|
|
||||||||
Génétique Microbienne, INRA, Domaine de Vilvert, 78352 Jouy en Josas cedex, France
Correspondence
Benjamin Candelon
bcandel{at}jouy.inra.fr
| ABSTRACT |
|---|
|
|
|---|
The GenBank accession numbers for the sequences determined in this work are given in the text.
| INTRODUCTION |
|---|
|
|
|---|
In several previous studies, Southern hybridization and inverse PCR were used for ribotyping the B. cereus group strains (Johansen et al., 1996
; Lechner et al., 1998
; Patra et al., 2002
; Priest et al., 1994
). However, these works led only to approximate determination of the rRNA operon number (Patra et al., 2002
). Recently the entire genomic sequence of the type strain B. cereus ATCC 14579 was established (Ivanova et al., 2003
). In this study we determined the precise number of rRNA operons and compared them in several strains of the B. cereus group distinguished by different phenotypes such as specific insect pathogenicity for B. thuringiensis (Schnepf et al., 1998
), psychrotolerance for B. weihenstephanensis (Lechner et al., 1998
), or food-related pathogenicity for B. cereus 391-98 (Lund et al., 2000
). Thirteen to fourteen rRNA operons were identified, the highest number ever detected in bacteria. To determine the relationships between these strains, we carried out parallel sequencing of several genes distributed over their chromosomes. The accurate analysis of rRNA operon sequences in the type strain revealed sequence variations, which suggest the existence of two distinct classes of rRNA operons. The eleven rRNA operons of the recently sequenced B. anthracis Ames (Ban Ames) (Read et al., 2003
) exhibit a similar polymorphism, suggesting that the presence of two distinct classes of rRNA operons is a general feature through the B. cereus group.
| METHODS |
|---|
|
|
|---|
|
PCR amplification.
PCR using the Expand Long Template PCR System (Roche Diagnostics) was used to obtain templates for sequencing and for preparing DNA hybridization probes. The cycling program was: 94 °C for 5 min; 12 cycles of 94 °C for 10 s and 68 °C for 12 min; 24 cycles of 94 °C for 10 s and 68 °C starting from 12 min and increasing this time by 15 s each cycle. The final extension was done at 72 °C for 10 min.
Sequencing procedures.
PCR products were treated for 1 h at 37 °C with exonuclease I and shrimp alkaline phosphatase (USB). Sequencing reactions were performed using an ABI PRISM sequencing kit (Applied Biosystems). Products of reactions were ethanol precipitated and analysed with an ABI 3700 sequencer (Applied Biosystems).
Separate amplification of each operon was performed using oligonucleotides listed in Table 2
. Sequencing was done on each amplification product separately using a set of 32 oligonucleotides with sequences common to all operons (oligonucleotide sequences can be provided on request). PCR amplification and sequencing of the regions between closely located 5S and 16S rRNA genes of operons rrnC and rrnD respectively were done using the following oligonucleotides: FIAH7 (5'GCCAGCTTATTCAACTAGCACTTG3'), FIAH8 (5'GTTTCCCGGAGTTATCCCAGTCTTA3'), FIBH7 (5'GATCCCTGAAAGATGATCAGGTTG3') and FIBH8 (5'GTTCCCATACCGAACACGGAAGTT3'). Assembly was performed manually using Staden's XBAP version 14.0 software (Dear & Staden, 1991
) and consensus sequences of 16S, 23S and 5S rRNA genes as scaffold. The 13 rRNA operon sequences were deposited at NCBI under accession numbers AY224379AY224388.
|
-32P]dCTP (3000 Ci mmol-1; 110 TBq mmol-1). Hybridization of the probe to DNA blotted on membrane was done overnight at 65 °C using the Rapid-hyb buffer (Amersham). Hybridized bands were detected using a STORM Scanner (Molecular Dynamics) and quantified using ImageQuant 5.2 software (Molecular Dynamics).
Determination of the number of rRNA operons.
Total DNA of each strain was digested with BclI, ClaI or HindIII. An internal fragment of the 16S rRNA gene was used as the probe and the enzymes used had no recognition sites within the 16S rRNA gene but had one or more sites within the 23S rRNA gene. In these conditions, each ribosomal operon was expected to produce only one DNA fragment able to hybridize to the probe. Intensity of each hybridization band was measured using the STORM scanner. After background subtraction, an iterative process was applied to determine the number of rRNA operons corresponding to each hybridized DNA band, assuming that each operon contributed equally to the signal intensity. In iteration the signal corresponding to one rRNA operon was estimated by dividing the intensity of each hybridization band by the postulated number of rRNA operons to which the band corresponded. The relative error of the signals of one rRNA operon, measured by using the different hybridized bands, was then calculated by the formula
|
|
|
Genetic relationships.
To investigate the genetic relationships of the different strains, seven genes distributed over the 5·4 Mb chromosome of the entirely sequenced type strain Bce 6A5 (Ivanova et al., 2003
) were partially sequenced in all strains. These were: clpC (position on the chromosome 90 kb) encoding the ClpC regulator; purF (300 kb), encoding glutamine phosphoribosylpyrophosphate amidotransferase; gdpD (574 kb), encoding glycerophosphoryl diester phosphodiesterase; yhfL (1068 kb), encoding long-chain fatty acid CoA ligase; panC (1484 kb), encoding pantoate
-alanine ligase; dinB (4103 kb), encoding DNA polymerase IV; plcR (5255 kb), encoding transcriptional regulator PlcR. The corresponding oligonucleotides used for PCR amplification and sequencing were: 5'GTACGCGAAGGTGAAGGAATTGC3' and 5'ATGCATCGATTGCACCTTCTGCTC3' for clpC (the nucleotide sequences used for phylogenetic analyses correspond to positions 151650 from the first primer); 5'CGAAGAATGTGGCGTTTTCGGAA3' and 5'GAAATACTAGAGTCTGGTACACCAG3' for purF (positions 101700); 5'GGTGGTTATGCAAATGCGACAAATG3' and 5'CGCCATAATATAAAATGGCGTCACG3' for gdpD (positions 101600); 5'GCGAAACCTCATCAGATTTTAACC3' and 5'CAGGTACTTCTTCCCCAAGTTCAT3' for yhfL (positions 101600); 5'CGATATCCTCGTGATATTGATAGAG3' and 5'TCCGCATAATCTACAGTGCCTTTC3' for panC (positions 101450); 5'GAGGCGAGAGAATACGGAATACG3' and 5'GCCCATTTGACTCGGATCCACT3' for dinB (positions 101500); and 5'CCCAAGTATGGATATATTGCAAGG3' and 5'CCAATTAATGCCATACTATTAATTCGGC3' for plcR (positions 101500). The resulting sequences were deposited at NCBI under GenBank accession numbers AY224696AY224779. Corresponding sequences of the B. anthracis strain Ames were also used in this study (accession no. AE016879) (Read et al., 2003
). The same source was used for Ban Ames rRNA operon analysis. Five other genes were also tested, but they were eliminated since we did not succeed in amplifying and sequencing them in all strains. The nucleotide sequences from each strain were compared by the neighbour-joining method using the multiple alignment program CLUSTALX 1.8 (Thompson et al., 1997
) and the phylogenetic trees calculated using 1000 bootstrap trials were visualized by the NJplot software (Perriere & Gouy, 1996
).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
The quantitative Southern hybridization approach used for strain Bce 6A5 was applied to 11 other strains from the B. cereus group. The selected strains represent the diversity of this group. According to previous studies, strains Bce 6A5, Bce 6A1 and B. thuringiensis subsp. canadensis (Btc) HD224 are closely related (Carlson et al., 1994
), B. thuringiensis subsp. israelensis (Bti) and B. thuringiensis subsp. kurstaki (Btk) strains represent the most important insecticidal groups (Hofte & Whiteley, 1989
), B. weihenstephanensis (Bwe) strains represent a large cluster of psychrotolerant strains (Lechner et al., 1998
) and strain Bce 391-98 was characterized as having a high pathogenic potential (Lund et al., 2000
). As in the case of strain Bce 6A5, three enzymes, BclI, ClaI and HindIII, were used. Representative ribotype profiles of these strains, using digestion by HindIII, and the deduced number of rRNA operons are shown in Fig. 2(A, B)
. Most of the studied strains appeared to possess 13 rRNA operons, like the type strain Bce 6A5; 14 rRNA operons were detected for the other strains. If a correct number was used for calculation, the relative statistical error was 34 %. This error increased up to 920 % if the number used for calculation differed by 1 (Fig. 1B
). In all cases, the minimal value of the statistical error correlated with the highest linear regression coefficient. This asserted that the intensity of hybridization signal varies linearly with the number of hybridized fragments, and hence with the number of rRNA operons. Thus, this approach provides an unambiguous estimation of the repeat number of a sequence in a genome even when it is as high as 14.
|
Genetic relationships between strains of the B. cereus group
To verify the relationships between strains presented above, we sequenced seven genes distributed over the chromosome of Bce 6A5 in the 12 studied strains. We also added the corresponding sequences of B. anthracis strain Ames (Ban Ames) (Read et al., 2003
) to get a wider view of the B. cereus group. Trees were constructed using the nucleotide sequences obtained for all genes. Examples of representative dendrograms are given in Fig. 3
(gdpD, panC and plcR genes). The resulting trees were almost fully congruent, for all the genes tested, except plcR, and they confirmed the separate clustering of the five Bwe psychrotolerant strains from the type strain Bce 6A5 and its relatives. For all tested genes, no difference was found between the two Bti strains, confirming their high clonality as mentioned above. In most cases, the two pathogenic strains Bce 391-98 and Ban Ames appeared to be relatively isolated but slightly closer to the psychrotolerant strains than to others. The genes dinB (not shown), panC and plcR of strain Bce 391-98 appeared to be very close to those of strain Bwe 10204 (less than 2 bp differences in 500 bp sequenced: Fig. 3B, C
), suggesting that those strains belong to the same group. However, the difference was greater for the gdpD gene (Fig. 3A
) and strain Bce 391-98 lacked the ability to grow at 8 °C. In comparison, the Ban Ames strain appeared to be much more isolated. On the whole, the trees based on parallel sequencing and on the riboprofiles exhibited similar topologies.
|
Comparison of the rRNA operons in Bce 6A5
Bce 6A5 appeared to possess 13 rRNA operons. As expected, all are located close to the replication origin. Physical separation of these 13 rRNA operons, amplified using LR PCR, allowed us to sequence them separately by primer walking and to study their variability in the conserved 16S, 23S and 5S regions and in the less conserved regions flanking these genes.
Sequences of the 16S, 23S and 5S genes were different in few single base positions (Fig. 4
). We detected seven, seven and two alleles for the 16S, 23S and 5S rRNA genes, respectively. Seven copies of the 16S rRNA gene (A, E, G, H, I, J and M) exactly corresponded to the consensus sequence determined previously (Ticknor et al., 2001
). None of the other alleles reported in this paper for different strains were detected during the present study. The 16S gene alleles corresponding to the rRNA operons B, D, F, K and L were all unique and contained one nucleotide difference compared to the consensus. The 16S gene in the rrnC operon contained two differences.
|
The intergenic 16S23S area, differing considerably between strains, has often been used to classify strains (Bourque et al., 1995
; Daffonchio et al., 1998
, 2000
; Harrell et al., 1995
). Our consensus sequence for this region corresponds exactly to the sequence reported earlier for the strain Bce 6A5 (Bourque et al., 1995
; Harrell et al., 1995
) (not shown). The alleles presented by operons A, B, C and D are different. We detected an insertion of tRNA-Ile and tRNA-Ala genes in operons A and B. This feature explains the existence of homoduplex and heteroduplex polymorphisms in this region, which have been used for classifying the strains (Daffonchio et al., 2000
). Separate amplification of different operons by LR PCR, using the oligonucleotides reported here (Table 2
), and subsequent sequencing of the intergenic 16S23S and 23S5S areas, can be suggested as a more precise approach for characterizing and classifying strains.
The consensus sequences of 23S and 5S genes have not been reported yet. From our data they are the same as the alleles corresponding to operons rrnD, G, H, I and J. Concerning the 23S gene, it is remarkable that the operon rrnB contains multiple single-nucleotide differences clustered in two regions, 310335 and 24282485. This might indicate that this allele originated from two recombinational events. Alleles of operons rrnC, E and L have several differences clustered close to position 1560, suggesting their common recombinational origin. Presence of identical 5S alleles that differ from the consensus in these three operons is consistent with this hypothesis. However, the same 5S allele was also found in operons rrnK and M, having the 23S alleles closer to the consensus. It is therefore probable that independent recombination events took place in the 23S and 5S genes. Concerning the 5S genes, only two alleles were detected, differing at four nucleotide sites, indicating that they probably diverged due to a recombination event.
Two distinct types of rRNA operons in Bce 6A5 and Ban Ames
An important difference in the overall organization of rRNA operons in Bce 6A5 is the presence of multiple tRNA genes downstream of operons rrnC, E, K, L and M (Fig. 5
A). Operons K, L and M have respectively 15, 20 and 22 tRNA genes downstream, with a partially similar order of codon specificity. The closely related operons C and E both have nine tRNA genes downstream, although the codon specificities are different. All the five operons having multiple tRNA genes downstream also differ from the others by their 5S rRNA allele (Fig. 4
) and 23S5S region (Fig. 5B
). These observations suggest the existence of two distinct types of rRNA operons in Bce 6A5. A phylogenetic tree constructed using the sequences of the 23S5S region presented in Fig. 5(B)
confirms the existence of two types of rRNA operons (Fig. 6
). The 13 rRNA operons in Bce 6A5 could therefore be divided into two classes. The first (class I) includes operons rrnA, B, D, F, G, H, I and J, all devoid of multiple tRNA genes downstream, and the second (class II) includes operons rrnC, E, K, L and M, all having many (75 in total) tRNA genes downstream (Fig. 5A
), and distinct 5S gene (Fig. 4
) and 23S5S intergenic region (Figs 5B and 6![]()
). It is worth noting that the 23S5S intergenic region of all class II operons contains sequences (TTGACT as -35 box and TA(C,A or T)AAT as -10 box) which are very similar to the Gram-positive and Gram-negative bacteria
A promoter consensus sequence (TTGACA as -35 box and TATAAT as -10 box). Moreover, class II rRNA operons do not have any obvious transcription terminator structure downstream of the 5S gene (Fig. 5B
). Thus, the 5S rRNA gene and the downstream tRNA genes might be transcribed independently from the 16S and 23S genes. In contrast, all class I operons, except rrnF, contain a clearly identifiable stemloop sequence downstream of the 5S gene, which should act as a transcription terminator (Fig. 5B
). The operon rrnF appears to be intermediate between the two classes. This operon has two tRNA genes downstream of the 5S rRNA gene and 12 tRNA genes upstream of the 16S gene. Its 5S allele is identical to those of class I rRNA operons and no promoter or terminator close to the 5S rRNA gene was detected for this operon. We assigned rrnF to class I, although it may have a particular significance compared to the two classes.
|
|
Evidence for the diversity of rRNA sequences in a single organism has been recently accumulating. Some authors have already evoked the existence of distinct types of rRNA operons based on the heterogeneity of the small-subunit rRNA genes in different domains of life, indicating the wide occurrence of this phenomenon (Carranza et al., 1996
; Liefting et al., 1996
; Maden et al., 1987
; Mylvaganam & Dennis, 1992
; Reischl et al., 1998
; Yap et al., 1999
). Concerning the B. cereus group, a potential psychrotolerant signature has already been found in the 16S sequence (Pruss et al., 1999
). Recently the existence of different types of rRNA operons based on the whole organization and sequence of the operons was reported in Escherichia coli (Ohnishi et al., 2000
) and Clostridium perfringens (Shimizu et al., 2001
). However, none of these studies revealed divergence as significant as the presence of a potential alternative promoter within the 23S5S intergenic region. The putative promoter highlighted in this study within this region in Bce 6A5 as well as in Ban Ames may enable the expression of tRNA genes independently of the global regulation of expression of the whole rRNA operon. The expression of tRNA genes could thus be regulated according to the amount of amino acids available for protein synthesis. Such a mechanism would be useful for B. cereus and B. anthracis for adaptation to the environment and the colonization of new environmental niches.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ankarloo, J., Caugant, D. A., Hansen, B. M., Berg, A., Kolsto, A. B. & Lovgren, A. (2000). Genome stability of Bacillus thuringiensis subsp. israelensis isolates. Curr Microbiol 40, 5156.[CrossRef][Medline]
Boschwitz, H., Gofshtein-Gandman, L., Halvorson, H. O., Keynan, A. & Milner, Y. (1991). The possible involvement of trypsin-like enzymes in germination of spores of Bacillus cereus T and Bacillus subtilis 168. J Gen Microbiol 137, 11451153.
Bourque, S. N., Valero, J. R., Lavoie, M. C. & Levesque, R. C. (1995). Comparative analysis of the 16S to 23S ribosomal intergenic spacer sequences of Bacillus thuringiensis strains and subspecies and of closely related species. Appl Environ Microbiol 61, 16231626.[Abstract]
Carlson, C. R., Caugant, D. A. & Kolsto, A. B. (1994). Genotypic diversity among Bacillus cereus and Bacillus thuringiensis strains. Appl Environ Microbiol 60, 17191725.
Carlson, C. R., Johansen, T. & Kolsto, A. B. (1996). The chromosome map of Bacillus thuringiensis subsp. canadensis HD224 is highly similar to that of the Bacillus cereus type strain ATCC 14579. FEMS Microbiol Lett 141, 163167.[CrossRef][Medline]
Carranza, S., Giribet, G., Ribera, C., Baguna & Riutort, M. (1996). Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida). Mol Biol Evol 13, 824832.[Abstract]
Clark, B. D. (1987). Thesis, Ohio State University.
Daffonchio, D., Borin, S., Frova, G., Manachini, P. L. & Sorlini, C. (1998). PCR fingerprinting of whole genomes: the spacers between the 16S and 23S rRNA genes and of intergenic tRNA gene regions reveal a different intraspecific genomic variability of Bacillus cereus and Bacillus licheniformis [corrected]. Int J Syst Bacteriol 48, 107116.
Daffonchio, D., Cherif, A. & Borin, S. (2000). Homoduplex and heteroduplex polymorphisms of the amplified ribosomal 16S-23S internal transcribed spacers describe genetic relationships in the "Bacillus cereus group". Appl Environ Microbiol 66, 54605468.
de Barjac, H. & Bonnefoi, A. (1972). Attempted biochemical classification of 64 Bacillus strains of groups 2 and 3 representing 11 different species. Ann Inst Pasteur 122, 463473.[Medline]
Dear, S. & Staden, R. (1991). A sequence assembly and editing program for efficient management of large projects. Nucleic Acids Res 19, 39073911.
Dulmage, H. T. (1970). Production of the spore-delta-endotoxin complex by variants of Bacillus thuringiensis in two fermentation media. J Invertebr Pathol 16, 385389.[CrossRef][Medline]
Frankland, G. C. & Frankland, P. F. (1887). Studies on some new micro-organisms from air. Philos Trans R Soc Lond B Biol Sci 173, 257287.
Granum, P. E. (1994). Bacillus cereus and its toxins. Soc Appl Bacteriol Symp Ser 23, 61S66S.[Medline]
Granum, P. E. & Lund, T. (1997). Bacillus cereus and its food poisoning toxins. FEMS Microbiol Lett 157, 223228.[CrossRef][Medline]
Harrell, L. J., Andersen, G. L. & Wilson, K. H. (1995). Genetic variability of Bacillus anthracis and related species. J Clin Microbiol 33, 18471850.[Abstract]
Helgason, E., Caugant, D. A., Lecadet, M. M., Chen, Y., Mahillon, J., Lovgren, A., Hegna, I., Kvaloy, K. & Kolsto, A. B. (1998). Genetic diversity of Bacillus cereus/B. thuringiensis isolates from natural sources. Curr Microbiol 37, 8087.[CrossRef][Medline]
Helgason, E., Caugant, D. A., Olsen, I. & Kolsto, A. B. (2000). Genetic structure of population of Bacillus cereus and B. thuringiensis isolates associated with periodontitis and other human infections. J Clin Microbiol 38, 16151622.
Hofte, H. & Whiteley, H. R. (1989). Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol Rev 53, 242255.
Ivanova, N., Sorokin, A., Anderson, I. & 20 other authors (2003). Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423, 8791.[CrossRef][Medline]
Jadamus, A., Vahjen, W. & Simon, O. (2001). Growth behaviour of a spore forming probiotic strain in the gastrointestinal tract of broiler chicken and piglets. Arch Tierernahr 54, 117.[Medline]
Jadamus, A., Vahjen, W., Schafer, K. & Simon, O. (2002). Influence of the probiotic strain Bacillus cereus var. toyoi on the development of enterobacterial growth and on selected parameters of bacterial metabolism in digesta samples of piglets. J Anim Physiol Anim Nutr 86, 4254.[Medline]
Johansen, T., Carlson, C. R. & Kolsto, A. B. (1996). Variable numbers of rRNA gene operons in Bacillus cereus strains. FEMS Microbiol Lett 136, 325328.[Medline]
Kotiranta, A., Haapasalo, M., Kari, K., Kerosuo, E., Olsen, I., Sorsa, T., Meurman, J. H. & Lounatmaa, K. (1998). Surface structure, hydrophobicity, phagocytosis, and adherence to matrix proteins of Bacillus cereus cells with and without the crystalline surface protein layer. Infect Immun 66, 48954902.
Kotiranta, A., Lounatmaa, K. & Haapasalo, M. (2000). Epidemiology and pathogenesis of Bacillus cereus infections. Microbes Infect 2, 189198.[CrossRef][Medline]
Lechner, S., Mayr, R., Francis, K. P., Pruss, B. M., Kaplan, T., Wiessner-Gunkel, E., Stewart, G. S. & Scherer, S. (1998). Bacillus weihenstephanensis sp. nov. is a new psychrotolerant species of the Bacillus cereus group. Int J Syst Bacteriol 48, 13731382.
Liefting, L. W., Andersen, M. T., Beever, R. E., Gardner, R. C. & Forster, R. L. (1996). Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma. Appl Environ Microbiol 62, 31333139.[Abstract]
Lund, T., De Buyser, M. L. & Granum, P. E. (2000). A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol 38, 254261.[CrossRef][Medline]
Maden, B. E., Dent, C. L., Farrell, T. E., Garde, J., McCallum, F. S. & Wakeman, J. A. (1987). Clones of human ribosomal DNA containing the complete 18S-rRNA and 28S-rRNA genes. Characterization, a detailed map of the human ribosomal transcription unit and diversity among clones. Biochem J 246, 519527.[Medline]
Margulis, L., Jorgensen, J. Z., Dolan, S., Kolchinsky, R., Rainey, F. A. & Lo, S. C. (1998). The Arthromitus stage of Bacillus cereus: intestinal symbionts of animals. Proc Natl Acad Sci U S A 95, 12361241.
Mietke, H., Beer, W., Voigt, W., Zucker, B. & Reissbrodt, R. (2000). Characterization and differentiation of probiotic Bacillus cereus isolates from feeds. In FT-IR Spectroscopy in Microbiological and Medical Diagnostic. Berlin: Robert Koch-Institute.
Mylvaganam, S. & Dennis, P. P. (1992). Sequence heterogeneity between the two genes encoding 16S rRNA from the halophilic archaebacterium Haloarcula marismortui. Genetics 130, 399410.[Abstract]
Ohnishi, M., Murata, T., Nakayama, K. & 8 other authors (2000). Comparative analysis of the whole set of rRNA operons between an enterohemorrhagic Escherichia coli O157 : H7 Sakai strain and an Escherichia coli K-12 strain MG1655. Syst Appl Microbiol 23, 315324.[Medline]
Okstad, O. A., Gominet, M., Purnelle, B., Rose, M., Lereclus, D. & Kolsto, A. B. (1999). Sequence analysis of three Bacillus cereus loci carrying PIcR-regulated genes encoding degradative enzymes and enterotoxin. Microbiology 145, 31293138.
Patra, G., Fouet, A., Vaissaire, J., Guesdon, J. L. & Mock, M. (2002). Variation in rRNA operon number as revealed by ribotyping of Bacillus anthracis strains. Res Microbiol 153, 139148.[Medline]
Perriere, G. & Gouy, M. (1996). WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364369.[Medline]
Priest, F. G., Kaji, D. A., Rosato, Y. B. & Canhos, V. P. (1994). Characterization of Bacillus thuringiensis and related bacteria by ribosomal RNA gene restriction fragment length polymorphisms. Microbiology 140, 10151022.
Pruss, B. M., Francis, K. P., von Stetten, F. & Scherer, S. (1999). Correlation of 16S ribosomal DNA signature sequences with temperature-dependent growth rates of mesophilic and psychrotolerant strains of the Bacillus cereus group. J Bacteriol 181, 26242630.
Read, T. D., Peterson, S. N., Tourasse, N. & 49 other authors (2003). The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423, 8186.[CrossRef][Medline]
Reischl, U., Feldmann, K., Naumann, L., Gaugler, B. J., Ninet, B., Hirschel, B. & Emler, S. (1998). 16S rRNA sequence diversity in Mycobacterium celatum strains caused by presence of two different copies of 16S rRNA gene. J Clin Microbiol 36, 17611764.
Ronner, U., Husmark, U. & Henriksson, A. (1990). Adhesion of Bacillus spores in relation to hydrophobicity. J Appl Bacteriol 69, 550556.[Medline]
Salamitou, S., Ramisse, F., Brehelin, M., Bourguet, D., Gilois, N., Gominet, M., Hernandez, E. & Lereclus, D. (2000). The plcR regulon is involved in the opportunistic properties of Bacillus thuringiensis and Bacillus cereus in mice and insects. Microbiology 146, 28252832.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D. R. & Dean, D. H. (1998). Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62, 775806.
Selander, R. K., Caugant, D. A., Ochman, H., Musser, J. M., Gilmour, M. N. & Whittam, T. S. (1986). Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics. Appl Environ Microbiol 51, 873884.
Shimizu, T., Ohshima, S., Ohtani, K., Hoshino, K., Honjo, K. & Hayashi, H. (2001). Sequence heterogeneity of the ten rRNA operons in Clostridium perfringens. Syst Appl Microbiol 24, 149156.[CrossRef][Medline]
Stabb, E. V., Jacobson, L. M. & Handelsman, J. (1994). Zwittermicin A-producing strains of Bacillus cereus from diverse soils. Appl Environ Microbiol 60, 44044412.
Stenfors, L. P., Mayr, R., Scherer, S. & Granum, P. E. (2002). Pathogenic potential of fifty Bacillus weihenstephanensis strains. FEMS Microbiol Lett 215, 4751.[CrossRef][Medline]
Temeyer, K. B. (1984). Larvicidal activity of Bacillus thuringiensis subsp. israelensis in the dipteran Haematobia irritans. Appl Environ Microbiol 47, 952955.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 48764882.
Ticknor, L. O., Kolsto, A. B., Hill, K. K., Keim, P., Laker, M. T., Tonks, M. & Jackson, P. J. (2001). Fluorescent amplified fragment length polymorphism analysis of Norwegian Bacillus cereus and Bacillus thuringiensis soil isolates. Appl Environ Microbiol 67, 48634873.
Vilas-Boas, G., Sanchis, V., Lereclus, D., Lemos, M. V. & Bourguet, D. (2002). Genetic differentiation between sympatric populations of Bacillus cereus and Bacillus thuringiensis. Appl Environ Microbiol 68, 14141424.
Yap, W. H., Zhang, Z. & Wang, Y. (1999). Distinct types of rRNA operons exist in the genome of the actinomycete Thermomonospora chromogena and evidence for horizontal transfer of an entire rRNA operon. J Bacteriol 181, 52015209.
Received 28 October 2003;
revised 28 November 2003;
accepted 2 December 2003.
This article has been cited by other articles:
![]() |
N. J. Tourasse and A.-B. Kolsto SuperCAT: a supertree database for combined and integrative multilocus sequence typing analysis of the Bacillus cereus group of bacteria (including B. cereus, B. anthracis and B. thuringiensis) Nucleic Acids Res., January 11, 2008; 36(suppl_1): D461 - D468. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |