Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 150 (2004), 365-371; DOI  10.1099/mic.0.26826-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rezcallah, M. S.
Right arrow Articles by Sledjeski, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rezcallah, M. S.
Right arrow Articles by Sledjeski, D. D.
Agricola
Right arrow Articles by Rezcallah, M. S.
Right arrow Articles by Sledjeski, D. D.
Microbiology 150 (2004), 365-371; DOI  10.1099/mic.0.26826-0
© 2004 Society for General Microbiology

Mouse skin passage of Streptococcus pyogenes results in increased streptokinase expression and activity

Myrna S. Rezcallah1, Michael D. P. Boyle2 and Darren D. Sledjeski3

1 Department of Microbiology, University of Minnesota Medical School, Minneapolis, MN 55455, USA
2 Department of Biology, Juniata College, 1700 Moore Street, Huntingdon, PA 16652, USA
3 Department of Microbiology and Immunology, Medical College of Ohio, 3055 Arlington Avenue, Toledo, OH 43614-5806, USA

Correspondence
Darren D. Sledjeski
dsledjeski{at}mco.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The plasminogen activator streptokinase has been proposed to be a key component of a complex mechanism that promotes skin invasion by Streptococcus pyogenes. This study was designed to compare ska gene message and protein levels in wild-type M1 serotype isolate 1881 and a more invasive variant recovered from the spleen of a lethally infected mouse. M1 isolates selected for invasiveness demonstrated enhanced levels of active plasminogen activator activity in culture. This effect was due to a combination of increased expression of the ska gene and decreased expression of the speB gene. The speB gene product, SpeB, was found to efficiently degrade streptokinase in vitro.


Abbreviations: QRT-PCR, quantitative real-time reverse transcriptase-PCR; SELDI-TOF, surface-enhanced laser desorption ionization–time of flight; SK, streptokinase


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasminogen activation has been suggested as a critical component in establishing invasive bacterial infections (Boyle & Lottenberg, 1997Down; Coleman & Benach, 1999Down; Lahteenmaki et al., 2001Down). Streptococcus pyogenes represents the most extensively analysed model for interaction between pathogen and the plasminogen system. This organism can acquire surface plasminogen enzymic activity in a complex multi-step pathway (D’Costa & Boyle, 1998Down, 2000Down; Wang et al., 1994Down, 1995aDown, bDown). Although streptokinase (SK) from S. pyogenes isolates demonstrated a species-specific plasminogen activator with preference for human plasminogen (Boyle & Lottenberg, 1997Down; Marcum & Kline, 1983Down; McCoy et al., 1991Down; Nowicki et al., 1994Down; Schroeder et al., 1999Down; Wohl et al., 1983Down), previous studies have shown that streptococcal isolates that can activate mouse plasminogen are more invasive when injected into the skin of plg+/+ but not plg-/- mice (Li et al., 1999aDown).

In other studies, more invasive variants of S. pyogenes were isolated after passage through mouse skin and recovery from the spleen of mice that succumbed to the infection (Raeder & Boyle, 1993Down, 1995Down, 1996Down; Raeder et al., 1998Down). In vitro studies of S. pyogenes with human plasma suggest a key role for two bacterial proteins (a surface fibrinogen-binding protein and the secreted plasminogen activator SK) as well as two host proteins (fibrinogen and plasminogen) in invasion (D’Costa & Boyle, 1998Down, 2000Down; Wang et al., 1994Down, 1995aDown, bDown). Since the plasminogen activation is important for invasion, then invasive variants would be expected to demonstrate increased expression of fibrinogen-binding M proteins and SK leading to enhanced plasmin(ogen)-dependent surface enzymic activity. Previous studies have demonstrated enhanced expression of fibrinogen-binding proteins and decreased expression of the cysteine protease SpeB for invasive M1 serotype isolates injected in the skin of mice and recovered from the spleen (Raeder & Boyle, 1993Down, 1995Down, 1996Down; Saouda et al., 2001Down). These phenotypes were stable over many generations of growth in the laboratory with revertants occurring at a frequency of less than 1 : 5000 (Raeder & Boyle, 1993Down, 1995Down, 1996Down; Saouda et al., 2001Down). Interestingly, the variants with this phenotype were only selected following skin infection and recovery from the spleen. A similar single infection cycle involving intraperitoneal infection failed to result in generation of a SpeB- phenotype or significantly enhance expression of surface M and M-related proteins (Raeder & Boyle, 1993Down, 1995Down, 1996Down; Saouda et al., 2001Down). In this study, we have examined the effects of this mouse skin air-sac selection protocol on the expression of the plasminogen activator SK.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacteria.
S. pyogenes isolate 1881 (SpeB+, serotype M1, opacity-factor-negative) was obtained from the Centers for Disease Control and Prevention and has been fully characterized previously (Raeder & Boyle, 1995Down; Talkington et al., 1993Down). A stable SpeB- variant of isolate 1881 (SR1881) was isolated from the spleen of mice that died following infection with the SpeB+ wild-type isolate (WT1881) in a skin air-sac model as described by Raeder et al. (1998)Down. A series of ska : : lacZ fusion variants of isolate 1881 were generated using a Tn917–lacZ transposon as described previously (Sledjeski et al., 2001Down).

Determination of surface-associated plasmin(ogen)-dependent enzymic activity with bacteria grown in plasma.
Bacteria (5x108 c.f.u.) grown to saturation in Todd–Hewitt broth containing 0·3 % yeast extract (THY) (Difco) were incubated in 500 µl of 0·01 M PBS containing 10 % human plasma for 6 h at 37 °C. Bacteria were harvested by centrifugation at 4000 g for 10 min and washed twice with PBS to remove unbound material. Bacteria-associated enzymic activity was determined by adding 400 µl of a 400 µM stock solution of the synthetic substrate H-D-Val-Leu-Lys p-nitroanilide, S-2251 (Kabi Pharmacia), to the bacterial pellets and incubating overnight at 37 °C. The enzymic activity associated with bacterial pellets was determined by measuring the absorbance at 405 nm of 100 µl of bacteria-free supernatant in a microplate reader (Bio-Kinetics-Reader EL 312; Bio-Tek Instruments).

Determination of SK activity in bacterial culture supernatants.
SK activity was determined by the ability to activate human plasminogen to plasmin, and the resulting plasmin activity was quantified by cleavage of S-2251 as determined by absorbance of product at 405 nm. Centrifuged supernatants (150 µl) from saturated cultures of bacteria were mixed with 10 µg of purified human plasminogen or buffer (PBS) in the wells of a 96-well microtitre plate and incubated at 37 °C for 30 min. Next, the plasmin-selective synthetic substrate S-2251 was added to each well to a final concentration of 400 µM and incubated at 37 °C. Cleavage of the substrate was monitored by the increase in absorbance at 405 nm. The assay was linear to an A405 value of 1·25 under these conditions.

RNA purification.
RNA was purified using Trizol reagent (Gibco-BRL) and Phase Lock gel (Fischer Scientific) following the manufacturer's instructions with some modifications (Christner et al., 1997Down). Briefly, cells were grown to stationary phase (OD600 1·4) at 37 °C in 10 ml THY medium. Cells were pelleted by centrifugation (21 000 g for 30 s), resuspended in 1 ml Trizol reagent and transferred to a screw-cap tube containing 0·5 ml of 0·1 mm zirconia/silica beads. Bacteria were lysed by shaking three times in a mini bead beater (Biospec Products) for 30 s. Samples were cooled on ice in between shaking. The lysates were transferred to pre-spun Phase Lock Gel-Heavy tubes (Fischer Scientific) and allowed to incubate at room temperature for 5 min.

Chloroform (0·2 ml) was added and the samples were shaken vigorously for 15 s then centrifuged at 12 000 g for 10 min at 4 °C. The upper aqueous phase was transferred to a microcentrifuge tube and RNA was precipitated by the addition of 0·6 ml isopropyl alcohol and incubation for 10 min at room temperature. The RNA pellet was collected by centrifugation at 12 000 g for 30 min at 4 °C and washed with 70 % ethanol. RNA was dissolved in 100 µl of 1x DNase buffer and treated with 30 U of RNase-free DNase (Promega) for 1 h at 37 °C. RNA was re-precipitated, dissolved in nuclease-free water and incubated at 55–60 °C for 10 min to facilitate dissolution. RNA concentrations were determined by measuring absorbance at 260 nm.

Quantitative real-time RT-PCR (QRT-PCR).
Relative RNA concentrations were determined by QRT-PCR using a Perkin-Elmer TaqMan PCR system (Applied Biosystems). The primers and probe were designed based on the SF370 published S. pyogenes genome sequence (Ferretti et al., 2001Down) using PRIMER EXPRESS 1.5 (ABI). The primer sequences for SK were forward primer TGCATTAACATTTGGAACAGTCAA, reverse primer GTGGACGGTCTGGTAGCCA and probe TCGGTCCAAGCTATTGCTGGGTATGG. For gapdh, the primer sequences were forward primer CCCAGAACTTAACGGTAAACTTGAC, reverse primer TTACAACCAACTCAGTTACTGATCCAG and probe TGCTGCACAACGTGTTCCTGTTCC. Probes were 5'-labelled with 6-carboxyfluorescein and 3'-labelled with ‘black hole quencher’, BHQ1 (Biosearch Technologies). Primers and probes were synthesized by Integrated DNA Technologies.

Each 25 µl PCR mixture contained 50 ng RNA, 1x TaqMan PCR Master Mix, 1x Multiscribe and RNase inhibitor mix (omitted in RT-negative reactions), 300 nM each of the forward and reverse primers and 250 nM probe. For each sample, both RT-positive and RT-negative reactions were tested in triplicate.

The reactions were carried out using an ABI PRISM 5700 sequence detector with optimized cycle conditions: 48 °C for 30 min, 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Amounts of ska were determined relative to gapdh mRNA levels using the -{Delta}{Delta}Ct method as described by the manufacturer (ABI User bulletin number 2). Experiments in our laboratory have shown that S. pyogenes gapdh, recA or oxaloacetate decarboxylase mRNA levels are not significantly affected by mouse passage or the mutations described (data not shown). In addition, agarose gel electrophoresis and ethidium bromide staining confirmed RNA concentrations. For all the QRT-PCR experiments shown, gapdH message was used as the internal control.

SELDI-TOF mass spectrometry.
Surface-enhanced laser desorption ionization–time of flight (SELDI-TOF) mass spectrometry was carried out as described previously (Boyle et al., 2001Down) using the Ciphergen protein chip system (Ciphergen). A hydrophobic H4 protein chip (CiphergenTM) containing a long-chain aliphatic surface capable of binding proteins by reverse-phase interaction was used in this study. Samples (3 µl) were applied to a spot on the chip, allowed to dry, washed with an equal volume of water and allowed to dry at room temperature. To the dry spot, 0·5 µl of energy-absorbing molecules, EAM [3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid) (Sigma) in 50 % acetonitrile (Sigma) and 0·5 % trifluoroacetic acid (Sigma)], was applied. Once dry, EAM was applied for a second time and allowed to dry. The chip was transferred to the Ciphergen SELDI reader and samples were analysed following desorption of bound proteins by short, intense pulses from a N2 320 nm UV-laser and detected by time of flight in a mass spectrometer.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Acquisition of surface plasmin(ogen)-dependent enzymic activity by invasive and non-invasive variants of S. pyogenes
Previous studies from our laboratory have suggested that the ability of bacteria to acquire surface plasminogen activator activity and unregulated plasmin may contribute to their skin invasive potential (Li et al., 1999aDown). Acquisition of this surface plasminogen activator activity requires expression of surface fibrinogen-binding M and M-related protein and secretion of SK (D’Costa & Boyle, 1998Down). If this is a biologically relevant mechanism we hypothesized that the ability to acquire surface plasminogen activator activity might vary between invasive and non-invasive isolates.

To test this hypothesis, the congenic variants of M1 serotype isolate 1881 (Raeder & Boyle, 1996Down; Saouda et al., 2001Down; Talkington et al., 1993Down) grown in the presence of human plasma (10 %) were compared for their ability to acquire plasmin(ogen)-dependent surface-bound enzymic activity. Wild-type 1881 (WT1881) acquired only 35 % of the plasmin(ogen)-dependent enzymic activity compared to the spleen-recovered variant (SR1881) (0·7±0·2 A405 units vs 2·0±0·1 A405 units). This effect cannot be due to differences in growth since previous work has shown no difference in the growth rates of the wild-type and spleen-recovered strains (Raeder & Boyle, 1996Down; Saouda et al., 2001Down; Talkington et al., 1993Down). When anti-SK antibody was added to the assays the amount of plasmin(ogen)-dependent enzymic activity was decreased to background levels in both the wild-type and isolate SR1881. The observed inhibition was immunoglobulin-specific since addition of an antibody of irrelevant specificity had no effect. These results indicated that the plasmin(ogen)-dependent enzymic activity acquired by either wild-type or SR1881 was dependent on SK.

The enhanced plasmin(ogen)-dependent surface enzymic activity of isolate SR1881 could be, in part, explained by the overexpression of surface fibrinogen-binding M proteins in this isolate and that SR1881 binds fibrinogen only to a limited extent (Raeder & Boyle, 1993Down, 1995Down, 1996Down). Previous studies of acquisition of plasmin(ogen)-dependent enzymic activity have demonstrated that SK is normally the limiting factor (Wang et al., 1994Down, 1995aDown, bDown). This also appeared to be the case for WT1881 since addition of purified SK (200 U) to this isolate resulted in high levels of plasmin(ogen)-dependent surface enzymic activity (data not shown).

Mouse-passaged isolates have increased SK activity and expression
Since SK was limiting for plasmin(ogen)-dependent surface enzymic activity one explanation for the increase in this activity after mouse passage was an increase in SK expression and activity. To test this, the ability of WT1881 and SR1881 isolates to secrete SK was determined in overnight culture supernatants of each isolate. The WT1881 isolate failed to secrete detectable levels of SK activity in culture while SR1881 secreted significant levels of the plasminogen activator (Fig. 1Down). This effect was not due to growth differences between the strains since both isolates have equivalent growth rates (Saouda et al., 2001Down).



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1. Analysis of SK activity in WT1881 and SR1881 isolates of S. pyogenes. Wild-type (WT1881; {blacktriangleup}) and spleen-recovered (SR1881; {blacksquare}) isolates of 1881 were grown at 37 °C for 16 h. SK activity in culture supernatants was determined by hydrolysis of the plasmin selective substrate H-D-Val-Leu-Lys p-nitroanilide (S-2251) as described in Methods. The experiment shown is representative of multiple independent experiments.

 
A possible explanation for the higher level of SK in cultures of SR1881 is that mouse skin passage of isolate 1881 resulted in increased ska transcription. To test this, RNA from WT1881 and SR1881 isolates was extracted at stationary phase and the amounts of ska mRNA relative to gapdh were determined by QRT-PCR as described in Methods. In the stationary phase, ska message was eightfold higher in the SR1881 variant compared to WT1881 (relative expression 8±0·2 vs 1±0·1).

SpeB degrades SK in vitro and in vivo
Based on the presence of detectable ska message in WT1881 and the very sensitive functional assay for SK, the complete absence of plasminogen activator activity in the WT1881 culture medium would not be expected. This type of discrepancy between message level and protein expression has been reported previously for other S. pyogenes gene products (Raeder et al., 2000Down). For example, surface M protein and other cell-surface and secreted proteins can be expressed and then post-translationally degraded by the secreted cysteine protease SpeB (Berge et al., 1997Down; Lei et al., 2000Down; Pinkney et al., 1995Down; Raeder et al., 1998Down).

Since the ability to secrete the cysteine protease SpeB is a well-characterized difference between WT1881 and SR1881 (Raeder & Boyle, 1996Down; Saouda et al., 2001Down), one potential explanation for the discrepancy between the SK protein level (Fig. 1Up) and the ska mRNA level (QRT-PCR) was the possibility that SpeB was degrading SK. To test this hypothesis, WT1881 and SR1881 were grown in the presence of the cysteine protease inhibitor E64. There was significantly more SK activity in stationary-phase-culture supernatants from WT1881 grown in the presence of E64 than in the absence of the inhibitor (Fig. 2Downa). There was no significant effect on the SK level when E64 was added to the SpeB- SR1881 isolate and addition of E64 did not affect the amount of ska mRNA detected in either isolate (data not shown). A similar experiment using a targeted isogenic SpeB- mutant of isolate 1881 (described in Raeder et al., 1998Down) demonstrated a significant increase in SK when compared to the wild-type (Fig. 2bDown). This speB mutation, however, had no significant effect on ska gene transcription as assayed by QRT-PCR (data not shown).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. (a) Analysis of SK activity in WT1881 and SR1881 isolates of S. pyogenes with (open symbols) or without (solid symbols) 10 µM E64. Wild-type (WT1881; {lozenge}, {blacklozenge}) and spleen-recovered (SR1881; {circ}, {bullet}) isolates of 1881 were grown at 37 °C overnight. SK activity in culture supernatants was determined by hydrolysis of the plasmin selective substrate H-D-Val-Leu-Lys p-nitroanilide (S-2251) as described in Methods. The experiment shown is representative of multiple independent experiments. (b) Analysis of SK activity in WT1881 ({bullet}) and an isogenic speB mutant ({circ}). The wild-type (WT1881) or the isogenic speB mutant (Raeder et al., 1998Down) of 1881 was grown at 37 °C overnight. SK activity in culture supernatants was determined by hydrolysis of the plasmin selective substrate S-2251 as described in Methods. The experiment shown is representative of multiple independent experiments.

 
When the levels of SK were compared between WT1881 and SR1881 grown in the presence of E64, there was a significant quantitative difference which was predicted based on the increased level of ska mRNA in SR1881.

To analyse the potential effects of SpeB on SK, purified proteins were mixed at a ratio of 1 : 2 (SpeB/SK). Following incubation for various times at room temperature, E64 was added to prevent further enzymic degradation and at 30 min all samples were analysed using a hydrophobic H4 protein chip and SELDI-TOF mass spectrometer as described in Methods. In the mass spectrometer, activated SpeB was identified by time of flight as a 28 480 Da protein while the SK protein demonstrated a molecular mass of 47 921 Da. These molecular mass estimates corresponded to the previously reported molecular masses of each of the proteins (Boyle et al., 2001Down; Radek & Castellino, 1989Down).

When E64 was added at time zero, both proteins could be readily detected and the area under the SpeB peak remained constant at all time points (Fig. 3Down). In contrast, the SK peak decreased and within 30 min of incubation with active SpeB was not detectable (Fig. 3Down). As the area under the SK peak decreased, small-molecular-mass fragments (<10 kDa) were detected in the mass spectra that were not observed when SpeB or SK was incubated alone (data not shown). These results are consistent with post-translational degradation of SK by SpeB. Other studies (Johnston & Zabriskie, 1986Down; Svensson et al., 2002Down) have also suggested that SpeB degrades SK in stationary-phase cultures of S. pyogenes.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. SELDI-TOF analysis of the effect of SpeB on SK. Purified SpeB and purified SK, mixed at a ratio of 1 : 2 in PBS, were incubated for various times at ambient temperature. Following each time point, SpeB activity was inhibited by the addition of 10 µM E64 and 3 µl of the mixture was applied to a H4 chip; the solutions were allowed to dry. Following mixture with energy absorbing molecules (EAM), proteins were detected using the Ciphergen SELDI-TOF reader. The peak at ~28 kDa corresponds to the molecular mass of SpeB and the peak at ~48 kDa corresponds to the molecular mass of SK. Under the same conditions, SK incubated without SpeB was stable (data not shown). For precise experimental details see Methods.

 
Taken together, these data suggest that the difference in SK expression noted between the wild-type and spleen-recovered isolates can be accounted for by two effects: (1) biological pressure leading to up-regulation of the ska gene expression and (2) post-translational degradation of SK by the cysteine protease SpeB.

SK activity is not essential for increased expression of ska after mouse passage
To determine whether expression of SK was necessary for the selection of the invasive spleen-recovered variants, we isolated a ska : : lacZ transcriptional fusion in a wild-type 1881 background (Sledjeski et al., 2001Down). The insertion of the lacZ gene abolished expression of the SK protein. Colonies of the ska : : lacZ reporter fusion were white on X-Gal indicator plates, suggesting a low level of {beta}-galactosidase activity. After injection into a mouse skin air-sac and recovery from the spleen, the ska : : lacZ fusion strains were blue on the indicator plates, suggesting increased transcription of the ska : : lacZ fusion. As with the mouse-passaged wild-type 1881, these strains also had decreased speB expression as detected with QRT-PCR [386 (±43)-fold decrease compared to wild-type]. Therefore, these results provide evidence for co-ordinate regulation of ska and speB transcription in the absence of functional SK.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we showed that S. pyogenes, recovered after passage through a mouse skin air-sac model of infection, had an enhanced ability to bind and activate human plasmin(ogen). This increased acquisition of active plasmin(ogen) correlated with increased expression of the plasmin(ogen)-activating protein SK. The increase in SK expression was a combination of an eightfold increase in transcription of ska and stabilization of the protein due to loss of SpeB expression. Finally, using SELDI-TOF mass spectrometry, we provided direct evidence that SpeB degrades SK.

The interaction of invasive pathogens with the host plasminogen system has been proposed as a common characteristic of invasive pathogens (Boyle & Lottenberg, 1997Down; Coleman & Benach, 1999Down; Lahteenmaki et al., 2001Down; Lottenberg et al., 1994Down). The ability to capture unregulatable plasmin on the surface of a pathogen has been observed irrespective of whether the organism can produce its own plasminogen activator (Boyle & Lottenberg, 1997Down; Coleman & Benach, 1999Down; Lahteenmaki et al., 2001Down). Organisms that lack plasminogen activator potential have developed the ability to capture host plasminogen activators in a non-regulatable form (Coleman & Benach, 1999Down).

Streptococci represent one of the best-studied models for interaction of a pathogen with the host plasminogen system. These organisms can secrete a plasminogen activator, SK, which binds plasminogen to form a 1 : 1 complex that acts as a plasminogen activator (Robbins & Markus, 1976Down). The plasminogen activation potential of SK is species-specific and parallels the host range that a given streptococcal species can infect (Boyle & Lottenberg, 1997Down; Marcum & Kline, 1983Down; Wohl et al., 1983Down). The references cited demonstrated plasmin activity on the bacterial surface. The plasminogen activator activity was shown later by D’Costa & Boyle (1998)Down.

In an extensive series of studies of the interaction of S. pyogenes with human plasma, we have demonstrated a highly developed system by which the organism can acquire surface plasminogen activator and unregulated plasmin activity when grown in human plasma (DesJardin et al., 1989Down; Lottenberg et al., 1994Down). In this model, two bacterial proteins are critical – a surface fibrinogen-binding protein and the secreted plasminogen activator SK (Christner et al., 1997Down; D’Costa & Boyle, 1998Down, 2000Down; Wang et al., 1994Down, 1995aDown, bDown). Fibrinogen binds to surface M or M-related proteins and provides an anchor to bind an SK–plasminogen complex. The surface fibrinogen-binding protein is also involved in the surface localization of the cytosolic enzyme GAPDH (D’Costa et al., 2000Down) allowing it to act as a surface plasmin-binding protein (PLR) (D’Costa & Boyle, 1998Down, 2000Down; D’Costa et al., 2000Down; Lottenberg et al., 1987Down).

Earlier studies demonstrated that differences in the invasive potential of M1 serotype isolates could be distinguished based on the expression of different quantitative and qualitative patterns of IgG-binding, fibrinogen-binding, M1 proteins (Raeder & Boyle, 1993Down, 1995Down, 1996Down). S. pyogenes variants that were more invasive were isolated after passage through mouse skin and recovery from the spleen of a lethally infected mouse (Raeder & Boyle, 1993Down). The acquisition of a skin-invasive phenotype was also associated with the conversion of the isolate from SpeB+ to SpeB-. In this study, we have examined these selected variants for effects on SK secretion.

Invasive variants secreted more SK in culture due to increased transcription of the SK gene, ska, and decreased degradation of SK due to absence of SpeB protease expression. Analysis of the invasive variant SR1881 shows co-ordinate regulation of at least three key genes, emm (Boyle et al., 1998Down) and ska (this study) (up-regulation) and speB (Saouda et al., 2001Down) (down-regulation), which would favour efficient capture of surface plasmin(ogen)-dependent enzymic activity by S. pyogenes. While emm gene expression is known to be under the control of the trans-acting regulator mga (Caparon & Scott, 1987Down; McIver & Scott, 1997Down), this regulator has no effect on ska or speB expression. Expression of speB is controlled by rgg and this regulator has no effect on emm or ska expression (Chaussee et al., 1999Down, 2001Down; Lyon et al., 1998Down). Thus, a global regulatory pathway, or a series of pathways, must be involved in selection of the mouse-invasive phenotypic variants. A similar regulatory pathway has also been implicated in the regulation of Protein H expression in S. pyogenes (Smith et al., 2003aDown, bDown). Other regulators with effects on ska, speB and/or emm gene expression have been identified in S. pyogenes. These include the global regulators pel (Li et al., 1999bDown), fasX (Kreikemeyer et al., 2001Down), covRS (csrRS) (Federle et al., 1999Down; Heath et al., 1999Down) and luxS (Lyon et al., 2001Down). These regulators also affect other phenotypic characteristics such as {beta}-haemolysis and capsule (Federle et al., 1999Down; Heath et al., 1999Down; Kreikemeyer et al., 2001Down; Li et al., 1999aDown; Lyon et al., 2001Down). Although ska is clearly co-ordinately regulated with emm and speB in the mouse-passaged isolates, it was surprising that SK was not necessary for the selection of this phenotype. Since the ability to acquire surface plasminogen activator activity was important in establishing an invasive infection in the human host, then co-ordinate regulation of the key bacterial factors – the surface fibrinogen-binding proteins and the secreted plasminogen activator SK – would be anticipated. Furthermore, concomitant down-regulation of SpeB, which is known to degrade both of these bacterial factors, would also be expected. In this study, we have obtained evidence for selection of variants that display these predicted characteristics. One question remaining is, what is the signal that S. pyogenes senses in the mouse skin air-sac that is not present in the peritoneum? We do not believe that M protein, SK or SpeB act as sensors or that plasminogen is directly sensed. Instead, we propose that S. pyogenes senses an environmental signal associated with the skin and thus would be expected to be present in both the skin air-sac of mice and potentially in a corresponding site of infection in human skin. The bacterial response to this signal (in mice and in humans) is a stable increase in plasminogen binding and activation. This would explain why we observe increased SK expression even in the absence of SK or human plasminogen.

Taken together, the results presented in this study suggest that there are a variety of additional regulatory pathways that play an important role in determining the skin invasive potential of S. pyogenes. It was of interest that selected invasive variants demonstrate co-ordinate regulation of genes that favour acquisition of host plasmin(ogen)-dependent enzymic activity. Recently, Svensson et al. (2002)Down reported that inactivation of the SK or the plasminogen-binding M protein (PAM) genes results in significant loss of virulence in a human-skin-SCID mouse model of impetigo. These findings further support the importance of an interaction between the pathogen and the host plasminogen system in the pathogenesis of invasive streptococcal skin infections.


    ACKNOWLEDGEMENTS
 
This work was supported by grant N-100229-01 from the Ohio Valley affiliate of the American Heart Association and by grants AI-43474 and AI-50731 from the National Institutes of Health.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Berge, A., Kihlberg, B. M., Sjoholm, A. G. & Bjorck, L. (1997). Streptococcal protein H forms soluble complement-activating complexes with IgG, but inhibits complement activation by IgG-coated targets. J Biol Chem 272, 20774–20781.[Abstract/Free Full Text]

Boyle, M. D. & Lottenberg, R. (1997). Plasminogen activation by invasive human pathogens. Thromb Haemost 77, 1–10.[Medline]

Boyle, M. D., Raeder, R., Flosdorff, A. & Podbielski, A. (1998). Role of emm and mrp genes in the virulence of group A streptococcal isolate 64/14 in a mouse model of skin infection. J Infect Dis 177, 991–997.[Medline]

Boyle, M. D., Romer, T. G., Meeker, A. K. & Sledjeski, D. D. (2001). Use of surface-enhanced laser desorption ionization protein chip system to analyze streptococcal exotoxin B activity secreted by Streptococcus pyogenes. J Microbiol Methods 46, 87–97.[CrossRef][Medline]

Caparon, M. G. & Scott, J. R. (1987). Identification of a gene that regulates expression of M protein, the major virulence determinant of group A streptococci. Proc Natl Acad Sci U S A 84, 8677–8681.[Abstract/Free Full Text]

Chaussee, M. S., Ajdic, D. & Ferretti, J. J. (1999). The rgg gene of Streptococcus pyogenes NZ131 positively influences extracellular SPE B production. Infect Immun 67, 1715–1722.[Abstract/Free Full Text]

Chaussee, M. S., Watson, R. O., Smoot, J. C. & Musser, J. M. (2001). Identification of Rgg-regulated exoproteins of Streptococcus pyogenes. Infect Immun 69, 822–831.[Abstract/Free Full Text]

Christner, R., Li, Z., Raeder, R., Podbielski, A. & Boyle, M. D. (1997). Identification of key gene products required for acquisition of plasmin-like enzymatic activity by group A streptococci. J Infect Dis 175, 1115–1120.[Medline]

Coleman, J. L. & Benach, J. L. (1999). Use of the plasminogen activation system by microorganisms. J Lab Clin Med 134, 567–576.[CrossRef][Medline]

D’Costa, S. S. & Boyle, M. D. (1998). Interaction of a group A streptococcus within human plasma results in assembly of a surface plasminogen activator that contributes to occupancy of surface plasmin-binding structures. Microb Pathog 24, 341–349.[CrossRef][Medline]

D’Costa, S. S. & Boyle, M. D. (2000). Interaction of group A streptococci with human plasmin(ogen) under physiological conditions. Methods 21, 165–177.[CrossRef][Medline]

D’Costa, S. S., Romer, T. G. & Boyle, M. D. (2000). Analysis of expression of a cytosolic enzyme on the surface of Streptococcus pyogenes. Biochem Biophys Res Commun 278, 826–832.[CrossRef][Medline]

DesJardin, L. E., Boyle, M. D. & Lottenberg, R. (1989). Group A streptococci bind human plasmin but not other structurally related proteins. Thromb Res 55, 187–193.[CrossRef][Medline]

Federle, M. J., McIver, K. S. & Scott, J. R. (1999). A response regulator that represses transcription of several virulence operons in the group A streptococcus. J Bacteriol 181, 3649–3657.[Abstract/Free Full Text]

Ferretti, J. J., McShan, W. M., Ajdic, D. & 20 other authors (2001). Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc Natl Acad Sci U S A 98, 4658–4663.[Abstract/Free Full Text]

Heath, A., DiRita, V. J., Barg, N. L. & Engleberg, N. C. (1999). A two-component regulatory system, CsrR-CsrS, represses expression of three Streptococcus pyogenes virulence factors, hyaluronic acid capsule, streptolysin S, and pyrogenic exotoxin B. Infect Immun 67, 5298–5305.[Abstract/Free Full Text]

Johnston, K. H. & Zabriskie, J. B. (1986). Purification and partial characterization of the nephritis strain-associated protein from Streptococcus pyogenes, group A. J Exp Med 163, 697–712.[Abstract/Free Full Text]

Kreikemeyer, B., Boyle, M. D., Buttaro, B. A., Heinemann, M. & Podbielski, A. (2001). Group A streptococcal growth phase-associated virulence factor regulation by a novel operon (Fas) with homologies to two-component-type regulators requires a small RNA molecule. Mol Microbiol 39, 392–406.[CrossRef][Medline]

Lahteenmaki, K., Kuusela, P. & Korhonen, T. K. (2001). Bacterial plasminogen activators and receptors. FEMS Microbiol Rev 25, 531–552.[Medline]

Lei, B., Mackie, S., Lukomski, S. & Musser, J. M. (2000). Identification and immunogenicity of group A Streptococcus culture supernatant proteins. Infect Immun 68, 6807–6818.[Abstract/Free Full Text]

Li, Z., Ploplis, V. A., French, E. L. & Boyle, M. D. (1999a). Interaction between group A streptococci and the plasmin(ogen) system promotes virulence in a mouse skin infection model. J Infect Dis 179, 907–914.[CrossRef][Medline]

Li, Z., Sledjeski, D. D., Kreikemeyer, B., Podbielski, A. & Boyle, M. D. (1999b). Identification of pel, a Streptococcus pyogenes locus that affects both surface and secreted proteins. J Bacteriol 181, 6019–6027.[Abstract/Free Full Text]

Lottenberg, R., Broder, C. C. & Boyle, M. D. (1987). Identification of a specific receptor for plasmin on a group A streptococcus. Infect Immun 55, 1914–1918.[Abstract/Free Full Text]

Lottenberg, R., Minning-Wenz, D. & Boyle, M. D. (1994). Capturing host plasmin(ogen): a common mechanism for invasive pathogens? Trends Microbiol 2, 20–24.[CrossRef][Medline]

Lyon, W. R., Gibson, C. M. & Caparon, M. G. (1998). A role for trigger factor and an rgg-like regulator in the transcription, secretion and processing of the cysteine proteinase of Streptococcus pyogenes. EMBO J 17, 6263–6275.[CrossRef][Medline]

Lyon, W. R., Madden, J. C., Levin, J. C., Stein, J. L. & Caparon, M. G. (2001). Mutation of luxS affects growth and virulence factor expression in Streptococcus pyogenes. Mol Microbiol 42, 145–157.[CrossRef][Medline]

Marcum, J. A. & Kline, D. L. (1983). Species specificity of streptokinase. Comp Biochem Physiol B 75, 389–394.[CrossRef][Medline]

McCoy, H. E., Broder, C. C. & Lottenberg, R. (1991). Streptokinases produced by pathogenic group C streptococci demonstrate species-specific plasminogen activation. J Infect Dis 164, 515–521.[Medline]

McIver, K. S. & Scott, J. R. (1997). Role of mga in growth phase regulation of virulence genes of the group A streptococcus. J Bacteriol 179, 5178–5187.[Abstract/Free Full Text]

Nowicki, S. T., Minning-Wenz, D., Johnston, K. H. & Lottenberg, R. (1994). Characterization of a novel streptokinase produced by Streptococcus equisimilis of non-human origin. Thromb Haemost 72, 595–603.[Medline]

Pinkney, M., Kapur, V., Smith, J. & 7 other authors (1995). Different forms of streptolysin O produced by Streptococcus pyogenes and by Escherichia coli expressing recombinant toxin: cleavage by streptococcal cysteine protease. Infect Immun 63, 2776–2779.[Abstract]

Radek, J. T. & Castellino, F. J. (1989). Conformational properties of streptokinase. J Biol Chem 264, 9915–9922.[Abstract/Free Full Text]

Raeder, R. & Boyle, M. D. (1993). Association between expression of immunoglobulin G-binding proteins by group A streptococci and virulence in a mouse skin infection model. Infect Immun 61, 1378–1384.[Abstract/Free Full Text]

Raeder, R. & Boyle, M. D. (1995). Distinct profiles of immunoglobulin G-binding-protein expression by invasive serotype M1 isolates of Streptococcus pyogenes. Clin Diagn Lab Immunol 2, 478–483.[Abstract]

Raeder, R. & Boyle, M. D. (1996). Properties of IgG-binding proteins expressed by Streptococcus pyogenes isolates are predictive of invasive potential. J Infect Dis 173, 888–895.[Medline]

Raeder, R., Woischnik, M., Podbielski, A. & Boyle, M. D. (1998). A secreted streptococcal cysteine protease can cleave a surface-expressed M1 protein and alter the immunoglobulin binding properties. Res Microbiol 149, 539–548.[Medline]

Raeder, R., Harokopakis, E., Hollingshead, S. & Boyle, M. D. (2000). Absence of SpeB production in virulent large capsular forms of group A streptococcal strain 64. Infect Immun 68, 744–751.[Abstract/Free Full Text]

Robbins, K. C. & Markus, G. (1976). The interaction of human plasminogen with streptokinase. In Fibrinolysis, pp. 61–75. Edited by P. J. Gaffney & S. Balkuv-Ulutin. New York: Academic Press.

Saouda, M., Wu, W., Conran, P. & Boyle, M. D. (2001). Streptococcal pyrogenic exotoxin B enhances tissue damage initiated by other Streptococcus pyogenes products. J Infect Dis 184, 723–731.[CrossRef][Medline]

Schroeder, B., Boyle, M. D., Sheerin, B. R., Asbury, A. C. & Lottenberg, R. (1999). Species specificity of plasminogen activation and acquisition of surface-associated proteolytic activity by group C streptococci grown in plasma. Infect Immun 67, 6487–6495.[Abstract/Free Full Text]

Sledjeski, D. D., Coco, C., Corriher, C. & Boyle, M. D. (2001). Isolation of human plasma-inducible, growth phase- and temperature-regulated gene fusions in Streptococcus pyogenes using a Tn917-lacZ transposon. J Microbiol Methods 46, 107–117.[CrossRef][Medline]

Smith, T. C., Sledjeski, D. D. & Boyle, M. D. (2003a). Regulation of protein H expression in M1 serotype isolates of Streptococcus pyogenes. FEMS Microbiol Lett 219, 9–15.[CrossRef][Medline]

Smith, T. C., Sledjeski, D. D. & Boyle, M. D. (2003b). Streptococcus pyogenes infection in mouse skin leads to a time-dependent up-regulation of protein H expression. Infect Immun 71, 6079–6082.[Abstract/Free Full Text]

Svensson, M. D., Sjobring, U., Luo, F. & Bessen, D. E. (2002). Roles of the plasminogen activator streptokinase and the plasminogen-associated M protein in an experimental model for streptococcal impetigo. Microbiology 148, 3933–3945.[Abstract/Free Full Text]

Talkington, D. F., Schwartz, B., Black, C. M., Todd, J. K., Elliott, J., Breiman, R. F. & Facklam, R. R. (1993). Association of phenotypic and genotypic characteristics of invasive Streptococcus pyogenes isolates with clinical components of streptococcal toxic shock syndrome. Infect Immun 61, 3369–3374.[Abstract/Free Full Text]

Wang, H., Lottenberg, R. & Boyle, M. D. (1994). Analysis of plasmin(ogen) acquisition by clinical isolates of group A streptococci incubated in human plasma. J Infect Dis 169, 143–149.[Medline]

Wang, H., Lottenberg, R. & Boyle, M. D. (1995a). Analysis of the interaction of group A streptococci with fibrinogen, streptokinase and plasminogen. Microb Pathog 18, 153–166.[CrossRef][Medline]

Wang, H., Lottenberg, R. & Boyle, M. D. (1995b). A role for fibrinogen in the streptokinase-dependent acquisition of plasmin(ogen) by group A streptococci. J Infect Dis 171, 85–92.[Medline]

Wohl, R. C., Sinio, L., Summaria, L. & Robbins, K. C. (1983). Comparative activation kinetics of mammalian plasminogens. Biochim Biophys Acta 745, 20–31.[CrossRef][Medline]

Received 10 October 2003; revised 12 November 2003; accepted 17 November 2003.


This article has been cited by other articles:


Home page
FASEB J.Home page
J. D. McArthur, F. C. McKay, V. Ramachandran, P. Shyam, A. J. Cork, M. L. Sanderson-Smith, J. N. Cole, U. Ringdahl, U. Sjobring, M. Ranson, et al.
Allelic variants of streptokinase from Streptococcus pyogenes display functional differences in plasminogen activation
FASEB J, September 1, 2008; 22(9): 3146 - 3153.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. N. Cole, J. D. McArthur, F. C. McKay, M. L. Sanderson-Smith, A. J. Cork, M. Ranson, M. Rohde, A. Itzek, H. Sun, D. Ginsburg, et al.
Trigger for group A streptococcal M1T1 invasive disease
FASEB J, August 1, 2006; 20(10): 1745 - 1747.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. R. Lafontaine, D. Wall, S. L. Vanlerberg, H. Donabedian, and D. D. Sledjeski
Moraxella catarrhalis Coaggregates with Streptococcus pyogenes and Modulates Interactions of S. pyogenes with Human Epithelial Cells
Infect. Immun., November 1, 2004; 72(11): 6689 - 6693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rezcallah, M. S.
Right arrow Articles by Sledjeski, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rezcallah, M. S.
Right arrow Articles by Sledjeski, D. D.
Agricola
Right arrow Articles by Rezcallah, M. S.
Right arrow Articles by Sledjeski, D. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2004 Society for General Microbiology.