Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gregor, D.
Right arrow Articles by Pfeifer, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gregor, D.
Right arrow Articles by Pfeifer, F.
Agricola
Right arrow Articles by Gregor, D.
Right arrow Articles by Pfeifer, F.
Microbiology 151 (2005), 25-33; DOI  10.1099/mic.0.27541-0
© 2005 Society for General Microbiology

In vivo analyses of constitutive and regulated promoters in halophilic archaea

Dagmar Gregor and Felicitas Pfeifer

Institut für Mikrobiologie und Genetik, Technische Universität Darmstadt, Schnittspahnstr. 10, D-64287 Darmstadt, Germany

Correspondence
Felicitas Pfeifer
pfeifer{at}bio.tu-darmstadt.de


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The two gvpA promoters PcA and PpA of Halobacterium salinarum, and the PmcA promoter of Haloferax mediterranei were investigated with respect to growth-phase-dependent expression and regulation in Haloferax volcanii transformants using the bgaH reading frame encoding BgaH, an enzyme with {beta}-galactosidase activity, as reporter. For comparison, the Pfdx promoter of the ferredoxin gene of Hbt. salinarum and the PbgaH promoter of Haloferax lucentense (formerly Haloferax alicantei) were analysed. Pfdx, driving the expression of a house-keeping gene, was highly active during the exponential growth phase, whereas PbgaH and the three gvpA promoters yielded the largest activities during the stationary growth phase. Compared to Pfdx, the basal promoter activities of PpA and PmcA were rather low, and larger activities were only detected in the presence of the endogenous transcriptional activator protein GvpE. The PcA promoter does not yield a detectable basal promoter activity and is only active in the presence of the homologous cGvpE. To investigate whether the PcA-TATA box and the BRE element were the reason for the lack of the basal PcA activity, these elements and also sequences further upstream were substituted with the respective sequences of the stronger PpA promoter and investigated in Hfx. volcanii transformants. All these promoter chimera did not yield a detectable basal promoter activity. However, whenever the PpA-BRE element was substituted for the PcA-BRE, an enhanced cGvpE-mediated activation was observed. The promoter chimeras harbouring PpA-BRE plus 5 (or more) bp further upstream also gained activation by the heterologous pGvpE and mcGvpE proteins. The sequence required for the GvpE-mediated activation was determined by a 4 bp scanning mutagenesis with the 45 bp region upstream of PmcA-BRE. None of these alterations influenced the basal promoter activity, but the sequence TGAAACGG-n4-TGAACCAA was important for the GvpE-mediated activation of PmcA.


Abbreviations: TBP, TATA box-binding protein


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The basal transcription machinery of archaea consists of a multi-subunit RNA polymerase, the TATA box-binding protein TBP and the transcription factor TFB (a homologue of the eukaryal TFIIB). This complex appears to be a minimal eukarya-type transcription system related to the eukaryal RNAPII system (Bell & Jackson, 1998Down). Most archaeal genes contain a TATA box centred 24–28 nt upstream of the transcription start site, representing a highly conserved 8 bp sequence element (TTTAWAtr, with W=A/T, R=A/G) which binds TBP. Many archaeal promoters also contain the TFB-responsive element BRE (cRNaANt) located upstream and adjacent to the TATA box that binds TFB. BRE consists of an 8 bp purine-rich region, and as determined for hyperthermophilic archaea, determines the promoter strength and the orientation of the transcription apparatus (Kosa et al., 1997Down; Littlefield et al., 1999Down; Qureshi & Jackson, 1998Down; Bell et al., 1999aDown, bDown). In silico analyses of Halobacterium salinarum genes also suggest the presence of a BRE element in halophilic archaea (Soppa, 1999Down). In contrast to the one to two TBP and TFB proteins in hyperthermophilic and many methanogenic archaea, the halophiles Hbt. salinarum and Haloferax volcanii possess multiple TBP and TFB proteins that may influence gene regulation (Baliga et al., 2000Down). In vitro transcription systems have been used to study the transcription initiation and also the action of various transcription regulators in methanogenic and hyperthermophilic archaea (for example Hochheimer et al., 1999Down; Bell et al., 1999aDown; Brinkman et al., 2000Down; Enoru-Eta et al., 2000Down; Leonard et al., 2001Down; Ouhammouch et al., 2003Down). For halophilic archaea, a functional in vitro transcription system is not yet available, and thus the majority of the studies on the transcription initiation and regulator proteins of Hfx. volcanii and Hbt. salinarum have been done in vivo (Danner & Soppa, 1996Down; Patenge et al., 2000Down; Pfeifer et al., 2001Down; Zimmermann & Pfeifer, 2003Down; Hofacker et al., 2004Down). We are using the various promoters of the gvp genes involved in gas vesicle formation of Hbt. salinarum and Haloferax mediterranei to study gene regulation in halophilic archaea.

The formation of gas vesicles requires the expression of the 14 genes gvpACNO and gvpDEFGHIJKLM, which are located in two opposite clusters in the vac region (Horne et al., 1991Down; Englert et al., 1992aDown). The TATA boxes of the promoters of gvpA (PA) and gvpD (PD) are separated by 50 bp in the plasmid-borne p-vac region of Hbt. salinarum PHH1 and the mc-vac region of Hfx. mediterranei. PA and PD are both activated by the endogenous activator protein GvpE (Röder & Pfeifer, 1996Down; Zimmermann & Pfeifer, 2003Down; Hofacker et al., 2004Down). Hfx. mediterranei harbours the single mc-vac region, whereas Hbt. salinarum PHH1 contains, in addition to p-vac, the related but distinct c-vac region. Both vac regions are similar but not identical to the gvp1 (p-vac) and gvp2 (c-vac) gene clusters of Halobacterium sp. NRC-1 (Ng et al., 2000Down). The expression of gvpACNO leads to the synthesis of the gas vesicle structural proteins GvpA and GvpC. The second operon encodes (among other proteins presumably involved in gas vesicle assembly, and minor gas vesicle structural proteins; Shukla & DasSarma, 2004Down) the two regulatory proteins GvpD and GvpE. Four promoters (PpA, PpD, PpF and PpO) drive the expression of p-vac, leading to the constitutive production of spindle-shaped gas vesicles in Hbt. salinarum PHH1 (Offner et al., 1996Down; Hofacker et al., 2004Down). A promoter scanning mutagenesis performed on a 50 bp region upstream of the transcriptional start site of PpA determined that the sequences of BRE and the TATA box, as well as a sequence around position –10, influence the basal transcription. Furthermore, an adaptation of the putative BRE sequence element to the archaeal consensus BRE element sequence results in a significantly enhanced basal PpA promoter activity. These analyses also imply that the sequence AACCA located upstream and adjacent to BRE is involved in the GvpE-mediated activation, suggesting a close contact of GvpE with the core transcription machinery (Hofacker et al., 2004Down).

The second vac region of Hbt. salinarum PHH1, c-vac, is only partly expressed in this wild-type strain (due to the minor activity of PcD), but the c-gvpACNO genes are not expressed at all (Pfeifer et al., 1997Down). Gas vesicles due to c-vac are only formed in the p-vac deletion mutant Hbt. salinarum PHH4 (Krüger & Pfeifer, 1996Down). Using the gvp negative Hfx. volcanii as recipient strain, earlier investigations showed that a basal promoter activity of PcA is not detectable and that this promoter is only active in the presence of cGvpE in c-gvpA/cEex transformants that contain the c-gvpE reading frame expressed under the control of Pfdx in pJAS35 in addition to c-gvpA (Krüger et al., 1998Down). Similar results on the PcA activity have been obtained using the bgaH reading frame encoding an enzyme with {beta}-galactosidase activity as reporter (Holmes & Dyall-Smith, 2000Down; Gregor & Pfeifer, 2001Down). Again, in contrast to PcA, the PpA and PmcA promoters yield basal promoter activities that are significantly enhanced in the presence of the respective homologous GvpE proteins. In contrast to PcA, these two PA promoters are also activated by heterologous GvpE proteins. GvpE resembles eukaryotic basic leucine-zipper (bZIP) proteins and is able to dimerize in solution (Krüger et al., 1998Down; Plößer & Pfeifer, 2002Down). More recent analyses on mcGvpE and the second regulatory protein, mcGvpD, involved in the repression of gas vesicle formation of Hfx. mediterranei, show that GvpE and GvpD are able to interact (Zimmermann & Pfeifer, 2003Down).

In the present study, using the bgaH reporter system, we compared the activities of the three gvpA promoters to that of the strong and constitutive Pfdx promoter of the fdx gene encoding the (2Fe–2S) ferredoxin of Hbt. salinarum (Pfeifer et al., 1993Down) in Hfx. volcanii transformants. In addition, the activity of the PbgaH promoter was determined. The PbgaH-bgaH and Pfdx-bgaH transformants yielded large amounts of BgaH activities, whereas the basal PpA and PmcA promoter activities were rather low. Again, a basal PcA activity was not detectable in PcA-bgaH transformants. To investigate whether the PcA-TATA box and BRE were the reason for the latter observation, promoter chimeras were constructed between PcA and PpA and analysed for reporter gene expression. None of these PcA-pA promoter variants yielded a detectable basal promoter activity, but the activity was enhanced in the presence of GvpE when the BRE element and/or the TATA box were exchanged. In addition, all three GvpE proteins were able to activate the PcA-pA promoter variants that contained the PpA-BRE element (plus at least 5 nt further upstream), whereas the original PcA promoter and the derivatives still containing PcA-BRE were only activated by cGvpE. To determine the sequences important for the GvpE-mediated activation, a 4 bp scanning mutagenesis was done with the PmcDPmcA region separating the BRE elements of the two mc-vac promoters. The results obtained suggested that two conserved regions adjacent to BRE were involved in the GvpE-mediated activation of PmcA.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Constructs used for transformation of Hfx. volcanii and reporter gene analysis.
The Hfx. volcanii growth medium and growth conditions have been described previously (Pfeifer et al., 2001Down). The p-vac construct containing the entire p-vac region, the cEex pEex and mcEex constructs in pJAS35, and PpA-cA-bgaH, PpA-bgaH, PcA-bgaH and PmcA-bgaH in pWL102 have been described previously (Offner & Pfeifer, 1995Down; Gregor & Pfeifer, 2001Down). The 2203 bp bgaH reading frame was amplified as an NcoI–BamHI fragment using the primer pair bgaH-NcoI and bgaH-BamHI (Gregor & Pfeifer, 2001Down) and plasmid pMLH32 as template. The NcoI site overlaps the AUG start codon of bgaH. For the construction of Pfdx-bgaH, the bgaH reading frame was isolated as an NcoI–Acc65I fragment from PA-bgaH by partial digestion and fused to Pfdx in pJAS35.

The BRE and TATA substitutions in PcA were introduced by recombinant PCR using complementary primers including the mutations, and the c-gvpA gene in pBSK+ as template. Two PCR reactions were performed to amplify two subfragments harbouring the inserted mutations in the overlapping end. The cA-pA-TATA, cA-pA-BRE and cA-pA-BRETATA fragments were amplified using the mutation primer BT-null (CGGACACTCCCTGTAGTT) plus cA-NcoI (Gregor & Pfeifer, 2001Down) for the first PCR, and the primers TATA (AGGGAGTGTCCGCATAAGCGCCGTTGTGA), BRE (AGGGAGTGTCCGGAAAACGATGTGTGTGAGTTCAA), or BRETATA (AGGGAGTGTCCGCATAAGGATGTGTGTGAGTTCAA) plus cA-XbaI for the second PCR. The full-size fragments were finally amplified using the cA-XbaI and cA-NcoI primers (Gregor & Pfeifer, 2001Down).

The PpA-cA promoter variants were constructed in the following way. The production of the promoter fragment +5u involved primer pair cA-NcoI plus pA-cA1 (ACTGGTGAAACCATACACATCGTT), and the pA-cA promoter (Gregor & Pfeifer, 2001Down) as template. The second PCR was done with the mutation primer pA-cA2 (ATGGTTTCACCAGTCGTTACGGCGCTCGTAA) and cA-XbaI. A third PCR with both amplicons as template and primers cA-XbaI and cA-NcoI yielded +5u. Similarly, the +10u promoter was constructed using mutation primer pA-cA-3 (ATGGTTTCACCAGTCGTTATGTCTCTCGTAATAGTT). The promoter chimera –5u was amplified using c-gvpA as template and mutation primer pA-cA-4 (GTTTTCCGGACACTCCCTGTAGTT) plus cA-NcoI. In the second PCR, primer pair pA-cA-5 (TGTCCGGAAAACGATGTGTATGGTTTCAACCCCCTTT) plus cA-XbaI were used, and the final promoter fragment was amplified using the products of both PCRs as template and primers cA-XbaI and cA-NcoI. The promoter –10u was produced in a similar way, but involved the mutation primer pA-cA-6 (TGTCCGGAAAACGATGTGTATGGGTTCAACCCCCGTTT). For the construction of –5d, the mutation primer pA-cA-7 (CGTTTCGGCGCTCGTAATAGTTCGCT) was used together with cA-XbaI and c-gvpA as template; the second PCR involved primer pA-cA-8 (AGCGCCGAAACGACTGGTGAAACCACAACGGCGGTTTTCCGGACACT) together with cA-NcoI. The construction of –10d was similar, but involved the mutation primers pA-cA-8 (AGCGCCGAAACGACTGGTGAAACCACAACGGCGGTTTTCCGGACACT) and pA-cA-9 (AGCGCCGAAACGACTGGTGAAACCATACCGGCGGTTTTCCGGACACT).

The mcA promoter mutant mcA-Del was amplified using primer pair mcA-NcoI and mcA-Del-Pal (CCAAACTATCTAGATGTTTGACTCATTACGAGAGGTGAAACGGTTGCACCAACACGAATG). The promoter mutants mcA-M1 through mcA-M6 involved the substitution of 4 bp upstream of the TATA box. The first PCR product was obtained using primer mcA-M0 (Table 1Down) together with mcA-NcoI, and mc-gvpA as template. The second PCR involved primer mcA-M1 (or mcA-M2 through M6; Table 1Down) together with mcA-XbaI. The mutants mcA-M7 through mcA-M11 were amplified using the respective oligonucleotides mcA-M7 through mcA-M11 together with mcA-NcoI and mc-gvpA as template. Each of these amplified fragments was purified by gel electrophoresis, and the PAmut promoter fragments were obtained by XbaI/NcoI digestion and used to substitute the wild-type PA promoter in the respective PA-bgaH fragment in vector pBSK+. In each case, the correct mutation and fusion of the mutant promoter to bgaH was determined by DNA sequence analysis. Each of these mutant PmcA-bgaH fragments was isolated as an XbaI–BamHI fragment and inserted in pWL102 for transformation of Hfx. volcanii.


View this table:
[in this window]
[in a new window]
 
Table 1. Oligonucleotides used to construct the 4 bp scanning mutants

Mutations are underlined; restriction sites introduced are given in italics.

 
Transformation of Hfx. volcanii and BgaH assay.
Prior to the transformation of Hfx. volcanii, each construct was passaged through the E. coli dam strain GM 1674 to avoid a halobacterial restriction barrier. Transformation was done as described by Pfeifer & Ghahraman (1993)Down. Transformants were selected on agar plates containing 6 µg lovastatin ml–1 (for the selection of pWL102) and 0·2 µg novobiocin ml–1 (for the selection of Eex in pJAS35). Lovastatin was a generous gift of MSD Sharp & Dohme GmbH. The presence of and the amount of the desired constructs in each transformant were comparable in each case, as determined by plasmid isolation and gel electrophoresis. The BgaH activity in cell lysates of the various Hfx. volcanii PA-bgaH transformants was measured by ONPG assay as described by Holmes et al. (1997)Down. Cells of 0·1–4 ml culture were resuspended in 100 µl medium, lysed with 50 µl 2 % Triton X-100 and mixed with 800 µl ONPG test buffer (2·6 M NaCl, 10 µM MnCl2, 0·1 % {beta}-mercaptoethanol, 50 mM Tris/HCl, pH 7·2). Then 50 µl ONPG (8 mg ONPG ml–1 in 0·1 M Tris/HCl, pH 7·2) was added, mixed and incubated for 5 min at room temperature. The BgaH activity was measured at 400 nm at room temperature. The activity was calculated as {Delta}A/{Delta}t={varepsilon}xdx{Delta}c/{Delta}t ({varepsilon} for ONP is 3·3x103 M–1 cm–1 and d=1 cm). One unit of BgaH activity is the amount of enzyme that catalyses the hydrolysis of 1 µmol ONPG per minute. The protein concentration was determined by the Bradford assay (Ausubel et al., 1988Down) using BSA as standard.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Activity of the three PA promoters in comparison to the promoters PbgaH and Pfdx
The three gvpA promoters (PA), the native promoter of the bgaH gene in pMLH32 (PbgaH), and also the Pfdx promoter of the ferredoxin gene of Hbt. salinarum were investigated in Hfx. volcanii transformants using the bgaH reading frame encoding an enzyme with {beta}-galactosidase activity (BgaH) as reporter. In each case, the promoter sequences were fused to bgaH at the fifth codon within the respective reading frame. The promoter sequences located upstream of the transcription start site are shown in Fig. 1(a)Down. Hfx. volcanii transformants harbouring the Pfdx-bgaH construct yielded large amounts of BgaH activities, especially in samples derived from the exponential but also from the stationary growth phase (Fig. 1bDown). These large amounts reflected the high activity of Pfdx, which is typical for this house-keeping gene (Pfeifer et al., 1993Down). A slight reduction of the BgaH activity was always observed during the stationary growth phase (Fig. 1bDown). The transformants harbouring pMLH32 carrying the native bgaH gene yielded significantly reduced BgaH activity in the sample derived from exponential growth, but increased activities were seen in the stationary growth phase (Fig. 1bDown). The two gvpA promoters PmcA and PpA have low basal promoter activities: 1–4 mU (mg protein)–1, which represents 1 % of the basal PbgaH and Pfdx activities (data not shown; Gregor & Pfeifer, 2001Down), but their activities were strongly enhanced in the presence of cGvpE (Fig. 1bDown). The GvpE-mediated activation of PmcA reached similarly large amounts of BgaH activities as that of the pMLH32 transformant, whereas the PpA-bgaH/cEex transformant with 200 mU (mg protein)–1 reached only 20 % of the respective activities determined for the Pfdx-bgaH transformant during the stationary growth phase (Fig. 1bDown). The BgaH activity of the GvpE-induced PcA promoter was, with 10 mU (mg protein)–1, very low (Fig. 1bDown). In all cases, the strongest BgaH activities were seen during the stationary growth phase, which was unexpected, since the transcriptional activator GvpE was produced under Pfdx control in these transformants and should have been present in large amounts during the exponential growth phase. These observations implied an additional factor that was responsible for the increased promoter activity of PmcA and PcA in the stationary growth phase.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 1. Promoter sequences and BgaH activities determined for the transformants. (a) Sequences of the five promoters investigated. The TATA box and the transcriptional start site are marked in bold and the BRE element in italics. The consensus sequences of both elements are given on top (N=any base; R=A, G; W=A, T). (b) BgaH activities of transformants containing the Pfdx-bgaH construct (fdx), the bgaH gene on pMLH32 (bgaH), PmcA-bgaH/cEex (mcA/cE), PpA-bgaH/cEex (pA/cE), and PcA-bgaH/cEex (cA/cE). The samples were taken at four time points during growth: 1, OD600 0·1–0·5 (exponential); 2, OD600 0·6–1·0 (early stationary); 3, OD600 1·2–1·7 (stationary); 4, OD600 1·8–2·2 (late stationary). The BgaH activities were determined by ONPG assay.

 
Substitution of PcA promoter elements by PpA sequences
A basal PcA promoter activity is not detectable, and the BgaH activity is only observed in the presence of cGvpE (Gregor & Pfeifer, 2001Down, and this report). To investigate whether the PcA-TATA box and/or the sequence of the putative PcA-BRE element were the reason for the undetectable basal promoter activity, these elements were exchanged with the respective sequences of the stronger PpA promoter (Fig. 2Down). The transformants harbouring these PcA-pA-bgaH constructs indicated that the substitution of the PcA-BRE and/or PcA-TATA box with the respective sequences of PpA was not sufficient to yield a detectable basal expression of these PcA-pA derivatives. With respect to the GvpE-mediated activation, six- to eightfold enhanced BgaH activities were observed, implying that the TATA box and the BRE element (and/or the factors bound here) support the GvpE-mediated activation (Fig. 2Down). However, these BgaH activities did not reach the strong activities of the PpA-bgaH/cEex transformant, demonstrating that additional sequences of PpA are responsible for the high level of basal and GvpE-induced promoter activities of PpA.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Substitution of PcA-BRE and TATA box by the respective PpA sequences, and BgaH activities. The TATA box (bold) and the putative BRE element (italic) are shaded in grey, and the consensus sequences of both elements are given on top (N=any base; R=A, G; W=A, T). The sequences derived from PpA are underlined. Dots in the mutant sequences indicate nucleotides that are identical to the PcA sequence. Numbers on the right are specific activities of BgaH in mU (mg protein)–1 determined for each transformant in the stationary growth phase (OD600 1·8–2·2); cEex=cGvpE; ND=no detectable activities (<0·5 mU mg–1).

 
To determine the sequences required for the GvpE-mediated activation, additional substitutions were done with the sequence upstream of the PcA-TATA box. The original PpA-cA promoter chimera published by Gregor & Pfeifer (2001)Down contains a substitution of 21 bp upstream of the TATA box of PcA with the respective sequence of PpA (including BRE), and still yields an undetectable basal promoter activity (Fig. 3Down). In the presence of cGvpE, this promoter shows an enhanced activity compared to PcA. As shown earlier, this PpA-cA promoter is activated by the heterologous pGvpE and mcGvpE proteins to a minor extent, whereas the original PcA promoter is exclusively activated by cGvpE (Gregor & Pfeifer, 2001Down; Fig. 3Down). From these results we concluded that this 21 bp sequence (or a portion of it) is involved in the GvpE-mediated activation. In the present study we altered the size of the 21 bp PpA region in PpA-cA by exchanging portions of this sequence (or additional sequences) between PpA and PcA in steps of 5 bp (Fig. 3Down). Again, none of the resulting promoter derivatives (+10u, +5u, –5u, –10u, –5d and –10d) yielded a basal promoter activity in the respective transformants. With respect to the GvpE-mediated activation, the four transformants +10u, +5u, –5u and –10u yielded similarly large amounts of BgaH activities to those of the original PpA-cA-bgaH/cEex transformant. These four variants were also activated by the heterologous pGvpE and mcGvpE proteins to a similar degree to that found for the PpA-cA-bgaH/cEex transformant (Fig. 3Down). In contrast, the two transformants –5d/cEex and –10d/cEex (which still contained the PcA-BRE element sequence) were exclusively activated by cGvpE, similar to the original PcA-bgaH/cEex transformant (Fig. 3Down). These results led to the conclusion that the PpA-BRE element (+5 bp upstream) was the reason for the enhanced activation by cGvpE detected for the former four mutants, and also for the stimulation by the heterologous GvpE proteins. Again, the BRE element affected the GvpE-mediated activation.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Promoter chimera between PcA and PpA sequences upstream of the TATA box, and BgaH activities. The sequences derived from the PpA promoter region are underlined. Dots in the mutant sequences indicate nucleotides that are identical to PcA. Numbers on the right are BgaH activities determined in stationary growth in mU (mg protein)–1. ND, No detectable activities (<0·5 mU mg–1); +cEex, induced by cGvpE; +pEex, induced by pGvpE; +mcEex, induced by mcGvpE.

 
These analyses on PcA demonstrated that it is difficult to determine sequences involved in GvpE-mediated activation, since PcA has an undetectable basal promoter activity. Mutations could affect the strength of the basal PcA transcription (and thus also the GvpE-mediated activation). The stronger PpA promoter has already been investigated by a 4 bp scanning mutagenesis in a 50 bp region located upstream of the transcription start, and from this analysis the sequence AACCA located upstream of BRE appears to be involved in the GvpE-mediated activation (Hofacker et al., 2004Down).

Search for the sequence affecting the GvpE-mediated activation of PmcA
The PmcA promoter of Hfx. mediterranei offers the highest promoter activity of all PA promoters when induced with GvpE, and also yields a measurable basal promoter activity (Fig. 1Up; Gregor & Pfeifer, 2001Down). A 4 bp scanning mutagenesis was performed with the 49 bp region separating the TATA boxes of PmcA and PmcD, and the resulting mutant PmcA-bgaH transformants were investigated for BgaH activities (Fig. 4Down). None of these 4 bp alterations affected the basal activity of PmcA (Fig. 4bDown). The analysis of the GvpE-mediated activation yielded reduced activities (19–23 % of the wild-type activity) in mutants carrying the alterations adjacent to BRE (mcA-M1 through mcA-M3) and in the centre of this region (mcA-M5 through mcA-M7), where the most significant reductions (6–10 % of the wild-type activity) were observed (Fig. 4aDown; the PmcA sequences affected are indicated in bold in Fig. 4bDown). These analyses suggested that the sequence TGAACCAA close to BRE, and also the sequence TGAAACGG in the centre of the intergenic region, were important for the GvpE-mediated activation of PmcA. Mutant mcA-Del incurred a 3 bp deletion 6 bp upstream of BRE (Fig. 4bDown). This deletion did not affect the basal promoter activity of PmcA, but completely abolished the GvpE-mediated activation (Fig. 4bDown). In summary, these results demonstrated that the sequence upstream of BRE had no influence on the basal promoter activity, but the GvpE-mediated activation was negatively affected when the sequence TGAACCAA-n4-TGAAACGG was altered.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4. Scanning mutagenesis of the PmcA promoter region. (a) BgaH activities determined for the PmcA mutant series in Pmut-bgaH/mcEex transformants, drawn relative to the 4 bp sequence alterations given below. (b) 4 bp scanning mutagenesis and a 3 bp deletion (marked by xxx); these mutants were induced by the homologous mcGvpE (mcEex). Dots indicate nucleotides identical to the PmcA sequence given at the top. The BRE elements of PmcA (right) and PmcD (left) and TATA box of PmcA are shaded in grey, and the palindrome originally thought to be the interaction site of GvpE is underlined. The nucleotides affecting the GvpE-mediated activation are indicated in bold. The basal and GvpE-induced BgaH activities are given in mU (mg protein)–1 (determined in stationary growth); ND, no detectable BgaH activities (<0·5 mU mg–1).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The bgaH reading frame was used as a reporter to analyse the activity of five haloarchaeal promoters, and also to define the sequences important for the GvpE-mediated activation of the three PA promoters of Hbt. salinarum and Hfx. mediterranei. Each promoter–bgaH fusion was inserted into a low-copy-number plasmid, and the BgaH activities (i.e. {beta}-galactosidase activities) were determined throughout the growth of the Hfx. volcanii transformants. The promoter Pfdx appeared to be the strongest one investigated, yielding large activities even during the exponential growth phase. The fdx gene is a typical house-keeping gene, and the expression pattern determined here reflects the predominant production of fdx mRNA during the exponential growth phase (Pfeifer et al., 1993Down). In contrast, the basal activities of PpA and PmcA were rather low, and reached only 10–3 of the Pfdx activity (Gregor & Pfeifer, 2001Down, and this report). Even in the presence of the activator protein GvpE, PpA and PmcA did not gain a similarly high level of activity as that of Pfdx. In the presence of GvpE, all PA promoters reached the greatest activity during the stationary growth phase of Hfx. volcanii. This was unexpected, since the GvpE protein was produced under Pfdx control in these PA-bgaH/cEex transformants, that is, predominantly during the exponential growth phase. These results led to the assumption that an additional factor appearing in stationary growth was responsible for the enhanced expression in this growth phase. Since multiple basal transcription factors (6 TBP and 7 TFB proteins) have been found in Halobacterium sp. NRC-1 (Baliga et al., 2000Down) and several of these are also present in Hfx. volcanii, it is possible that one (or some) of them preferably initiate(s) transcription in the stationary growth phase. To determine whether or not these five promoters investigated harbour differences in their BRE or the TATA box elements that might reflect their activities, these elements were compared to the respective conserved archaeal element sequences. The TATA box elements were well conserved in each case (4–6 out of 8 conserved nucleotides; see Fig. 1Up), but larger variations were observed with respect to BRE. Pfdx-BRE exhibits the highest similarity to the archaeal BRE consensus (4 bp of the 5 conserved bp; see Fig. 1Up), whereas the BRE elements of PmcA, PpA, PcA and also PbgaH contained only a few conserved base pairs. It is possible that these differences cause different binding affinities of the TFB protein or even recruit a different TFB protein. An in vitro transcription system for halophilic archaea would be very helpful to determine the contributions of these sequence elements and of the different TFB (and TBP) proteins to the activity of each promoter, but unfortunately such a system is not yet available.

We investigated whether or not the PcA-TATA box and PcA-BRE element were the reason for the undetectable basal activity of PcA by substituting these elements with the respective sequences of PpA which exhibit the strongest basal promoter activity of the three PA promoters. Even the substitution of both PcA promoter elements by the respective PpA promoter sequences resulted in a promoter with no detectable basal promoter activity, demonstrating that both PpA elements were not sufficient to drive the basal transcription of these PcA-pA promoters. Since the exchange of an additional 21 bp of PcA sequences further upstream with the respective PpA sequences did not result in a measurable basal transcription, the sequence located between the TATA box and the transcription start must be responsible for the observed lack of basal transcription in PcA. Earlier results have shown that alterations in the respective sequences of the PpA promoter strongly affect the basal transcription (Hofacker et al., 2004Down). From these results we assume that the higher GC content found in PcA compared to PmcA and PpA (13 of 22 bp versus 9 of 22 bp, see Fig. 1Up) interferes with the open complex formation of the RNA polymerase and might be the major reason for the undetectable basal transcription in PcA.

In the presence of GvpE the promoter derivatives +10u, +5u, –5u, –10u led to enhanced BgaH activities, similar to the PpA-cA-bgaH construct described earlier (Gregor & Pfeifer, 2001Down). These four promoter variants were also activated by the heterologous pGvpE and mcGvpE proteins (to a minor extent), whereas the original PcA-bgaH construct is only induced by the homologous cGvpE (Gregor & Pfeifer, 2001Down). In contrast, mutants –5d and –10d harbouring the original PcA-BRE were only induced by cGvpE. These results led to the conclusion that the PpA-BRE element was a major reason for the enhanced and extended promoter activities observed with the four PpA-cA mutants mentioned above. The PpA-BRE could cause a stronger binding of the original TFB protein (or even bind a different TFB protein), resulting in the enhanced GvpE-mediated activation.

The PmcA promoter of Hfx. mediterranei was selected to determine the sequences required for GvpE-mediated activation. PmcA yields a basal promoter activity and also has the strongest GvpE-induction of all PA promoters. A 4 bp scanning mutagenesis was done throughout the 34 bp region separating the two BRE elements of the oppositely oriented PmcA and PmcD promoters. The region between the TATA box and the transcription start site was not included, since alterations in the related region of the PpA promoter did not affect the GvpE-mediated activation (Hofacker et al., 2004Down). None of these mutations in PmcDPmcA affected the basal PmcA promoter activity. With respect to the GvpE-mediated activation, mutants carrying alterations of the sequences TGAACCAA adjacent to BRE and TGAAACGG located further upstream showed a reduced GvpE-induced promoter activity, demonstrating that both these sequences were important for the GvpE-mediated activation. These two sequences were similar. An alignment of the three PDPA regions of p-vac, c-vac and mc-vac indicated three different conserved regions of >4 bp, two of which are part of this sequence element (Fig. 5aDown, conserved nucleotides are marked in bold). An alignment of all 8 nt sequence elements led to the consensus sequence TGAAACNA (Fig. 5bDown). A similar sequence element can be determined with respect to PmcD (which is also activated by GvpE). This sequence includes the conserved sequence ATTAC close to the BRE element of PmcD and PpD (see Fig. 5aDown). These two promoters are activated by GvpE, whereas the PcD promoter of the c-vac region is not responsive to GvpE-mediated activation, presumably because the PpD-BRE element is located 10 bp further away (Krüger & Pfeifer, 1996Down). However, this needs further proof. A footprint analysis would be very helpful, but the GvpE binding sites determined by these in vivo analyses cover almost the entire PmcDPmcA region. The palindrome sequence GTTG-n6-ACCA, originally hypothesized as the GvpE-binding site by Krüger & Pfeifer (1996)Down, did not contribute to the GvpE-mediated activation. Although mutations in the ACCA portion of this sequence in the course of the 4 bp scanning mutagenesis in PmcA resulted in a reduced GvpE-mediated promoter activation, mutations in the GTTG portion of this palindrome had no influence on the promoter activation.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. Alignment of the intergenic region between PA and PD and of the sequences involved in GvpE-mediated activation. (a) The sequences derived from mc-vac (mc), p-vac (p) and c-vac (c). The TATA box and the BRE elements of the PA and PD promoters are shaded in grey. The sequences determined to be responsible for the GvpE-mediated activation of PmcA (this report) and PpA (Hofacker et al., 2004Down) are underlined. Nucleotides (>4) conserved in all three regions are marked in bold. (b) Alignment of the two regions determined in mc-vac with the respective sequences found in p-vac and c-vac (left), and deduced consensus sequence (right).

 
In summary, the results presented here imply that the sequence TGAAACGG-n4-TGAACCAA located close to PmcA-BRE is involved in the GvpE-mediated activation, suggesting a close interaction between GvpE and the basal transcription machinery. An interaction between an archaeal regulator protein and TBP has been described for Ptr2 of the hyperthermophilic Methanococcus jannaschii (Ouhammouch et al., 2003Down). Ptr2 is a homologue of the leucine-responsive regulatory protein (Lrp) family, and footprint analyses indicate that it binds to two sites consisting of a palindrome located upstream of the TATA box (Ouhammouch et al., 2003Down). As demonstrated by in vitro analysis, Ptr2 appears to recruit the TBP protein and enhances transcription. In the case of GvpE, an in vitro transcription system would be extremely helpful to study the contribution of the various promoter elements, in concert with distinct TFB and/or TBP proteins, to the GvpE-mediated activation of PA. However, the high salt requirement (up to 4 M KCl) of halophilic proteins, and presumably also the possession of multiple transcription factors, have so far complicated the establishment of such a system.


    ACKNOWLEDGEMENTS
 
We thank Peter Zimmermann and Annette Hofacker for discussions, and Peter Zimmermann and Kathryn Nixdorff for critical reading of the manuscript. Lovastatin was a generous gift of MSD Sharp & Dohme GmbH (Haar, Germany). This work was financially supported by the Deutsche Forschungsgemeinschaft (PF 165/8-2).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1988). Current Protocols in Molecular Biology, vol 1. New York: Greene Publishing Associates & Wiley-Interscience.

Baliga, N., Goo, Y. A., Ng, W. V., Hood, L., Daniels, C. & DaSarma, S. (2000). Is gene expression in Halobacterium NRC-1 regulated by multiple TBP and TFB transcription factors? Mol Microbiol 36, 1184–1185.[CrossRef][Medline]

Bell, S. D. & Jackson, S. (1998). Transcription and translation in archaea: a mosaic of eukaryal and bacterial features. Trends Microbiol 6, 222–228.[CrossRef][Medline]

Bell, S. D., Cairns, S. S., Robson, R. L. & Jackson, S. P. (1999a). Transcriptional regulation of an archaeal operon in vivo and in vitro. Mol Cell 4, 971–982.[CrossRef][Medline]

Bell, S. D., Kosa, P., Sigler, P. & Jackson, S. (1999b). Orientation of the transcription preinitiation complex in archaea. Proc Natl Acad Sci U S A 96, 13662–13667.[Abstract/Free Full Text]

Brinkman, A. B., Dahlke, I., Tuininga, J. & 7 other authors (2000). An Lrp-like transcriptional regulator from the archaeon Pyrococcus furiosus is negatively autoregulated. J Biol Chem 272, 38160–38169.

Danner, S. & Soppa, J. (1996). Characterization of the distal promoter element of halobacteria in vivo using saturation mutagenesis and selection. Mol Microbiol 19, 1265–1276.[CrossRef][Medline]

Englert, C., Krüger, K., Offner, S. & Pfeifer, F. (1992a). Three different but related gene clusters encoding gas vesicles in halophilic archaea. J Mol Biol 227, 586–592.[CrossRef][Medline]

Enoru-Eta, J., Gigot, D., Thia-Toong, T., Glansdorf, N. & Charlier, D. (2000). Purification and characterization of Sa-Lrp, a DNA-binding protein from the extreme thermoacidophilic archaeon Sulfolobus acidocaldarius homologous to the bacterial global transcription regulator Lrp. J Bacteriol 182, 3661–3672.[Abstract/Free Full Text]

Gregor, D. & Pfeifer, F. (2001). The use of a halobacterial bgaH reporter gene to analyse the regulation of gene expression in halophilic archaea. Microbiology 147, 1745–1754.[Abstract/Free Full Text]

Hochheimer, A., Hedderich, R. & Thauer, R. K. (1999). The DNA binding protein Tfx from Methanobacterium thermoautotrophicum: structure, DNA binding properties and transcriptional regulation. Mol Microbiol 31, 641–650.[CrossRef][Medline]

Hofacker, A., Schmitz, K. M., Cichonczyk, A., Sartorius-Neef, S. & Pfeifer, F. (2004). GvpE- and GvpD-mediated transcription regulation of the p-gvp genes encoding gas vesicles in Halobacterium salinarum. Microbiology 150, 1829–1838.[Abstract/Free Full Text]

Holmes, M. L. & Dyall-Smith, M. (2000). Sequence and expression of a halobacterial {beta}-galactosidase gene. Mol Microbiol 36, 114–122.[CrossRef][Medline]

Holmes, M. L., Scopes, R., Moritz, R., Simpson, R., Englert, C., Pfeifer, F. & Dyall-Smith, M. (1997). Purification and analysis of an extremely halophilic {beta}-galactosidase from Haloferax alicantei. Biochim Biophys Acta 1337, 276–286.[CrossRef][Medline]

Horne, M., Englert, C., Wimmer, C. & Pfeifer, F. (1991). A DNA region of 9 kbp contains all genes necessary for gas vesicle synthesis in halophilic archaebacteria. Mol Microbiol 5, 1159–1174.[CrossRef][Medline]

Kosa, P., Ghosh, G., DeDecker, B. & Sigler, P. (1997). The 2·1-Å crystal structure of an archaeal preinitiation complex: TATA box-binding protein/transcription factor (II)B core/TATA box. Proc Natl Acad Sci U S A 94, 6042–6047.[Abstract/Free Full Text]

Krüger, K. & Pfeifer, F. (1996). Transcript analysis of the c-vac region, and differential synthesis of the two regulatory gas-vesicle proteins GvpD and GvpE in Halobacterium salinarum PHH4. J Bacteriol 178, 4012–4019.[Abstract/Free Full Text]

Krüger, K., Hermann, T., Armbruster, V. & Pfeifer, F. (1998). The transcriptional activator GvpE for the halobacterial gas vesicle genes resembles a basic region leucine-zipper regulatory protein. J Mol Biol 279, 761–771.[CrossRef][Medline]

Leonard, P. M., Smiths, S. H., Sedelnikova, S. E., Brinkman, A. B., de Vos, W. M., van der Oost, J., Rice, D. W. & Rafferty, J. B. (2001). Crystal structure of the Lrp-like transcriptional regulator from the archaeon Pyrococcus furiosus. EMBO J 20, 990–997.[CrossRef][Medline]

Littlefield, O., Korkhin, Y. & Sigler, P. (1999). The structural basis for the oriented assembly of a TBP/TFB/promoter complex. Proc Natl Acad Sci U S A 96, 13668–13673.[Abstract/Free Full Text]

Ng, W. V., Kennedy, S. P., Mahairas, G. & 40 other authors (2000). Genome sequence of Halobacterium species NRC-1. Proc Natl Acad Sci U S A 97, 12176–12181.[Abstract/Free Full Text]

Offner, S. & Pfeifer, F. (1995). Complementation studies with the gas vesicle-encoding p-vac region of Halobacterium salinarum PHH1 reveal a regulatory role for the p-gvpDE genes. Mol Microbiol 16, 9–19.[Medline]

Offner, S., Wanner, G. & Pfeifer, F. (1996). Functional studies of the gvpACNO operon of Halobacterium salinarum reveal that the GvpC protein shapes gas vesicles. J Bacteriol 178, 2071–2078.[Abstract/Free Full Text]

Ouhammouch, M., Dewhurst, R., Hausner, W., Thomm, M. & Geiduschek, E. P. (2003). Activation of archaeal transcription by recruitment of the TATA-binding protein. Proc Natl Acad Sci U S A 100, 5097–5102.[Abstract/Free Full Text]

Patenge, N., Haase, A., Bolhuis, H. & Oesterhelt, D. (2000). The gene for a halophilic {beta}-galactosidase (bgaH) of Haloferax alicantei as a reporter gene for promoter analyses in Halobacterium salinarum. Mol Microbiol 36, 102–113.

Pfeifer, F. & Ghahraman, P. (1993). Plasmid pHH1 of Halobacterium salinarum: characterization of the replicon region, the gas vesicle gene cluster and insertion elements. Mol Gen Genet 238, 193–200.[Medline]

Pfeifer, F., Griffig, J. & Oesterhelt, D. (1993). The fdx gene encoding the 2Fe-2S ferredoxin of Halobacterium salinarum (H. halobium). Mol Gen Genet 239, 66–71.[Medline]

Pfeifer, F., Krüger, K., Röder, R., Mayr, M., Ziesche, S. & Offner, S. (1997). Gas vesicle formation in halophilic archaea. Arch Microbiol 167, 259–268.[CrossRef][Medline]

Pfeifer, F., Zotzel, J., Kurenbach, B., Röder, R. & Zimmermann, P. (2001). A p-loop motif and two basic regions in the regulatory protein GvpD are important for the repression of gas vesicle formation in the archaeon Haloferax mediterranei. Microbiology 147, 63–73.[Abstract/Free Full Text]

Plößer, P. & Pfeifer, F. (2002). A bZIP protein from halophilic archaea: structural features and dimer formation of cGvpE from Halobacterium salinarum. Mol Microbiol 45, 511–520.[CrossRef][Medline]

Qureshi, S. & Jackson, S. (1998). Sequence-specific DNA binding by the S. shibatae TFIIB homolog, TFB, and its effect on promoter strength. Mol Cell 1, 389–400.[CrossRef][Medline]

Röder, R. & Pfeifer, F. (1996). Influence of salt on the transcription of the gas vesicle genes of Haloferax mediterranei and identification of the endogenous transcriptional activator gene. Microbiol 142, 1715–1723.[Abstract]

Shukla, H. D. & DasSarma, S. (2004). Complexitiy of gas vesicle biogenesis in Halobacterium sp. strain NRC-1: identification of five new proteins. J Bacteriol 186, 3182–3186.[Abstract/Free Full Text]

Soppa, J. (1999). Normalized nucleotide frequencies allow the definition of archaeal promoter elements for different archaeal groups and reveal base-specific TFB contacts upstream of the TATA box. Mol Microbiol 31, 1589–1601.[CrossRef][Medline]

Zimmermann, P. & Pfeifer, F. (2003). Regulation of gas vesicle formation in Haloferax mediterranei: the two regulatory proteins GvpD and GvpE interact. Mol Microbiol 49, 783–794.[CrossRef][Medline]

Received 3 August 2004; revised 30 September 2004; accepted 8 October 2004.


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. Bauer, L. Marschaus, M. Reuff, V. Besche, S. Sartorius-Neef, and F. Pfeifer
Overlapping activator sequences determined for two oppositely oriented promoters in halophilic Archaea
Nucleic Acids Res., February 2, 2008; 36(2): 598 - 606.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Scheuch and F. Pfeifer
GvpD-induced breakdown of the transcriptional activator GvpE of halophilic archaea requires a functional p-loop and an arginine-rich region of GvpD
Microbiology, April 1, 2007; 153(4): 947 - 958.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
J. Soppa
From genomes to function: haloarchaea as model organisms.
Microbiology, March 1, 2006; 152(Pt 3): 585 - 590.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gregor, D.
Right arrow Articles by Pfeifer, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gregor, D.
Right arrow Articles by Pfeifer, F.
Agricola
Right arrow Articles by Gregor, D.
Right arrow Articles by Pfeifer, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2005 Society for General Microbiology.