HlyII haemolysis by decreasing hlyII expression at the level of transcription. To prove this conjecture, two types of experiments were performed. First, we constructed plasmid pFH1Lac, harbouring a fusion of the upstream regulatory region of hlyII with the lacZ gene (Fig. 2
a), and we determined the effect of a compatible plasmid carrying hlyIIR on the amount of
-galactosidase activity in cells carrying pFH1Lac. The results, which are presented in Fig. 2b
, show that in the presence of vector plasmid p15KS substantial levels of
-galactosidase activity were obtained in cells harbouring pFH1Lac. However, when hlyIIR plasmid pRH2 was substituted for p15KS, a 10-fold decrease in
-galactosidase activity was observed. As expected, no
-galactosidase activity was found in cells harbouring pRH2 and the pUC19 vector. The results thus support the idea that HlyIIR inhibits hlyII transcription.
|
Ssp plasmid, a derivative of pH2 in which the hlyII upstream sequences have been removed as far as an SspI site located 180 bp upstream of the hlyII-initiating ATG (Fig. 2c
Ssp did not exhibit any haemolytic activity (data not shown).
The transcription start site identified in E. coli corresponds to the natural transcription start site in B. cereus, since a primer extension experiment performed with RNA prepared from B. cereus VKM-B771 revealed the same primer extension product as that determined in E. coli (Fig. 2d
).
HlyIIR interacts with a palindromic DNA sequence upstream of the hlyII promoter
The hlyIIR gene was cloned into the E. coli expression plasmid and the recombinant HlyIIR protein was overproduced and purified from cell extracts to homogeneity as an N-terminal hexahistidine fusion. The DNA-binding activity of HlyIIR was tested in gel retardation assay using EcoRI- and BamHI-digested pH2. The results, which are presented in Fig. 3
, show that only the 480 bp EcoRIBamHI fragment of pH2, which includes the entire upstream sequence of hlyII, was shifted in the presence of HlyIIR (Fig. 3a
, indicated by an arrow). In contrast, the electrophoretic mobilities of the two larger pH2 fragments remained unchanged in the presence of HlyIIR (Fig. 3a
, compare lanes 1 and 2). To further narrow the HlyIIR binding site, the 480 bp EcoRIBamHI fragment of pH2 was purified, treated with AluI (cleaves at positions 200 and 270 with respect to the left-hand end of the fragment) and the gel retardation experiment with HlyIIR was repeated. As expected, in the absence of HlyIIR, three major DNA fragments were observed (Fig. 3a
, lane 3). In the presence of recombinant HlyIIR, retardation of the largest, 200 bp, fragment but not of the smaller, 180 and 70 bp, fragments was observed (Fig. 3a
, lane 4). The interaction of HlyIIR with the 200 bp fragment was specific, since the addition of a 10-fold excess of linearized pUC19 plasmid DNA did not change the retardation pattern (Fig. 3b
, lane 5).
|
50 bp of DNA, between positions 75 to 25 relative to the hlyII transcription initiation start point, from DNase I digestion. The protected region corresponds to the 22 bp inverted repeat centred 48 bp upstream from the hlyII transcription initiation start point (Fig. 2d
We next proceeded to establish that the 22 bp inverted repeat is sufficient for interaction with HlyIIR. We used a synthetic double-stranded DNA probe that contained the entire 22 bp inverted repeat. Gel-retardation experiments revealed that HlyIIR readily shifted this oligonucleotide (Fig. 3c
, compare lanes 1 and 3) and that the HlyIIRDNA complex was specific, as it withstood competition with a large excess of pUC19 DNA (Fig. 3c, compare lanes 4 and 5). We conclude that the 22 bp inverted repeat contains the HlyIIR binding site.
Transcription inhibition by HlyIIR in vitro
We next studied the effect of recombinant HlyIIR on transcription from the hlyII promoter in vitro. Both E. coli RNAP
70 holoenzyme and B. cereus
A holoenzyme produced a single transcript from a DNA fragment containing the hlyII promoter (Fig. 4
a, lanes 1 and 3, respectively). In the presence of HlyIIR, no transcript was produced by either enzyme (Fig. 4a
, lanes 2 and 4). Primer extension revealed that both enzymes initiated transcription from the same point (Fig. 4b
), which corresponded to the in vivo start point utilized in E. coli (Fig. 2c
).
|
70 holoenzyme. A steady-state multiple-round transcription assay demonstrated that the addition of HlyIIR strongly inhibited transcription from the hlyII promoter regardless of whether HlyIIR was added before or after
70 holoenzyme (Fig. 5
565) reconstituted from E. coli RNAP core enzyme and mutant
70 which lacks the C-terminal conserved region 4.2 (Minakhin et al., 2003
70 region 4.2 interactions with the 35 promoter consensus element are not required for transcription from the extended 10 class promoters) and suggests that
70 region 4.2 is not the target of transcription inhibition by HlyIIR. We attempted to determine the effect of HlyIIR on in vitro transcription from a hlyII promoter derivative that lacked both copies of the inverted repeat. However, such a DNA fragment had no promoter activity in vitro, despite the fact that the extended 10 promoter element was retained, suggesting that upstream elements of the hlyII promoter contribute to efficient promoter utilization. Be that as it may, we conclude that HlyIIR acts as a transcription inhibitor in vitro, and that transcription inhibition is dependent on the presence of an intact HlyIIR binding site, the 22 bp inverted repeat.
|
70 holoenzyme, a supershifted complex with electrophoretic mobility higher than that of either HlyIIR complex (Fig. 5b
The hlyII promoter complexes formed by RNAP in the presence or absence of HlyIIR were studied by DNase I footprinting. The results are presented in Fig. 5c
. As can be seen, HlyIIR and RNAP alone produced distinct DNase I footprints (Fig. 5c
, compare lane 2 with lanes 3 and 4). HlyIIR alone protected DNA from 17 to 60 (Fig. 5c
, lane 3), while RNAP alone protected the DNA from positions +20 to 13 (Fig. 5c
, lane 4). In addition, RNAP changed the pattern of promoter DNA digestion by DNase I further upstream. DNA at around positions 24, 34, 44, 54 and, most strikingly, 64 became hypersensitive to DNase in the presence of RNAP. The extended protection of promoter upstream sequences by RNAP is probably due to wrapping of the very AT-rich upstream promoter DNA around RNAP (Burns et al., 1999
). In the presence of HlyIIR and RNAP, promoter DNA between positions +20 and 13 remained fully protected (Fig. 5c
, lanes 5 and 6). The pattern of upstream promoter DNA protection was changed and became distinct from those seen in the presence of either HlyIIR or RNAP alone. The extent of hypersensitivity in the upstream promoter DNA decreased in the presence of HlyIIR. However, in contrast to the situation seen in the presence of HlyIIR alone, no full protection of upstream promoter DNA was seen in the presence of both HlyIIR and RNAP. Several quantitative differences between the HlyIIR/RNAP footprint and the RNAP-alone footprint suggested that HlyIIR was present in these complexes (Fig. 5c
, arrows). First, the striking hypersensitive band at 64 was either missing (when RNAP was added to the HlyIIRDNA complex, Fig. 5c
, lane 5) or significantly reduced (when HlyIIR was added to RNAPpromoter complexes, Fig. 5c
, lane 6) in the presence of both HlyIIR and RNAP. Second, hypersensitive bands at positions 44 and 33 were also missing when both proteins were present in footprinting reactions. We take these data, together with the band shift results of Fig. 5b
, as an indication that promoter complexes containing both HlyIIR and RNAP can form on the hlyII promoter. It appears that, in the ternary complex, contacts made by either HlyIIR or RNAP are different from contacts made when either of these proteins is present alone.
The hlyII promoter complexes were also probed by KMnO4, a chemical agent specific for single-stranded thymines (Fig. 5d
). As can be seen, and as expected, RNAP, but not HlyIIR, caused the appearance of KMnO4-sensitive bands at positions +3, 1, 2, 5 and 12 (Fig. 5d
, compare lanes 2 and 3). The degree of KMnO4 sensitivity decreased
3·5-fold in the presence of HlyIIR, but the pattern of sensitive thymines remained the same (Fig. 5d
, compare lane 3 with lanes 4 and 5). The result thus suggests that HlyIIR negatively regulates hlyII transcription by interfering with the formation of catalytically active RNAP open promoter complexes.
The footprinting results presented above suggest that HlyIIR may interact with the RNAP holoenzyme, at least in the context of the hlyII promoter complex. To determine whether HlyIIR can interact with free RNAP, a native gel analysis of reactions containing pure HlyIIR, E. coli RNAP core or
70 holoenzyme, and reactions containing HlyIIR with either core or
70 holoenzyme was performed (Fig. 6
a). As can be seen, HlyIIR caused a change in the electrophoretic mobility of both the core and the holoenzyme (compare lanes 2 and 4 with lanes 2 and 5, respectively), suggesting an interaction. Analysis of the polypeptide composition of bands from the native gels revealed that bands shifted in the presence of HlyIIR contained, in addition to the expected RNAP subunits, the HlyIIR protein (Fig. 6b
, lanes 4 and 6). We therefore conclude that HlyIIR is able to bind RNAP core and holoenzyme in solution, in the absence of the hlyII promoter DNA.
|
| DISCUSSION |
|---|
|
|
|---|
subunit is not involved in the interaction.
Although our data on hlyII promoter regulation were obtained in a heterologous E. coli system, we believe that the hlyII promoter identified in this study is also active in B. cereus, since, in vitro, B. cereus RNAP initiates hlyII transcription at the same site as E. coli RNAP, indicating that the relative positions of HlyIIR and RNAP bound to the hlyII promoter are the same in E. coli and B. cereus. Sinev et al. (1993)
and Budarina et al. (1994)
reported that in both B. cereus and E. coli cells carrying the pUJ1 plasmid (contains both hlyII and hlyIIR), haemolysin II production was activated at the late logarithmic stage of growth. While the reason(s) for this is not known, it may have to do either with negative regulation of hlyIIR expression or with the regulation of HlyIIR binding to DNA by low-molecular-mass ligands whose nature is yet to be determined.
Analyses of genomic sequences of B. anthracis demonstrate that sequences homologous to both hlyII and hlyIIR are present, as expected from the very close similarity between B. cereus and B. anthracis. However, unlike B. cereus, the anthrax bacterium is not generally known to produce haemolysins. Sequence analysis of B. anthracis DNA gives some clues to this apparent paradox. While the B. anthracis A2012 strain hlyII sequence is identical to the B. cereus VKM-B771 sequence (Read et al., 2002
), an A corresponding to B. cereus hlyII position 232 is missing from the B. anthracis hlyII gene. In addition, a G at hlyII position 1116 is substituted for an A. The frame shift resulting from the absence of an A at position 232 likely renders B. anthracis haemolysin II non-functional. In contrast, while the hlyII genes from B. cereus strains ATCC 14579 (Ivanova et al., 2003
) and BGSC 6A5 (Miles et al., 2002
) have accumulated a significant number of point substitutions compared to the VKM-B771 sequence, they have maintained an intact reading frame which, at least in the case of BGSC 6A5, is known to code for a functional haemolysin (Miles et al., 2002
).
The relative position of the the hlyII and hlyIIR genes, and the palindromic HlyIIR binding sites in front of hlyII is conserved. This allows some of the errors in annotation which arise due to sequence similarities between the protein sequences of HlyII and CytK haemolysins to be corrected. Thus, in the recently published genome of B. cereus ATCC 10987 (Rasko et al., 2004
) a gene annotated as CytK is followed by a gene encoding a HlyIIR protein. The haemolysin gene is preceded by a palindromic sequence similar to the HlyIIR binding site. Since CytK genes are not followed by genes encoding TetR-like regulators and are not preceded by HlyIIR binding sites, we suggest that the B. cereus ATCC 10987 cytotoxin K gene in fact encodes HlyII. As is also the case with other B. cereus hlyII genes, the ATCC 10987 gene encodes a full-sized protein.
Interestingly, the ORF of the hlyII gene (annotated as an
-haemolysin precursor) is also interrupted in B. cereus G9241 (Hoffmaster et al., 2004
), the only sequenced B. cereus strain which is associated with an illness resembling inhalation anthrax and which carries a circular plasmid very similar to B. anthracis toxin-encoding plasmid pXO1. The result may indicate that some aspects of HlyII function may be incompatible with anthrax toxin function. In this regard, the presence of frame-shift mutations in hlyII genes from B. anthracis, but not in those from B. cereus, is reminiscent of the previously described situation with the plcR gene, which encodes the major positive regulator of pathogenicity factors, including haemolysins, in B. cereus. The ORF of the plcR gene is interrupted in B. anthracis, which explains why B. anthracis does not produce pathogenicity proteins characteristic of B. cereus. Inspection of the DNA sequence upstream of hlyII and hlyIIR reveals no PlcR-binding sites, suggesting that haemolysin II production is not subject to direct regulation by PlcR.
The sequence of the B. anthracis A2012 hlyIIR gene is identical to that of B. cereus hlyIIR, except for a single G to A substitution that changes Gly2 in B. cereus HlyIIR to Glu in the B. anthracis protein. Further, the 22 bp palindromic HlyIIR operator is also present in front of B. anthracis hlyII. However, a single G to A change at the tenth position of the promoter-distal copy of the inverted repeat has occurred. A corresponding C to T change has occurred in the promoter-proximal copy of the B. anthracis repeat, thus preserving the perfect 22 bp palindrome, and suggesting that this DNA site continues to play a regulatory role. It is formally possible that a single Gly to Glu amino acid substitution changes the operator specificity of B. anthracis HlyIIR. It is not clear why B. anthracis would keep a non-functional haemolysin II gene as well as a gene encoding an apparently functional regulator protein. Reports on the isolation of haemolytic B. anthracis strains from several natural sources (Mikshis et al., 1999
) indicate that haemolysis in B. anthracis may be more widespread than previously anticipated. A systematic comparison of hlyII sequences from various anthracoid bacilli strains and correlation with the haemolytic activity of these strains may thus be warranted.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Baida, G., Budarina, Z. I., Kuzmin, N. P. & Solonin, A. S. (1999). Complete nucleotide sequence and molecular characterization of hemolysin II gene from Bacillus cereus. FEMS Microbiol Lett 180, 714.[CrossRef][Medline]
Barne, K. A., Bown, J. A., Busby, S. J. & Minchin, S. D. (1997). Region 2·5 of the Escherichia coli RNA polymerase
70 subunit is responsible for the recognition of the extended-10 motif at promoters. EMBO J 16, 40344040.[CrossRef][Medline]
Budarina, Z. I., Sinev, M. A., Mayorov, S. G., Tomashevski, A. Y., Shmelev, I. V. & Kuzmin, N. P. (1994). Hemolysin II is more characteristic of Bacillus thuringiensis than Bacillus cereus. Arch Microbiol 161, 252257.[Medline]
Burns, H. D., Ishihama, A. & Minchin, S. D. (1999). Open complex formation during transcription initiation at the Escherichia coli galP1 promoter: the role of the RNA polymerase
subunit at promoters lacking an UP-element. Nucleic Acids Res 27, 20512056.
Chakrabarti, S. K. & Misra, T. K. (2000). SarA represses agr operon expression in a purified in vitro Staphylococcus aureus transcription system. J Bacteriol 182, 58935897.
Gaal, T., Ross, W., Estrem, S. T., Nguyen, L. H., Burgess, R. R. & Gourse, R. L. (2001). Promoter recognition and discrimination by E
S RNA polymerase. Mol Microbiol 42, 939954.[CrossRef][Medline]
Gouaux, E. (1998).
-Hemolysin from Staphylococcus aureus: an archetype of
-barrel, channel-forming toxins. J Struct Biol 121, 110122.[CrossRef][Medline]
Granum, P. E. (1997). Bacillus cereus. In Fundamentals in Food Microbiology, pp. 327336. Edited by M. Doyle, L. Beuchat & T. Montville. Washington, DC: American Society for Microbiology.
Hoffmaster, A. R., Ravel, J., Rasko, D. A. & 19 other authors (2004). Identification of anthrax toxin genes in a Bacillus cereus associated with an illness resembling inhalation anthrax. Proc Natl Acad Sci U S A 101, 84498454.
Ivanova, N., Sorokin, A., Anderson, I. & 20 other authors (2003). Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423, 8791.[CrossRef][Medline]
Kashlev, M., Nudler, E., Severinov, K., Borukhov, S., Komissarova, N. & Goldfarb, A. (1996). Histidine-tagged RNA polymerase of Escherichia coli and transcription in solid phase. Methods Enzymol 274, 326334.[Medline]
Lund, T., De Buyser, M. L. & Granum, P. E. (2000). A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol 38, 254261.[CrossRef][Medline]
Mikshis, N. I., Eremin, S. A. & Bolotnikova, M. F. (1999). Correlation of the virulence of Bacillus anthracis with expression of signs, coded for by chromosomal genes. Molecular Genetics, Microbiology and Virology (English translation of Molekulyarnaya Genetika Microbiologija i Virusologija) 4, 2528.
Miles, G., Bayley, H. & Cheley, S. (2002). Properties of Bacillus cereus hemolysin II: a heptameric transmembrane pore. Protein Sci 11, 18131824.
Minakhin, L., Niedziela-Majka, A., Kuznedelov, K., Adelman, K., Urbauer, J., Heyduk, T. & Severinov, K. (2003). Interaction of T4 AsiA with its target sites in the RNA polymerase
70 subunit leads to distinct and opposite effects on transcription. J Mol Biol 326, 679690.[CrossRef][Medline]
Namwat, W., Lee, C. K., Kinoshita, H., Yamada, Y. & Nihira, T. (2001). Identification of the varR gene as a transcriptional regulator of virginiamycin S resistance in Streptomyces virginiae. J Bacteriol 183, 20252031.
Nikolaev, I., Epishin, S., Zakharova, E., Kotenko, S. & Vinetskii, I. (1992). Molecular cloning of the gene for secreted beta-galactosidase of the filamentous fungus Penicillium canescens. Molecular Biology (English Translation of Molekulyarnaya Biologiya (Moscow)) 26, 869875.
Rasko, D. A. J., Ravel, O. A., Okstad, E. & 12 other authors (2004). The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res 32, 977988.
Read, T. D., Salzberg, S. L., Pop, M. & 10 other authors (2002). Comparative genome sequencing for discovery of novel polymorphisms in Bacillus anthracis. Science 296, 20282033.
Recsei, P., Kreiswirth, B., O'Reilly, M., Schlievert, P., Gruss, A. & Novick, R. P. (1986). Regulation of exoprotein gene expression in Staphylococcus aureus by agr. Mol Gen Genet 202, 5861.[CrossRef][Medline]
Severinova, E., Severinov, K. & Darst, S. A. (1998). Inhibition of Escherichia coli RNA polymerase by T4 AsiA. J Mol Biol 279, 918.[CrossRef][Medline]
Sinev, M. A., Budarina, Z. I., Gavrilenko, I. V., Tomashevskii, A. I. & Kuzmin, N. P. (1993). Evidence of the existence of hemolysin II from Bacillus cereus: cloning the genetic determinant of hemolysin II. Mol Biol (Russ) 27, 12181229.
Zabeau, M. & Stanley, K. K. (1982). Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda. EMBO J 1, 12171224.[Medline]
Received 5 March 2004;
revised 23 June 2004;
accepted 4 August 2004.
This article has been cited by other articles:
![]() |
J. L. Ramos, M. Martinez-Bueno, A. J. Molina-Henares, W. Teran, K. Watanabe, X. Zhang, M. T. Gallegos, R. Brennan, and R. Tobes The TetR Family of Transcriptional Repressors Microbiol. Mol. Biol. Rev., June 1, 2005; 69(2): 326 - 356. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||