|
|
||||||||
1 School of Molecular and Microbial Sciences, The University of Queensland, St Lucia, Qld 4072, Australia
2 Centre for Metals in Biology, The University of Queensland, St Lucia, Qld 4072, Australia
Correspondence
Alastair G. McEwan
mcewan{at}uq.edu.au
| ABSTRACT |
|---|
|
|
|---|
The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are AY452058, AY452059, AY452060 and AY452061.
| INTRODUCTION |
|---|
|
|
|---|
In addition to the acidophilic bioleaching bacteria, a number of thermophilic Crenarchaeota are also able to oxidize sulfur compounds and sulfidic metal ores and can achieve leaching rates superior to those of mesophilic micro-organisms, making them attractive for use in commercial tank leaching operations (Dew et al., 2000
). However, at present, our knowledge about the physiological features of these organisms which enable this enhanced performance is rather limited.
The oxidation of ferrous iron and inorganic sulfur molecules is an aerobic process that is linked to the respiratory chain. Over the last decade or more there has been considerable progress towards an understanding of the molecular properties of the oxidases and associated electron transfer proteins in Crenarchaeota, especially Sulfolobus acidocaldarius (Pereira et al., 2004
; Schafer et al., 1999
; Schmidt, 2004
). Biochemical and spectroscopic characterization of respiratory complexes has been complemented by molecular genetic studies, and the latter have been greatly facilitated by the availability of sequenced genomes for Sulfolobus solfataricus and Sulfolobus tokodaii (Kawarabayasi et al., 2001
; She et al., 2001
). The current view of aerobic respiratory electron transfer in S. acidocaldarius is that it involves at least two oxidases. The SoxABCD complex functions as a quinol oxidase and contains a haem aa3-CuB centre that is the site of oxygen reduction. The second complex in S. acidocaldarius is the SoxM supercomplex. It contains a subunit (SoxM) that has a haem bb3-CuB centre and a second subunit (SoxH) that is also found in enzymes of the superfamily of cytochrome oxidases (Komorowski et al., 2002
). The SoxH subunit contains a binding motif for a binuclear CuA centre that is absent in the analogous SoxA subunit of the quinol-oxidizing SoxABCD oxidase. SoxHM does not oxidize quinol directly. Instead, it is thought that quinol oxidation occurs via the SoxFG component, which is analogous to the cytochrome bc1 complex of a bacterial respiratory chain. It has been proposed that electron transfer from the SoxFG components to the SoxHM oxidase components is mediated by a small copper protein, sulfocyanin (SoxE), which appears to be anchored to the cell membrane via a single N-terminal transmembrane helix (Komorowski & Schafer, 2001
). A third type of terminal oxidase found in species of the Sulfolobales is another quinol oxidase (Dox-type) that has so far been found exclusively in Acidianus species (Giuffre et al., 1997
; Purschke et al., 1997
). Recently, a second analogue of bacterial cytochrome bc1 complexes (referred to as the Cbs/SoxL2N complex) has been identified in S. acidocaldarius (Hiller et al., 2003
). It is composed of a SoxC-like cytochrome b (SoxN), a Rieske protein (SoxL2) and a high-potential b-type cytochrome (CbsA). The Cbs/SoxL2N complex clearly represents a third quinol-oxidizing species, although it is not established how this complex interacts with the respiratory oxidases.
A major task in describing chemolithotrophy in Crenarchaeota is to understand how ferrous iron- and sulfur-oxidizing pathways are connected to the aerobic respiratory chain. Unfortunately, none of the species described above for which we have genomic information is able to grow efficiently on pyrite or sulfur. In order to address this deficiency we have investigated the expression of respiratory gene clusters in Metallosphaera sedula, a Crenarchaeon related to the aforementioned Sulfolobus species (Huber et al., 1989
). This thermophilic archaeon is able to grow chemoauto- and chemomixotrophically using pyrite or sulfur as energy source and can also grow heterotrophically using yeast extract. Thus, M. sedula represents an excellent model organism for basic research into bioleaching processes. In the present paper we report the identification of genetic loci encoding components of respiratory complexes from M. sedula as well as the expression of relevant genes under different growth conditions.
| METHODS |
|---|
|
|
|---|
(Invitrogen) was routinely cultivated on LB medium; when necessary the medium was supplemented with antibiotics (Sambrook et al., 1989
200 µm, BHP Billiton, Randburgh, South Africa) (PYR). The pH of the medium was adjusted to pH 2·0 for growth on pyrite and yeast extract and to pH 3·0 for growth on sulfur using dilute sulfuric acid. pH values were stable for 72 h in pyrite and yeast extract cultures, in sulfur-containing culture the pH dropped to 1·52 over 72 h. Cultures were inoculated with 5 % of a preculture grown on the same medium and incubated at 65 °C, 120 r.p.m. in a shaking waterbath (Julabo SW-22). Cells were cultivated in either 100 ml (250 ml flask) or 200 ml (500 ml flask) medium for the time period indicated. For strain maintenance, the cells were transferred every 7 days.
Growth curves.
Growth of M. sedula in 100 ml YE and S medium was monitored by following the increase in OD600 over a period of 80 h. In addition, growth of S and PYR cultures was monitored by whole-cell protein determination (duration of experiment 102 h, culture volume 100 ml). Relationships between protein concentration and OD600 were computed based on the S medium data. Aliquots (2 ml) of culture were harvested in a microcentrifuge and the cell pellets extracted with ice-cold acetone/methanol (7 : 2) solution at 20 °C overnight. Protein pellets were collected by spinning the extracted samples at 4 °C for 30 min and air-dried. The protein pellets were then resuspended in 100 µl distilled water and used for a microscale Lowry protein assay (range 025 µg protein ml1) at an appropriate dilution (Lowry et al., 1951
). In all cultures growth rate began to decline after
6065 h.
Cloning of M. sedula oxidase gene clusters.
Standard methods were used throughout (Ausubel et al., 1987
; Sambrook et al., 1989
). DNA from M. sedula was isolated using the DNAzol reagent (Invitrogen). Degenerate primers targeting soxC/soxN-like genes (SOSOXCF2, TggTggCCWAgRAAYTT; SOSOXCF1, TDTWCAgTCAYYTDTATgg; SOSOXC2R, gAAgAACCATggNggATA), the soxM (SOSOXMF1, CTggTTCTTYggHCAYCC; SOSOXMR, ACCATgTARTgKAARTgHCC) and soxG genes (SOSOXGF, AWTggTTAgADAgAKTAgg; SOSOXGR, ACYAADggATCMACRCC) were designed using sequences available in GenBank and taking the codon usage bias (determined using Web Angis, http://www.angis.org.au/) for M. sedula into account (45 mol% GC for M. sedula). PCR products for soxC/soxN and soxM were readily obtained using genomic DNA as the template, an annealing temperature of 48 °C and an extension time of 3 min 30 s. The products were cloned into pGemTeasy, resulting in constructs pMssoxC1 and pMssoxM1. The plasmid inserts were sequenced and used to generate DIG-dUTP (Roche)-labelled PCR products (probe sizes 600 and 500 bp, respectively) for use in Southern blot experiments. PCR-labelling was performed according to the manufacturer's instructions. Southern blot hybridizations were performed at 68 °C for 1618 h followed by chemiluminescence detection using CDP-Star (Roche). Two positive DNA fragments, a
5·5 kb HindIII fragment and a
4·5 kb EcoRV fragment hybridizing with the soxM and the soxC/soxN probe, respectively, were chosen for cloning. Partial genomic libraries of M. sedula genomic DNA fragments in the size range 4·56·5 kb (HindIII) and 3·55·5 kb (EcoRV) were constructed in pBluescript and
200 clones screened by Southern blotting of digested plasmids using the soxM and the soxC/soxN gene probes. A clone strongly hybridizing to the soxC/soxN probe and one clone that weakly hybridized to the soxM probe could be isolated. They were designated pMSE91 and pMSH182 and the inserts sequenced completely, showing that they contained a cbsBAsoxL2N and a partial soxL1soxABCD gene cluster, respectively. This result was unexpected, and it is assumed that the similarity of the soxB and soxM genes (48 % identity at the protein level) may have given rise to the positive hybridization result leading to identification of pMSH182. In fact, there is a potential soxM probe-binding site located in the soxB gene, as shown by sequence alignments (see Fig. 2
). Multiple binding sites exist for the soxC/soxN gene probe in the M. sedula soxN gene, one of which is located within the soxN fragment encoded by pMSE91. It is assumed that this fragment did not show up in the original Southern blot analyses because the probe interaction is not strong enough to give a detectable signal when only a few copies of the fragment are present, as would be the case when blotting genomic DNA digests. The soxN probe sequence itself is not contiguous with the partial soxN gene sequence obtained (see Fig. 5
). To obtain further sequence for the soxM gene cluster, a size-fractioned HindIII digest of M. sedula genomic DNA was ligated overnight and used in an inverse PCR reaction. Primers for this PCR were designed based on the sequence obtained from pMSsoxM. The inverse PCR product was partially sequenced.
|
|
Analytical methods.
Electronic absorption spectra were recorded at 25 °C on a split-beam UV-3000 spectrophotometer (Hitachi). Membrane fractions were analysed as prepared (oxidized) and after reduction by addition of solid dithionite.
RNA isolation.
M. sedula cultures (100 ml) were harvested 24, 48 and 72 h after inoculation. Cultures were chilled to 4 °C immediately and harvested by centrifugation (4 °C, 10 min, 4000 g). RNA was isolated from cell pellets using Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA pellets were stored at 80 °C until further use. RNA yields were assessed using a spectrophotometer, and the integrity of the samples was checked by gel electrophoresis using a 10 mM BES buffer system (50x buffer: 500 mM BES, 5 mM EDTA, pH 6·7) and DMSO/glyoxal as the denaturing agents. For Northern blot analysis, RNA was transferred from such gels to a positively charged nylon membrane (Hybond-N+, Amersham Biosciences) by capillary blotting (Sambrook et al., 1989
). The membranes were subjected to UV cross-linking and hybridized for 18 h at 50 °C in DIG Easyhyb solution (Roche) using DIG-dUTP (Roche) PCR-labelled dsDNA probes (see above), followed by chemiluminescent signal detection using CPD-Star (Roche).
RT-PCR and real-time RT-PCR.
RNA for use in RT-PCR experiments was DNase treated using Qiagen RNeasy columns and the RNase-free DNase set (Qiagen). To detect DNA contaminations, 50100 ng RNA were used as a template in a non-RT PCR reaction, and only samples that resulted in no amplification after 35 PCR cycles were considered DNA-free. RNase inhibitor (RNAsin, Promega) was included in all RT reactions. RT-PCR was conducted using a Qiagen One-Step RT-PCR kit; for real-time RT-PCR, 1 µg RNA was reverse transcribed using random hexamer primers (Invitrogen, 0·2 µg per reaction) and the Omniscript RT Kit (Qiagen). The single-stranded cDNA was diluted to appropriate concentrations before being used in real-time PCR experiments. Primers for use in such experiments were designed to produce amplicons of 201 bp using the Primer Express software (Applied Biosystems). The primers used were: MS16SF, TAGTCCCGGCTGTAGACGATG; MS16SR, CCCGCCAATTCCTTTAAGTTTC; MSSOXMQF, TCATTTTGCCGGCCATG; MSSOXMQR, CATCCAAACTCCCAGAACTGACA; MSSOXCQF, TCGGCGTTCTAATGCTCGTC; MSSOXQR, GAAGGACAGTTGCGGAATTGCG; MSQsoxL2F, GGAGGAAGTTGGGTTCACCTG; MSQsoxL2R, GGCTACTGGCTTCCCCAAGT; MSQcsbAF, CCTGCATCCTTTAGGGTGAAGC; MSQcbsR, TGGTATTACCCTGACAGGGCTG; MSQsoxBF, TCCTCGGAGGACCAGACATG; MSQsoxBR, GCTTAAGGCCAAGGCGAGATAG. Real-time PCR was performed on an Applied Biosystems 7700 sequence detection system using 25 µl total reaction volume, 5 µl cDNA, 12·5 µl SYBR Green PCR Master Mix (Applied Biosystems) and an appropriate amount of each primer (100400 nM) per reaction. Preliminary experiments showed that all primer pairs gave rise to unique amplification products. During real-time PCR experiments, the formation of PCR products and PCR artefacts (e.g. primer dimers) was routinely monitored by melting-curve analysis. At least three independent reactions were performed for each data point; values for 16S rRNA gene expression were collected for each RNA sample and used for normalization of the expression values. PCR efficiencies were determined for each reaction, as suggested by Liu & Saint (2002)
, and averaged for related samples present on the same 96-well plate. Normalized expression values were then determined from the ratios of target gene expression to reference gene expression using means of the CT values obtained for each experiment, similar to the method of Pfaffl (2001)
. These values were corrected for differences in the template concentration used. The relative standard deviation of the normalized expression values was assessed on the basis of the observed variation in CT values.
GenBank accession numbers and computer-based analyses.
DNA sequences have been deposited with GenBank under accession numbers AY452058, AY452059, AY452060 and AY452061. Analysis of the available Sulfolobus genomes was undertaken using the BLAST algorithm (Altschul et al., 1997
). Assembly of DNA sequences and determination of codon usages was carried out using the 2D-ANGIS and Web-ANGIS programs (ANGIS). Analysis of putative gene products was conducted using SignalP, DAS, TMPred and TMHMM (Cserzo et al., 1997
; Krogh et al., 2001
; Moller et al., 2001
; Nielsen et al., 1997a
, b
) programs accessible via the Expasy-molecular biology server.
| RESULTS |
|---|
|
|
|---|
-band region that was characterized by a peak at 591 nm with a shoulder at around 608 nm (Fig. 1a
|
60 % similarity at the protein level), and the cloned fragment of a soxC/soxN-like gene from M. sedula is probably part of a soxN-like gene.
Following identification of suitably sized restriction fragments (Fig. 2
), clones containing partial respiratory-complex gene clusters were obtained either by screening of partial genomic libraries or by inverse PCR. Three partial gene clusters, encoding parts of a soxABCD, a soxM and a cbssoxL2N cluster (Fig. 3
), could be identified.
|
Using inverse PCR, a partial soxM gene could be sequenced from a circularized HindIII DNA fragment. This partial gene encodes 643 amino acids (predicted full-length protein
815 aa) which share 66 % and 64 % identity with soxM proteins from S. solfataricus and S. tokodaii, respectively. It has been predicted to contain at least 13 membrane-spanning regions.
In addition to the two gene clusters that encode terminal oxidases or an oxidase/bc1 supercomplex, a homologue of the cbsABsoxL2N gene cluster from S. acidocaldarius was also isolated. In M. sedula, the order of the cbs genes has been reversed, and the cluster encodes cbsBAsoxL2N. The 3247 bp EcoRV fragment in pMSE91 contains partial sequences for cbsB and soxN and complete coding regions for cbsA and soxL2. Both complete coding regions were preceded by putative promoter elements: CTTAATA for soxL2 and TTTATTA for cbsA, located 35 and 34 bp upstream of the genes, respectively. Putative transcription termination signals were detected downstream of cbsA. Again, all of these genes are most closely related to the corresponding genes from S. solfataricus and S. tokodaii (7073 % identity for soxL2 and cbsA at the protein level). The cbsA gene encodes a polypeptide with 464 aa and two predicted transmembrane helices, located at the N- and the C-terminus. The N-terminal transmembrane helix is likely to be an export signal (predicted signal cleavage site: aa 3233) that is not present in the mature protein. Fourteen predicted N-glycosylation sites and a high content of serine and threonine (7·4 % and 11·3 % of all amino acids, respectively, in the processed CbsA protein) may indicate that the protein is a glycoprotein similar to cbsA from S. acidocaldarius (Hettmann et al., 1998
).
Like its SoxL1 homologue, the SoxL2 gene product contains a QcrA/Rieske Fe-S signature (COG0723) and one membrane-spanning region. While both SoxL1 and SoxL2 are closely related (6070 % identity over 236321 aa) in the Sulfolobus species, the SoxF Rieske Fe-S protein found in the SoxM supercomplex has only 46 % similarity (206 aa alignment) to these proteins, possibly indicating a different function of the protein. This is in agreement with biochemical data showing a differing redox behaviour for soxF (Schmidt, 2004
).
Expression of genes encoding respiratory complexes under different growth conditions
In order to investigate respiratory-complex gene expression under different growth conditions, M. sedula cells were grown on YE or sulfur or pyrite. Growth was followed by optical density for sulfur and YE cultures and by protein determination for sulfur and pyrite cultures. The final OD600 reached in YE-grown cells was
0·65 (corresponding to
180 µg ml1 protein) after 72 h; for sulfur- and pyrite-grown cells, protein concentrations of 66 µg ml1 and 35 µg ml1 were reached after 72 h incubation. The latter two values may be somewhat lower than the real protein content due to the presence of solids in the medium, to which the micro-organisms can adhere and from which the protein may not be quantitatively extracted. RNA was prepared from cultures after 24, 48 and 72 h incubation, representing different stages in the growth curve. Expression of the identified gene clusters was monitored via the soxB, soxM, cbsA, soxL2 and soxN genes. Expression of the 16S rRNA gene was determined for each sample and used for normalization of the data.
Expression of the soxABCD and the soxM gene clusters
It was found that expression of the soxABCD quinol oxidase gene cluster, as indicated by soxB transcript levels, was highest in M. sedula cells grown on sulfur (Fig. 4b
), while expression in cells grown on yeast extract (Fig. 4a
) or pyrite (Fig. 4c
) was lower by factors of 1012. While soxB expression increased over time in YE-grown cells, it appeared to be steady in pyrite- and sulfur-grown cells. In contrast, the soxM gene was most highly expressed in cells grown on YE (Fig. 4a
), while levels were reduced by a factor of 1·54 in sulfur-grown cells (Fig. 4b
) and a factor of 10 in pyrite-grown cells (Fig. 4c
). Under all three growth conditions monitored, the expression of the soxM gene increased over time. In sulfur-grown cells, levels of soxB transcript exceeded those of the soxM transcript by about 50 %. During growth with pyrite, expression of both the soxB and the soxM genes was very low (Fig. 4c
). The fact that soxM was most highly expressed during heterotrophic growth was confirmed by Northern blot analysis, in which a transcript of 2·9 kb (corresponding to the estimated size of the soxM gene) was detected using a soxM gene probe. The signals obtained for RNA from YE-grown cells were clearly the strongest observed (data not shown).
|
In contrast, expression of the cbsA gene exceeded the levels observed for the soxL2 and soxN genes under all three growth conditions, although cbsA expression appeared to follow a similar expression pattern. In pyrite-grown cell material, the levels of this transcript exceeded those of the soxL2N transcript by a factor of
25. For growth on sulfur, cbsA levels tripled with respect to those of soxL2N. It was also notable that the pattern of expression of cbsA and soxL2N during the growth cycle appeared to be different for heterotrophically and lithotrophically grown cells. In the case of the heterotrophically grown cells, there was an increase in transcript levels with time, and it was only in the 72 h cultures that high levels of expression were observed. This contrasted with the situation for sulfur- and pyrite-grown cells, where the transcription of the above genes was high from the beginning of growth. The observed contrast between transcript levels for soxN is supported by Northern blot experiments, in which RNA (isolated after 48 h of incubation) from sulfur-grown cells gave the strongest signal, and the signal for pyrite-grown cells was at the sensitivity threshold (Fig. 5c
).
Transcriptional organization of the cbsBAsoxL2N locus
In view of the overall similar expression patterns found for cbsA, soxL2 and soxN and the strikingly different levels of expression observed for these genes, one-step RT-PCR experiments were carried out to establish the transcriptional units present in this gene locus. While all primer combinations used readily gave rise to PCR products of the expected sizes when using genomic DNA as template (Fig. 5a, b
), only the soxL2soxN combination gave rise to an RT-PCR product when using 100 ng Dnase-treated RNA (isolated from cultures grown on either YE, sulfur or pyrite for 48 h) as the template. The combinations that included a cbsA gene primer and a reverse primer for the soxL2 gene did not give rise to an RT-PCR product, while RT-PCR using a primer pair targeting the cbsA gene alone established that all samples contained cbsA transcripts. Hence, cbsA seems to be located on a separate transcriptional unit, while soxL2 and soxN are co-transcribed. This result is supported by Northern blot experiments carried out using a soxN gene probe, in which two transcripts with sizes of
2·6 kb and
2·852·9 kb were detected (Fig. 5c
). This would correspond well to a transcript of soxL2N (
2·6 kb) and a putative transcript including an odsN-type gene (
2·6 kb±0·3 kb), which is found upstream of the soxN gene in S. acidocaldarius. It is also possible, however, that the weakly hybridizing 2·6 kb transcript arises from a different gene locus present on the M. sedula genome, which was also detected in Southern blot experiments using the soxN gene probe. A transcript of soxL2N including the cbsA gene would have an expected size of at least 4·1 kb.
| DISCUSSION |
|---|
|
|
|---|
In this paper we have shown that M. sedula possesses at least two terminal oxidases, the SoxM complex and the SoxABCD quinol oxidase, as well as a CbsBA-SoxL2N cytochrome bc1-complex analogue.
The main focus of our study was to determine whether there was differential expression of these respiratory complexes in M. sedula associated with different growth modes (Fig. 4
). Measurements of the levels of transcripts for genes encoding the two oxidase complexes indicate that the soxM gene is most highly expressed during heterotrophic growth of M. sedula, while the soxABCD gene cluster was most highly expressed during growth on sulfur. Both findings are consistent with the optical spectra of the corresponding membrane fractions, suggesting that the transcript level reflected the formation of respiratory complexes within the membrane. The fact that neither of the monitored oxidase gene clusters was expressed to high levels in cells growing on pyrite was very surprising, in particular since optical spectra of membranes from pyrite-grown cells clearly showed the presence of oxidase-related haems. One possible explanation is that the diversity of respiratory enzymes in M. sedula is greater than can be easily gauged in the absence of a genome sequence. The presence of multiple copies of soxC/soxN-related genes in M. sedula is suggested by Southern blot analysis (Fig. 2
). Multiple gene clusters encoding terminal oxidases are present in other Sulfolobales, for example the genome sequence of S. tokodaii contains at least another two loci that might encode novel oxidase complexes: genes ST2593ST2595 encode a CbsA-like, a SoxH-like and a SoxB/SoxM-like protein, while the ST2392ST2396 cluster encodes one Rieske-type Fe-S protein, two sulfocyanin-like proteins as well as a SoxA/H- and a SoxB/M-related polypeptide. In addition, at least one copy of doxAD-homologous genes, which encode two subunits of the Acidianus-type quinol oxidase (Purschke et al., 1997
), was present in both the S. solfataricus and the S. tokodaii genomes. Additional terminal oxidases have also been identified on a biochemical level in S. tokodaii (Iwasaki et al., 1995
).
The transcription of the cbsBAsoxL2N bc1-complex analogue in M. sedula was also investigated and differed from that found in S. acidocaldarius (Hiller et al., 2003
), where soxL2 and soxNodsN form separate transcriptional units and small amounts of a cbsABsoxL2 transcript were also detected. In M. sedula, the cbsA gene and the soxL2N genes are located on different transcriptional units, while soxL2 and soxN are co-transcribed (Fig. 5
). This observation agrees with the expression patterns and levels measured for these genes. Expression of soxL2N was high in sulfur-grown cells and increased over time in YE-grown cells, while M. sedula grown on pyrite contained only low levels of this transcript throughout.
In contrast, the independently transcribed cbsA gene was present at high levels in cells grown on both sulfur and pyrite throughout the experiments, while levels in YE-grown cells only reached high levels in the 72 h sample. The high levels of expression were particularly striking in pyrite-grown cells, as all other monitored genes were only expressed at very low level in these cells. The cbsA gene encodes an unusual glycosylated membrane-bound cytochrome b566/588 that has been purified from S. acidocaldarius. It has been proposed to function in electron transfer in the pseudoperiplasmic space of the organism (Hettmann et al., 1998
; Schoepp-Cothenet et al., 2001
), and the amount of CbsA present in the cells varied in response to oxygen tension and nitrogen sources present in the medium (Hettmann et al., 1998
; Schafer et al., 1994
). These observations may explain why the expression of cbsA was enhanced in M. sedula cells grown for 72 h on YE, since these cultures would be densest, and therefore the oxygen tension in the culture would be lower than for the previous data points. Since the S. acidocaldarius type strain used for the CbsA induction studies is not capable of chemolithotrophic growth, there are no comparable data relating to growth on sulfur- or pyrite-containing media. However, our results suggest that the cbsA gene product is important during chemolithotrophic growth of M. sedula, and it may in fact be related to a yellow-coloured, acid- and protease-resistant haemoprotein (cytochrome b572) isolated from membranes of M. sedula cultures grown on ferrous-iron-containing media (Blake et al., 1993
). The additional cytochrome peak at 573 nm observed in the spectra of pyrite-grown cells of M. sedula might be related to both this acid-resistant protein and to the high expression of the cbsA gene found under these conditions.
It is clear from our results that terminal oxidase complexes in the archaeon M. sedula are differentially expressed in relation to the prevailing growth mode, a property which, to our knowledge, has not been previously shown to exist in thermoacidophilic Crenarchaeota. The high expression levels of the cbsA gene during chemolithotrophic growth suggest a central role for the resulting protein in mediating electron transfer from as yet uncharacterized iron- and possibly sulfur-oxidizing enzymes on the outside of the cell to the respiratory oxidases during chemolithotrophic growth in M. sedula. At present, the respiratory pathway which involves CbsA is not defined, and the data presented here provide a good basis for further research into mechanisms of chemolithotrophy in M. sedula.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1987). Current Protocols in Molecular Biology. New York: Wiley.
Blake, R. C., Shute, E. A., Greenwood, M. M., Spencer, G. H. & Ingledew, W. J. (1993). Enzymes of aerobic respiration on iron. FEMS Microbiol Rev 11, 918.[CrossRef][Medline]
Brasseur, G., Bruscella, P., Bonnefoy, V. & Lemesle-Meunier, D. (2002). The bc(1) complex of the iron-grown acidophilic chemolithotrophic bacterium Acidithiobacillus ferrooxidans functions in the reverse but not in the forward direction. Is there a second bc(1) complex? Biochim Biophys Acta 1555, 3743.[Medline]
Cserzo, M., Wallin, E., Simon, I., von Heijne, G. & Elofsson, A. (1997). Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the Dense Alignment Surface method. Protein Eng 10, 673676.
Dew, D. W., van Buuren, C., McEwan, K. & Bowker, C. (2000). Bioleaching of base metal sulphide concentrates: a comparison of high and low temperature bioleaching. J S Afr Inst Min Metall 100, 409413.
Giuffre, A., Gomes, C. M., Antonini, G., Ditri, E., Teixeira, M. & Brunori, M. (1997). Functional properties of the quinol oxidase from Acidianus ambivalens and the possible catalytic role of its electron donor studies on the membrane-integrated and purified enzyme. Eur J Biochem 250, 383388.[Medline]
Hain, J., Reiter, W.-D., Hüdepohl, U. & Zillig, W. (1992). Elements of an archaeal promoter defined by mutational analysis. Nucleic Acids Res 20, 54235428.
Hettmann, T., Schmidt, C. L., Anemuller, S., Zahringer, U., Moll, H., Petersen, A. & Schafer, G. (1998). Cytochrome b(558/566) from the archaeon Sulfolobus acidocaldarius. J Biol Chem 273, 1203212040.
Hiller, A., Henninger, T., Schafer, G. & Schmidt, C. L. (2003). New genes encoding subunits of a cytochrome bc1-analogous complex in the respiratory chain of the hyperthermoacidophilic crenarchaeon Sulfolobus acidocaldarius. J Bioenerg Biomembr 35, 121131.[CrossRef][Medline]
Huber, G., Spinnler, C., Gambacorta, A. & Stetter, K. O. (1989). Metallosphaera sedula gen. and sp. nov. represents a new genus of aerobic, metal-mobilizing, thermoacidophilic archaebacteria. Syst Appl Microbiol 12, 3847.
Iwasaki, T., Wakagi, T., Isogai, Y., Iizuka, T. & Oshima, T. (1995). Resolution of the aerobic respiratory system of the thermoacidophilic archaeon, Sulfolobus sp, strain 7. 2. Characterization of the archaeal terminal oxidase subcomplexes and implication for the intramolecular electron transfer. J Biol Chem 270, 3089330901.
Kawarabayasi, Y., Hino, Y., Horikawa, H. & 27 other authors (2001). Complete genome sequence of an aerobic thermoacidophilic crenarchaeon, Sulfolobus tokodaii strain 7. DNA Res 8, 123140.[Abstract]
Komorowski, L. & Schafer, G. (2001). Sulfocyanin and subunit II, two copper proteins with novel features, provide new insight into the archaeal SoxM oxidase supercomplex. FEBS Lett 487, 351355.[CrossRef][Medline]
Komorowski, L., Verheyen, W. & Schafer, G. (2002). The archaeal respiratory supercomplex SoxM from S. acidocaldarius combines features of quinole and cytochrome c oxidases. Biol Chem 383, 17911799.[CrossRef][Medline]
Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305, 567580.[CrossRef][Medline]
Liu, W. & Saint, D. A. (2002). A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal Biochem 302, 5259.[CrossRef][Medline]
Lowry, O. H., Roseborough, N. J., Farr, A. L. & Randall, R. T. (1951). Protein measurement with Folin phenol reagent. J Biol Chem 193, 265275.
Lubben, M. (1995). Cytochromes of archaeal electron transfer chains. Biochim Biophys Acta 1229, 122.[Medline]
Lubben, M., Arnaud, S., Castresana, J., Warne, A., Albracht, S. P. J. & Saraste, M. (1994a). A second terminal oxidase in Sulfolobus acidocaldarius. Eur J Biochem 224, 151159.[Medline]
Lubben, M., Warne, A., Albracht, S. P. J. & Saraste, M. (1994b). The purified SoxABCD quinol oxidase complex of Sulfolobus acidocaldarius contains a novel heme. Mol Microbiol 13, 327335.[CrossRef][Medline]
Moller, S., Croning, M. D. R. & Apweiler, R. (2001). Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 17, 646653.
Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997a). A neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Int J Neural Sys 8, 581599.
Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997b). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10, 16.
Ohmura, N., Sasaki, K., Matsumoto, N. & Saiki, H. (2002). Anaerobic respiration using Fe3+, S-0, and H-2 in the chemolithoautotrophic bacterium Acidithiobacillus ferrooxidans. J Bacteriol 184, 20812087.
Pereira, M. M., Bandeiras, T. M., Fernandes, A. S., Lemos, R. S., Melo, A. M. P. & Teixeira, M. (2004). Respiratory chains from aerobic thermophilic prokaryotes. J Bioenerg Biomembr 36, 93105.[CrossRef][Medline]
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, 20022007.
Purschke, W. G., Schmidt, C. L., Petersen, A. & Schafer, G. (1997). The terminal quinol oxidase of the hyperthermophilic archaeon Acidianus ambivalens exhibits a novel subunit structure and gene organization. J Bacteriol 179, 13441353.
Rawlings, D. E. (2001). The molecular genetics of Thiobacillus ferrooxidans and other mesophilic, acidophilic, chemolithotrophic, iron- or sulfur-oxidizing bacteria. Hydrometallurgy 59, 187201.[CrossRef]
Reiter, W.-D., Palm, P. & Zillig, W. (1988). Transcription termination in the archaebacterium Sulfolobus: signal structure and linkage to transcription termination. Nucleic Acids Res 16, 24452459.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sand, W., Gehrke, T., Jozsa, P. G. & Schippers, A. (2001). (Bio)chemistry of bacterial leaching direct vs. indirect bioleaching. Hydrometallurgy 59, 159175.[CrossRef]
Schafer, G., Anemuller, S., Moll, R., Gleissner, M. & Schmidt, C. L. (1994). Has Sulfolobus an archaic respiratory system structure, function and genes of its components. Syst Appl Microbiol 16, 544555.
Schafer, G., Engelhard, M. & Muller, V. (1999). Bioenergetics of the archaea. Microbiol Mol Biol Rev 63, 570620.
Schafer, G., Moll, R. & Schmidt, C. L. (2001). Respiratory enzymes from Sulfolobus acidocaldarius. Methods Enzymol 331, 369410.[Medline]
Schmidt, C. L. (2004). Rieske iron-sulfur proteins from extremophilic organisms. J Bioenerg Biomembr 36, 107113.[CrossRef][Medline]
Schoepp-Cothenet, B., Schutz, M., Baymann, F., Brugna, M., Nitschke, W., Myllykallio, H. & Schmidt, C. (2001). The membrane-extrinsic domain of cytochrome b(558/566) from the Archaeon Sulfolobus acidocaldarius performs pivoting movements with respect to the membrane surface. FEBS Lett 487, 372376.[CrossRef][Medline]
She, Q., Singh, R. K., Confalonieri, F. & 29 other authors (2001). The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proc Natl Acad Sci U S A 98, 78357840.
Received 27 July 2004;
revised 17 September 2004;
accepted 5 October 2004.
This article has been cited by other articles:
![]() |
M. Kozubal, R. E. Macur, S. Korf, W. P. Taylor, G. G. Ackerman, A. Nagy, and W. P. Inskeep Isolation and Distribution of a Novel Iron-Oxidizing Crenarchaeon from Acidic Geothermal Springs in Yellowstone National Park Appl. Envir. Microbiol., February 15, 2008; 74(4): 942 - 949. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Auernik, Y. Maezato, P. H. Blum, and R. M. Kelly The Genome Sequence of the Metal-Mobilizing, Extremely Thermoacidophilic Archaeon Metallosphaera sedula Provides Insights into Bioleaching-Associated Metabolism Appl. Envir. Microbiol., February 1, 2008; 74(3): 682 - 692. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bathe and P. R. Norris Ferrous Iron- and Sulfur-Induced Genes in Sulfolobus metallicus Appl. Envir. Microbiol., April 15, 2007; 73(8): 2491 - 2497. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. J. Brouns, J. Walther, A. P. L. Snijders, H. J. G. van de Werken, H. L. D. M. Willemen, P. Worm, M. G. J. de Vos, A. Andersson, M. Lundgren, H. F. M. Mazon, et al. Identification of the Missing Links in Prokaryotic Pentose Oxidation Pathways: EVIDENCE FOR ENZYME RECRUITMENT J. Biol. Chem., September 15, 2006; 281(37): 27378 - 27388. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK |