|
|
||||||||

1 Laboratorio di Genetica Microbica, DiSA, Università Politecnica delle Marche, 60131 Ancona, Italy
2 Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, S10 2TN, UK
Correspondence
Peter Piper
peter.piper{at}sheffield.ac.uk
| ABSTRACT |
|---|
|
|
|---|
Present address: Unit of Cancer Pathology, University G. D Annunzio', Via Colle dell' Ara, 66013 Chieti Scalo, Italy.
| INTRODUCTION |
|---|
|
|
|---|
In almost all living systems, temperature upshift elicits the heat-shock response. This response leads to strong induction of a conserved set of proteins (the heat-shock proteins, Hsps), and suppression of synthesis of most of the proteins made prior to temperature upshift (reviewed by Morimoto et al., 1997
; Parsell & Lindquist, 1993
; Piper, 1993
). Generally, the strong Hsp synthesis that is triggered by an upshift to slightly supraoptimal, but sublethal, temperatures is subsequently down-regulated. When the cells are maintained at such high temperatures, the synthesis of Hsps is eventually seen to decline, levelling off at lower basal levels that are still higher than the levels of Hsp synthesis that were present before the heat shock. The heat-shock response is therefore a transient, not a sustained stress response.
The heat-shock response has been subjected to very extensive molecular genetic analysis both in the bacterium Escherichia coli (Ades et al., 1999
; Craig & Gross, 1991
) and in the yeast S. cerevisiae (Lindquist & Kim, 1996
; Parsell & Lindquist, 1993
; Piper, 1993
). These studies have established the importance of some of the induced Hsps for the capacity of these organisms to grow at high temperatures and to survive higher, even more extreme temperatures (i.e. to acquire thermotolerance) (Craig & Gross, 1991
; Lindquist & Kim, 1996
; Morimoto et al., 1997
; Parsell & Lindquist, 1993
; Piper, 1993
). Some Hsps exert their protective effects by preventing and/or repairing partial protein denaturation at stressful temperatures, by binding to such proteins so to prevent their aggregation, by eliminating them through selective proteolysis, or by assisting in their refolding (Ellis & van der Vries, 1991
; Gething & Sambrook, 1992
; Lindquist & Kim, 1996
; Parsell & Lindquist, 1993
; Welch, 1991
). Hsps also provide several essential functions during normal growth, many of them providing vital chaperone functions that help to catalyse protein folding and the translocation of protein precursors across membranes (Morimoto et al., 1997
).
In this study, we investigated whether or not H. polymorpha, as the yeast with the highest growth temperature identified to date, displays any unusual features of its heat-shock response. A few studies had already been published on the individual Hsps of H. polymorpha (Titorenko et al., 1996
; Tsiomenko et al., 1997
), but not on the overall patterns of Hsp expression in this yeast. Unexpectedly, we found the normal transience of the H. polymorpha heat-shock response to be suppressed by hypoxia. As far as we are aware, this is the first study showing such a pronounced effect of oxygen levels on the heat-shock response.
| METHODS |
|---|
|
|
|---|
Heat shock, pulse-labelling and measurement of oxygen levels.
YPD and YPM cultures were grown to mid-exponential phase (12x107 cells ml1) at 30 °C, 37 °C and 49 °C, washed twice in water, and resuspended in 30 °C or 37 °C SD or SM to a density of 1x108 cells ml1. One hour later, they were divided into 20 ml aliquots and transferred to prewarmed flasks in a shaking waterbath set at the heat-shock temperature. One aliquot was maintained at the initial temperature as control. With all temperature-shift experiments, the cultures reached their final temperature in less than 3 min.
In vivo labelling was initiated by the addition of L-4,5-3H-leucine [85 Ci mM1 (Amersham) to 3 µCi ml1 final concentration] at the indicated times before or after temperature shift. Labelling was terminated by a rapid addition of 30 µg ml1 of non-radioactive leucine and the dilution of the samples with 1 volume of ice-cold water. Cells were collected by centrifugation, washed once with water, and either processed immediately or quickly frozen and stored at 80 °C.
Partial anoxia was imposed at the time of heat shock by the transfer of normoxic 30 °C cultures to a sealed vessel, so that the medium now occupied 90 % of the tube volume. A 4 ml stirred jacketed vessel, with in-built oxygen electrode, was found convenient for measuring the depletion of dissolved oxygen by these heat-shocked actively respiring cells. This apparatus, originally constructed for rat heart perfusion experiments, was kindly loaned by Iain Mowbray. For our purposes, it was maintained at 49 °C, the cells being transferred to the stirred chamber at time zero in the heat-shock experiment.
Preparation of crude extracts and SDS-PAGE analyses.
Total protein of H. polymorpha was extracted and analysed for pulse-labelled proteins on 12·5 % SDS gels, exactly as described previously for analyses of Hsps in S. cerevisiae (Cheng & Piper, 1994
; Panaretou & Piper, 1992
; Piper et al., 1994
).
Hsp70 mRNA analysis.
Samples of total RNA were prepared, Northern blotted and hybridized to an HpHSA1 gene (Titorenko et al., 1996
) probe fragment, as previously described (Piper et al., 1998
). The probe fragment was PCR amplified from H polymorpha genomic DNA, using primers 5'-ATGTCTAAAGCAGTCGGAATTG-3' and 5'-TCCACCTCTTCGACGGAAG-3'. Mapping of the 5' ends of HpHSA1 transcripts was by AMV reverse transcriptase-catalysed primer extension (Ausubel et al., 1995
), using a [5'-32P] end-labelled primer (TCTGTTACCTTGGTCATTGGC) that anneals at +82 to +103 on the HpHSA1 ORF. DNA sequencing reactions, run in parallel on the same gel, were prepared using the same primer and plasmid pHSA1 (Titorenko et al., 1996
) as template.
Thermotolerance experiments.
Mid-exponential cultures were grown at the indicated temperatures for at least five generations, or heat shocked as described, then incubated aerobically in a shaking water bath at 56 °C. Just before starting this incubation, and at intervals thereafter, samples were diluted into ice-cold YPD. Survival was then determined by plating on YPD plates and counting of the colonies formed over 3 days at 37 °C.
| RESULTS |
|---|
|
|
|---|
|
|
Heat shock induces transient Hsp synthesis and cell cycle arrest in H. polymorpha
The heat-shock response is transient in aerobic cultures of H. polymorpha suddenly subjected to a temperature upshift from 30 °C to 49 °C. Hsps are synthesized at an extremely high level during the first 15 min at the latter temperature, but this Hsp synthesis then declines with further 49 °C maintenance (Fig. 3a
). There is no appreciable thermal death of H. polymorpha maintained at 49 °C (Cabeca-Silva & Madiera-Lopes, 1984
) but we observed that these cells, initially in growth at 30 °C and then shifted to 49 °C, rapidly accumulated as unbudded cells at the latter temperature (not shown). This period of cell stasis lasted 46 h after the shift to 49 °C, during which time there was no increase in cell number. Thereafter, growth slowly resumed, eventually achieving the rate for balanced 49 °C growth. This prolonged stasis with heat shock appears to be a peculiar feature of the H. polymorpha heat-shock response. S. cerevisiae also shows a transient cell cycle arrest when abruptly transferred to its maximum growth temperature, accumulating transiently as unbudded cells (Rowley et al., 1993
). It appears, however, that S. cerevisiae cultures re-enter the cell cycle more rapidly when heat shocked to their maximum temperature of growth (achieving maximal proliferation rates for growth at 3739 °C within 90 min of an upshift to these temperatures from 30 °C (Rowley et al., 1993
).
|
|
To determine if these early results might have been influenced by the oxygen deprivation, we repeated the experiment in Fig. 3a
, but with the deliberate exclusion of oxygen at the time of temperature upshift (see Methods). Use of an oxygen electrode confirmed that hypoxic conditions had been rapidly established, as the heat-shocked respiring H. polymorpha consumed almost all of the available oxygen (to 1012 % atmospheric oxygen within 1214 min, and to <2 % over 3040 min). There was, though, no reduction in viable cell count over the 165 min that these cells were maintained at 49 °C. In these hypoxic heat-shocked cells, the induced Hsp synthesis was markedly sustained, remaining very high even after more than 2 h at 49 °C (Fig. 3b
). Indeed, Hsps were almost the only proteins that were being synthesized by such cells exposed to the combined stresses of a 49 °C heat shock and hypoxia (Fig. 3b
). A similar imposition of hypoxia to cultures in balanced 37 °C growth did not lead to any strong Hsp induction (data not shown), showing that it is necessary to apply both stresses in order to obtain this sustained heat-shock response.
To determine whether hypoxia was generating this sustained heat-shock response in H. polymorpha by preventing the down-regulation of Hsp gene transcription that normally attenuates this stress response, we analysed the mRNA for the major heat-inducible Hsp70 of H. polymorpha (Titorenko et al., 1996
), both in normoxic and in hypoxic cultures heat shocked from 30 °C to 49 °C (Fig. 5
). We were careful to use conditions that exactly replicated those used for the protein pulse-labelling studies in Fig. 3
. Northern blot analysis (Fig. 5a
) revealed the Hsp70 mRNA undergoing an initial rapid increase, then decreasing in the normoxic culture maintained at 49 °C as the heat-shock response was down-regulated. In contrast, the levels of the Hsp70 mRNA were induced and then sustained in the culture that became hypoxic as it was maintained at 49 °C (Fig. 5a
). Primer extension mapping of the 5' end of this mRNA (Fig. 5b
) showed that this sustained response is not associated with any alteration to the transcriptional start site on the HpHSA1 gene (5' ends of the heat-induced Hsp70 mRNA in all of the RNA samples mapping predominantly at 13 and 14, with a minor component at 22; Fig. 5b
). Fig. 5
shows therefore that the strong influence of oxygen deprivation on the H. polymorpha heat-shock response is exerted mainly through altered Hsp mRNA levels, at least in the case of those transcripts encoding the major heat-inducible Hsp70.
|
| DISCUSSION |
|---|
|
|
|---|
H. polymorpha is an obligate aerobe, such that it is not possible to deprive it totally of oxygen for extended periods. Nevertheless, the ability of hypoxia to prevent the normal attenuation of the heat-shock response (Figs 3, 5![]()
) indicates that oxygen, presumably respiratory chain activity, is required for the feedback regulation that normally renders the heat-shock response transient. A sustained heat-shock response is also seen in many systems upon loss of Hsp90 chaperone activity (Duina et al., 1998
; Harris et al., 2001
; Zou et al., 1998b
). One Hsp90 mutation (corresponding to the E381K hsp82 allele) causes S. cerevisiae cells to display extremely high levels of Hsp synthesis, even at low temperatures of growth (Harris et al., 2001
).
Heat-shock transcription factor (HSF) is the transcriptional regulator of the heat-shock response in eukaryotic cells. In vitro studies using recombinant forms of HSF from Drosophila and yeast initially revealed that HSF may act as a direct sensor of physiological changes in temperature and oxidative state (Lee et al., 2000
; Zhong et al., 1998
). More recently, it was shown that recombinant mammalian HSF1 senses both heat and hydrogen peroxide directly through the reversible formation of two redox-sensitive disulphide bonds (Ahn & Thiele, 2003
). This formation of disulphide-bonded HSF1 leads, in turn, to the HSF1 undergoing homotrimerization, nuclear import, and acquiring DNA-binding capability (Ahn & Thiele, 2003
; Morimoto et al., 1997
). While higher organisms generally have multiple forms of HSF (Morimoto et al., 1997
), yeasts generally have just a single, essential HSF (Chen et al., 1993
). The latter is regulated differently from mammalian HSF, in that it lacks redox-sensitive thiol groups (Ahn & Thiele, 2003
) and exists constitutively homotrimerised in the yeast nucleus (Chen et al., 1993
; McDaniel et al., 1989
; Sorger, 1991
). Recent work indicates that up to 3 % of S. cerevisiae genes may be subject to HSF regulation (Hahn et al., 2004
).
The HSF of unstressed cells exists in association with chaperones, notably proteins of the Hsp70 family (Abravaya et al., 1992
; Bonner et al., 2000
; Shi et al., 1998
). A widely held view is that high temperature causes a partial unfolding of intracellular proteins, and that these are then sequestered by Hsp70-family chaperones. This leaves HSF unchaperoned and therefore able to activate the heat-shock response. Subsequently, the response rapidly elevates levels of Hsp70, thereby allowing Hsp70 to rebind HSF, forcing this HSF to reform into the original inactive HSFHsp70 complex. There is considerable support for such a model. In E. coli, a variety of abnormal proteins are found to cause induction of the heat-shock response, provided that they are reasonably stable so that their levels can build up within the cell (Parsell & Sauer, 1989
). In yeast, high levels of mistranslation (Grant et al., 1989
; Trotter et al., 2001
), inhibition of the proteasome (Lee & Goldberg, 1998
) and low levels of Hsp70-family proteins (Bonner et al., 2000
; Craig & Jacobsen, 1984
) can all activate the response. Similarly, the injection of abnormal proteins into Xenopus oocytes triggers a heat-shock response (Ananthan et al., 1986
), while the human HSF is activated by treatments that induce the formation of glutathioneprotein mixed disulphides (Zou et al., 1998a
). Despite this wealth of evidence, a number of findings in microbes are inconsistent with the primary induction signal for the heat-shock response being unfolded protein. In the blue-green alga Synechocystis, there is a strong correlation between the degree of membrane order in thylakoids and the threshold temperature for activation of the heat-shock response (Vigh et al., 1998
). In S. cerevisiae, the temperature optimum for the induction of the response is dramatically affected by membrane lipid content (Chatterjee et al., 1997
). Reduced plasma membrane potential also suppresses the response (Panaretou & Piper, 1990
). These findings are therefore evidence for a membrane sensor of heat stress.
Oxygen also appears to be important in the yeast heat-shock response. Superoxide is a strong inducer of S. cerevisiae HSF (Lee et al., 2000
). Furthermore, anaerobic S. cerevisiae cultures, as well as both aerobic and anaerobic cultures of respiratory-deficient S. cerevisiae petites that lack an assembled respiratory chain, fail to show any HSF activation in response to heat shock (K. Hatzixanthis, M. Mollapour and P.W. Piper; unpublished observations). It appears therefore that an assembled functional mitochondrial respiratory chain may be a requirement for S. cerevisiae cells to mount a heat-shock response. This study provides yet further evidence for the importance of oxygen in the heat-shock response of yeasts, showing it to be required for the attenuation of this response in H. polymorpha (Figs 3 and 5![]()
).
The protein chaperones induced by the heat-shock response are thought to serve an important function in protection against protein damage (Ellis & van der Vries, 1991
; Gething & Sambrook, 1992
; Parsell & Lindquist, 1993
; Welch, 1991
). By binding to exposed hydrophobic surfaces, they help to prevent protein aggregation and, in certain cases, can even help to refold partially denatured proteins (Lindquist & Kim, 1996
). The high Hsp synthesis induced by a heat shock of H. polymorpha to 49 °C (Figs 1, 2a and 3a![]()
![]()
) occurs simultaneously with growth arrest. Nevertheless, it declines rapidly (Fig. 3a
), long before cell division is resumed. In an earlier study, the gene for heat-inducible Hsp70 analysed in Fig. 5
was both deleted and overexpressed in H. polymorpha (Titorenko et al., 1996
). Remarkably, loss of this gene was found to increase survival, and its overexpression to decrease survival at 56 °C (Titorenko et al., 1996
: a study that did not report the effects on growth at 49 °C). The available data therefore does not support the argument that elevated Hsp synthesis makes a major contribution to the high-temperature growth and survival of H. polymorpha.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ades, S. E. L. E. C., Alba, B. M. & Gross, C. A. (1999). The Escherichia coli sigma(E)-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13, 24492461.
Ahn, S. G. & Thiele, D. J. (2003). Redox regulation of mammalian heat shock factor 1 is essential for Hsp gene activation and protection from stress. Genes Dev 17, 516528.
Ananthan, J., Goldberg, A. L. & Voellmy, R. (1986). Abnormal proteins serve as eukaryotic stress signals and trigger the activation of heat shock genes. Science 232, 522525.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1995). Short Protocols in Molecular Biology, 3rd edn. New York: Wiley.
Bonner, J. J., Carlson, T., Fackenthal, D. L., Paddock, D., Storey, K. & Lea, K. (2000). Complex regulation of the yeast heat shock transcription factor. Mol Biol Cell 11, 17391751.
Cabeca-Silva, C. & Madiera-Lopes, A. (1984). Temperature relations of yield, growth and thermal death in the yeast Hansenula polymorpha. Z Allg Mikrobiol 24, 129132.[CrossRef]
Chatterjee, M. T., Khalawan, S. A. & Curran, B. P. (1997). Alterations in cellular lipids may be responsible for the transient nature of the yeast heat shock response. Microbiology 143, 30633068.
Chen, Y., Barlev, N. A., Westergaard, O. & Jakobsen, B. K. (1993). Identification of the C-terminal activator domain in yeast heat shock factor: independent control of transient and sustained transcriptional activity. EMBO J 12, 50075018.[Medline]
Cheng, L. & Piper, P. W. (1994). Weak acid preservatives block the heat shock response and heat-shock-element-directed lacZ expression of low pH Saccharomyces cerevisiae cultures, an inhibitory action partially relieved by respiratory deficiency. Microbiology 140, 10851096.
Craig, E. A. & Gross, C. A. (1991). Is hsp70 the cellular thermometer? Trends Biochem Sci 16, 135140.[CrossRef][Medline]
Craig, E. A. & Jacobsen, K. (1984). Mutations in the heat shock-inducible 70 kilodalton genes of yeast confer temperature sensitive growth. Cell 38, 841849.[CrossRef][Medline]
Duina, A. A., Kalton, H. M. & Gaber, R. F. (1998). Requirement for Hsp90 and a Cyp40-type cyclophilin in negative regulation of the heat shock response. J Biol Chem 273, 1897418978.
Ellis, R. J. & van der Vries, S. M. (1991). Molecular chaperones. Annu Rev Biochem 60, 321347.[CrossRef][Medline]
Gellissen, G. (2000). Heterologous protein production in methylotrophic yeasts. Appl Microbiol Biotechnol 54, 741750.[CrossRef][Medline]
Gething, M. J. & Sambrook, J. (1992). Protein folding in the cell. Nature 355, 3345.[CrossRef][Medline]
Grant, C. M., Firoozan, M. & Tuite, M. F. (1989). Mistranslation induces the heat shock response in the yeast Saccharomyces cerevisiae. Mol Microbiol 3, 215220.[CrossRef][Medline]
Hahn, J. S., Hu, Z., Thiele, D. J. & Iyer, V. R. (2004). Genome-wide analysis of the biology of stress responses through heat shock transcription factor. Mol Cell Biol 24, 52495256.
Harris, N., MacLean, M., Hatzianthis, K., Panaretou, B. & Piper, P. W. (2001). Increasing the stress resistance of Saccharomyces cerevisiae, by the overactivation of the heat shock response that results from Hsp90 defects, does not extend replicative life span but can be associated with a slower chronological ageing of nondividing cells. Mol Gen Genomics 265, 258263.[CrossRef][Medline]
Hollenberg, C. P. & Gellissen, G. (1997). Production of recombinant proteins by methylotrophic yeasts. Curr Opin Biotechnol 8, 554560.[CrossRef][Medline]
Kirk, N. & Piper, P. W. (1991). The determinants of heat shock element-directed lacZ expression in Saccharomyces cerevisiae. Yeast 7, 539546.[CrossRef][Medline]
Lee, D. H. & Goldberg, A. L. (1998). Proteasome inhibitors cause induction of heat shock proteins and trehalose, which together confer thermotolerance in Saccharomyces cerevisiae. Mol Cell Biol 18, 3038.
Lee, S., Carlson, T., Christian, N., Lea, K., Kedzie, J., Reilly, J. P. & Bonner, J. J. (2000). The yeast heat shock transcription factor changes conformation in response to superoxide and temperature. Mol Biol Cell 11, 17531764.
Lindquist, S. & Kim, G. (1996). Heat shock protein 104 expression is sufficient for thermotolerance in yeast. Proc Natl Acad Sci U S A 93, 53015306.
Maheshwari, R., Bharadwaj, G. & Bhat, M. K. (2000). Thermophilic fungi: their physiology and enzymes. Microbiol Mol Biol Rev 64, 461488.
McDaniel, D., Caplan, A. J., Lee, M.-S., Adams, C. C., Fishel, B. R., Gross, D. S. & Garrard, W. T. (1989). Basal level expression of the yeast hsp82 gene requires a heat shock regulatory element. Mol Cell Biol 9, 47894798.
Morimoto, R. I., Kline, M. P., Bimston, D. N. & Cotto, J. J. (1997). The heat-shock response: regulation and function of heat-shock proteins and molecular chaperones. Essays Biochem 32, 1729.[Medline]
Panaretou, B. & Piper, P. W. (1990). Plasma membrane ATPase action affects several stress tolerances of Saccharomyces cerevisiae and Schizosaccharomyces pombe as well as the extent and duration of the heat shock response. J Gen Microbiol 136, 17631770.
Panaretou, B. & Piper, P. W. (1992). The plasma membrane of yeast acquires a novel heat-shock protein (hsp30) and displays a decline in proton-pumping ATPase levels in response to both heat shock and the entry to stationary phase. Eur J Biochem 206, 635640.[Medline]
Parsell, D. A. & Lindquist, S. (1993). The function of heat shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu Rev Genet 27, 437496.[CrossRef][Medline]
Parsell, D. A. & Sauer, R. T. (1989). Induction of a heat shock-like response by unfolded protein in E. coli: dependence on protein level not protein degradation. Genes Dev 3, 12261232.
Piper, P. W. (1993). Molecular events associated with the acquisition of heat tolerance in the yeast Saccharomyces cerevisiae. FEMS Microbiol Rev 11, 111.
Piper, P., Mahé, Y., Thompson, S., Pandjaitan, R., Holyoak, C., Egner, R., Mühlbauer, M., Coote, P. & Kuchler, K. (1998). The Pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast. EMBO J 17, 42574265.[CrossRef][Medline]
Piper, P. W., Talreja, K., Panaretou, B., Moradas-Ferreira, P., Byrne, K., Praekelt, U. M., Meacock, P., Recnacq, M. & Boucherie, H. (1994). Induction of major heat-shock proteins of Saccharomyces cerevisiae, including plasma membrane Hsp30, by ethanol levels above a critical threshold. Microbiology 140, 30313038.
Reinders, A., Romano, I., Wiemken, A. & de Virgilio, C. (1999). The thermophilic yeast Hansenula polymorpha does not require trehalose synthesis for growth at high temperature but does for normal acquisition of thermotolerance. J Bacteriol 181, 46654668.
Rowley, A., Johnston, G. C., Butler, B., Werner-Washburne, M. & Singer, R. A. (1993). Heat shock-mediated cell cycle blockage and G1 cyclin expression in the yeast Saccharomyces cerevisiae. Mol Cell Biol 13, 10341041.
Sechbach, J. (1994). Evolutionary pathways and enigmatic algae: Cyanidarium caldarium (Rhodophyta) and related cells. Dev Hydrobiol 91, 349366.
Shi, Y., Mosser, D. D. & Morimoto, R. I. (1998). Molecular chaperones as HSF1-specific transcriptional repressors. Genes Dev 12, 654666.
Sorger, P. K. (1991). Yeast heat shock factor contains separable transient and sustained response transcriptional activators. Cell 62, 793805.
Sudbery, P. E. (1996). The expression of recombinant proteins in yeasts. Curr Opin Biotechnol 7, 517524.[CrossRef][Medline]
Titorenko, V. I., Evers, M. E., Diesel, A., Samyn, B., van Beeumen, J., Roggenkamp, R., Kiel, J. A. K. W., van der Klei, I. J. & Veenhuis, M. (1996). Identification and characterisation of cytosolic Hansenula polymorpha proteins belonging to the Hsp70 family. Yeast 12, 849857.[CrossRef][Medline]
Trotter, E. W., Berenfeld, L., Krause, S. A., Petsko, G. A. & Gray, J. V. (2001). Protein misfolding and temperature upshift cause G1 arrest via a common mechanism dependent on heat shock factor in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 98, 73137318.
Tsiomenko, A. B., Plekhanov, P. G., Tuymetova, G. P. & Kononova, S. V. (1997). Secretory heat-shock protein of the thermotolerant yeast Hansenula polymorpha. Identification and comparative characteristics. Biochemistry (Mosc) 62, 123128.[Medline]
van Dijk, R., Faber, K. N., Kiel, J. A., Veenhuis, M. & van der Klei, I. (2000). The methylotrophic yeast Hansenula polymorpha: a versatile cell factory. Enzyme Microb Technol 26, 793800.[CrossRef][Medline]
van Uden, N. (1984). Temperature profiles of yeasts. Adv Microb Physiol 25, 195248.[Medline]
Vigh, L., Maresca, B. & Harwood, J. L. (1998). Does the membrane's physical state control the expression of heat shock and other genes? Trends Biochem Sci 23, 369374.[CrossRef][Medline]
Welch, W. J. (1991). The role of heat shock proteins as molecular chaperones. Curr Opin Cell Biol 3, 10331038.[CrossRef][Medline]
Zhong, M., Orosz, A. & Wu, C. (1998). Direct sensing of heat and oxidation by Drosophila heat shock transcription factor. Mol Cell 2, 101108.[CrossRef][Medline]
Zou, J., Salminen, W. F., Roberts, S. M. & Voellmy, R. (1998a). Correlation between glutathione oxidation and trimerisation of heat shock factor 1, an early step in stress induction of the Hsp response. Cell Stress Chaperones 3, 130141.[CrossRef][Medline]
Zou, J., Guo, Y., Guettouche, T., Smith, D. F. & Voellmy, R. (1998b). Repression of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1. Cell 94, 471480.[CrossRef][Medline]
Received 23 April 2004;
revised 18 October 2004;
accepted 9 December 2004.
This article has been cited by other articles:
![]() |
A. W. Truman, S. H. Millson, J. M. Nuttall, M. Mollapour, C. Prodromou, and P. W. Piper In the Yeast Heat Shock Response, Hsf1-Directed Induction of Hsp90 Facilitates the Activation of the Slt2 (Mpk1) Mitogen-Activated Protein Kinase Required for Cell Integrity Eukaryot. Cell, April 1, 2007; 6(4): 744 - 752. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |