Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 151 (2005), 963-973; DOI  10.1099/mic.0.27630-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skovgaard, O.
Right arrow Articles by Løbner-Olesen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skovgaard, O.
Right arrow Articles by Løbner-Olesen, A.
Agricola
Right arrow Articles by Skovgaard, O.
Right arrow Articles by Løbner-Olesen, A.
Microbiology 151 (2005), 963-973; DOI  10.1099/mic.0.27630-0
© 2005 Society for General Microbiology

Reduced initiation frequency from oriC restores viability of a temperature-sensitive Escherichia coli replisome mutant

Ole Skovgaard and Anders Løbner-Olesen

Department of Life Sciences and Chemistry, 18-1, Roskilde University, PO Box 260, DK-4000 Roskilde, Denmark

Correspondence
Ole Skovgaard
olesk{at}ruc.dk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The dnaX gene of Escherichia coli encodes {tau} and {gamma} clamp loader subunits of the replisome. Cells carrying the temperature-sensitive dnaX2016 mutation were induced for the SOS response at non-permissive temperature. The SOS induction most likely resulted from extensive replication fork collapse that exceeded the cells' capacity for restart. Seven mutations in the dnaA gene that partly suppressed the dnaX2016 temperature sensitivity were isolated and characterized. Each of the mutations caused a single amino acid change in domains III and IV of the DnaA protein, where nucleotide binding and DNA binding, respectively, reside. The diversity of dnaA(Sx) mutants obtained indicated that a direct interaction between the DnaA protein and {tau} or {gamma} is unlikely and that the mechanism behind suppression is related to DnaA function. All dnaA(Sx) mutant cells were compromised for initiation of DNA replication, and contained fewer active replication forks than their wild-type counterparts. Conceivably, this led to a reduced number of replication fork collapses within each dnaX2016 dnaA(Sx) cell and prevented the SOS response. Lowered availability of wild-type DnaA protein also led to partial suppression of the dnaX2016 mutation, confirming that the dnaA(Sx) mode of suppression is indirect and results from a reduced initiation frequency at oriC.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The DnaA protein is the initiator of chromosomal DNA replication from the origin of replication, oriC, in Escherichia coli. Analysis of sequence conservation, mutational analysis (Messer, 2002Down) and structural analysis (Erzberger et al., 2002Down) suggest that the DnaA protein is composed of four domains. The conserved N-terminal domain I is involved in protein oligomerization and interaction with the DnaB helicase. Domain II lacks conservation, has a flexible structure and varies in length between different bacteria. Domains IIIa and IIIb are the ADP/ATP-binding and the sensor II domains, respectively, of the AAA+ family of ATPase-type proteins. Domain IIIa has a second interaction with the DnaB helicase and also has another oligomerization determinant as a part of the AAA+ motif. The start of domain IV is involved in membrane binding, and the remaining part of domain IV recognizes and binds to the 9-mer recognition sequences (DnaA-box) sequence motif. The crystal structure of domain IV in complex with a DnaA-box was recently determined, revealing the interactions between individual amino acids and nucleotides in the DnaA-box (Fujikawa et al., 2003Down).

Initiation of E. coli chromosome replication is coupled to cell growth in such a way that it occurs when a certain cell mass per origin, the initiation mass, has accumulated (Donachie, 1968Down). The initiation mass is fairly constant over a wide range of growth rates (reviewed by Bipatnath et al., 1998Down) and is mainly set by accumulation of the DnaA protein in wild-type cells (Løbner-Olesen et al., 1989Down). In different dnaA mutants the initiation mass is increased, indicating that the reduced activity of the DnaA protein is compensated for by a decreased concentration of origins in the cell (Boye et al., 1996Down).

In the initiation process, the DnaA protein bound to either ATP or ADP recognizes and binds to its five DnaA-boxes in oriC (Fuller et al., 1984Down). Subsequently, ATP-bound DnaA recognizes an additional set of 9-mer sequences (I-boxes; McGarry et al., 2004Down). This triggers duplex opening in the AT-rich region, and DnaA-ATP stabilizes this ‘open complex’ by binding 6-mer motifs in the single-stranded AT-rich region (Speck et al., 1999Down). In the final stages of initiation, DnaA interacts with the DnaB helicase and recruits it to the open complex (Marszalek & Kaguni, 1994Down; Seitz et al., 2000Down) to form the ‘pre-priming complex’ that facilitates further strand separation and allows for entry of the replication machinery.

Fast-growing E. coli cells contain multiple origins of replication, which are synchronously initiated, once and only once per cell cycle. Several mechanisms contribute to this stringent control of chromosome replication. Immediate reinitiation is prevented by sequestration of hemimethylated origins (Campbell & Kleckner, 1990Down). During sequestration at least three mechanisms operate to lower the activity of the DnaA initiator protein sufficiently for initiation only to occur one mass doubling later. First, the dnaA promoter is also sequestered (Lu et al., 1994Down). This prevents de novo DnaA synthesis and accumulation during the sequestration period (Campbell & Kleckner, 1990Down). Second, new DnaA-binding sites outside the origin are generated by replication. These sites serve to lower the amount of free DnaA protein available for initiation. The most prominent of these DnaA binding sites, datA, is located about 0·7 Mb away from oriC. The datA region consists of two active DnaA-boxes that titrate large amounts of DnaA protein (Kitagawa et al., 1998Down; Ogawa et al., 2002Down) presumably in either ATP- or ADP-bound form. Third, DnaA-ATP is converted to DnaA-ADP by a process called RIDA involving the sliding clamp of active replication forks as well as the Hda protein (Su'etsugu et al., 2004Down).

E. coli cells with reduced DnaA protein activity, due either to certain mutations in domain III or IV of the protein, or to the introduction of additional datA sites, initiate replication at an increased cell mass per origin. Initiations are often asynchronous, indicating that not all origins are initiated each cell cycle. In such cells the time required to replicate the chromosome is reduced and cells contain only few active replication forks (Morigen et al., 2003Down).

The dnaX gene encodes both the {gamma} and the {tau} subunits of DNA polymerase III holoenzyme by a frame-shifting mechanism and consequently these proteins are identical for the first 430 amino acids (domains I–III) (Blinkova & Walker, 1990Down; Flower & McHenry, 1990Down). The intensive research on the role of {tau} and {gamma} in formation of the DnaX complex was recently reviewed by McHenry (2003)Down. The DnaX complex has a dual role in organizing the asymmetric dimeric replicase and loading the {beta}2 clamp onto DNA. Domain I of {tau}/{gamma} has similarity to the AAA+ class ATPases, and both {tau} and {gamma} possess ATPase activity. Domains IV and V are only present in the longer {tau} and are necessary for interaction with DnaB helicase and the core of DNA polymerase III. Two {tau} subunits organize the replisome by connecting two cores with DnaB helicase, imparting coordinated leading and lagging strand synthesis and rapid fork movement. The {gamma} subunit appears to organize the other subunits of the DnaX complex and connects this complex to the two {tau} subunits. The entire DnaX complex has the stoichiometry {tau}2{gamma}1{delta}1{delta}'1{chi}1{psi}1 in the mature in vivo DNA polymerase III. The dnaX2016 temperature-sensitive mutation changes glycine 118 to aspartate in both {tau} and {gamma} (Blinkova et al., 1993Down). This glycine is located between the Box IV' and the Walker B motif in the AAA+ domain I (Neuwald et al., 1999Down), and the dnaX2016 mutation potentially affects the ATPase activity of {tau}/{gamma}.

Extragenic mutations that partially suppress the temperature-sensitive phenotype of dnaX2016 (Sx phenotype) are easily obtained. Some of these mutations reside in the dnaA gene and consequently a direct interaction between the DnaA and the DnaX proteins was suggested (Walker et al., 1982Down; Ginés-Candelaria et al., 1995Down). Because these mutants were isolated for being concomitantly cold-sensitive, they are termed dnaA(Cs,Sx) mutants.

In this work seven new dnaX(Ts)-suppressing mutations in the dnaA gene are characterized. The amino acids changed in these mutants are widely distributed over domains III and IV of the DnaA protein. The initiation of replication is compromised in all the dnaA(Sx) mutants, implying that the mutant DnaA proteins are partly deficient in sustaining initiation of chromosomal DNA replication from oriC. Furthermore, all the dnaA(Sx) mutants alleviated the strong SOS response induced in the dnaX2016 mutant at non-permissive temperature.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Strains, plasmids and growth conditions.
Relevant markers of principal E. coli K-12 strains are AX727 (dnaX2016; Filip et al., 1974Down), RUC839 (AX727, tna2123 : : Tn10), KM22 [{Delta}(recC ptr recB recD) : : Plac-bet exo kan; Murphy, 1998Down], RUC1227 (KM22, dnaA46 tna2123 : : Tn10), RUC1000 [{Delta}(lac)X74; Berenstein et al., 2002Down], RUC1024 (RUC1000, dnaAp''lacZ; Berenstein et al., 2002Down), RUC1282 (RUC1000, {lambda}sulA''lacZ cI ind att+; Lin & Little, 1988Down), RUC1291 [RUC1282, dnaX2016, Tn5(CamR) inserted near dnaX].

Strains for measuring SOS induction were derived from RUC1282 or RUC1291 and strains for all other growth experiments were derived from RUC1024 by P1 transductions with selection for resistance to tetracycline [dnaA(Sx) alleles] or chloramphenicol (dnaX2016 mutation) and screening with restriction site polymorphism or with RG-PCR (Gasparini et al., 1992Down).

Plasmids pACYC177, pMW119 (a pSC101-based vector), pMOR6 (pACYC177-datA) and pMOR8 (pMW119-datA) were all obtained from Morigen (Morigen et al., 2001Down).

Bacterial cultures were grown in AB minimal medium supplemented with 0·1 µg thiamine ml–1, 0·2 % glucose, 1 % Casamino acids (Difco) and 0·05 % serine (ABTG-caa medium).

Chromosomal gene replacement.
A part of the dnaA gene containing the dnaA(Sx) mutation was PCR-amplified with primers dnaA3 (GGCGGATAACCCTGGCG) and dnaA4 (CCACCTAACGGACCGCTCAC). The DNA fragment was used to replace the temperature-sensitive dnaA46 allele on the chromosome of RUC1227 (KM22, dnaA46, tna2123 : : Tn10) with {lambda} Red-mediated recombination (Murphy, 1998Down) by selection for growth at 42 °C. The replaced DNA fragment was amplified by PCR in candidates, screened for restriction site polymorphism or with RG-PCR (Gasparini et al., 1992Down) and finally sequenced to ensure perfect gene replacement.

DNA sequencing.
Sequences were obtained with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) and an ABI Prism 310 Genetic Analyser (Applied Biosystems).

Autorepression.
Strains derived from RUC1024 were grown exponentially at 34 °C in ABGT-caa medium for five doubling times and triplicate samples were taken at OD450 0·5 for measuring specific {beta}-galactosidase activity (Miller, 1992Down) from the dnaAp''lacZ fusion in the attB site.

SOS induction.
Strains derived from RUC1282 or RUC1291 were grown exponentially at 34 °C in ABGT-caa medium for five doubling times. At OD450 0·5, cultures were diluted 10-fold into prewarmed medium at 38 °C for continuous growth at 38 °C. Duplicate samples for specific {beta}-galactosidase activity from the sulA''lacZ fusion were taken every 30 min. Cultures were diluted further into prewarmed medium when OD450 reached 0·5.

Quantity and stability of DnaA proteins.
Strains derived from RUC1024 were grown exponentially at 34 °C in ABTG-caa medium. At OD450 0·5, a t=0 sample was taken and chloramphenicol was added to 200 µg ml–1 to two aliquots followed by incubation at either 34 °C or 42 °C. Samples from the chloramphenicol-treated aliquots were taken at 30, 60 and 120 min. Proteins were separated by SDS-PAGE and immunoblotted with DnaA antibody obtained from K. Skarstad (Institute for Cancer Research, Oslo, Norway). Alkaline phosphatase activity of the secondary antibody was visualized with ECF substrate (Amersham Biosciences), scanned with a STORM840 PhosphorImager (Amersham Biosciences), and quantified with TotalLab software (Nonlinear Dynamics/Amersham Biosciences).

Flow cytometry.
This was performed as described by Løbner-Olesen et al. (1989)Down on a Bryte-HS flowcytometer (Bio-Rad) equipped with a 100 W mercury lamp. Strains derived from RUC1024 were grown exponentially at 34 °C in ABTG-caa medium. At OD450 0·5, samples were incubated with rifampicin (300 µg ml–1) and cephalexin (36 µg ml–1) to prevent new initiations of DNA replication and cell division.

Determination of the replication time, C, and the number of replication forks per cell, Fc.
Chromosomal DNA was prepared, and the origin to terminus ratio (O/T) was determined by marker frequency analysis exactly as described by Atlung & Hansen (1999)Down. When a culture has a doubling time {tau} and a chromosomal replication time C, the stoichiometry between origins, O, and termini, T, is given by the formula O/T=2C/{tau} (Bremer & Churchward, 1977Down), from which C is extracted as C=ln(O/T{tau}·[ln(2)–1]. The number of active replication forks, Fc, is given by the formula Fc=2(IcTc) (Bremer & Churchward, 1977Down), where Ic is the mean number of origins per cell and Tc is the mean number of termini per cell. Ic was determined by flow cytometry and Tc was determined by Ic divided by O/T.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation of new dnaA mutations suppressing the dnaX2016(Ts) phenotype
E. coli strain RUC839 carries the dnaX2016 mutation and a tna2123 : : Tn10 insertion. The dnaX2016 allele confers temperature-sensitive growth upon the cells, and suppressor mutations were readily isolated by selecting cells able to form colonies after 24 h incubation at 40 °C, conditions non-permissive to strain RUC839. Groups of approximately 50 suppressor colonies were pooled; a P1 lysate was grown on each pool and used to transduce strain AX727 (dnaX2016) to tetracycline resistance at 39 °C. Then one or two colonies from each transduction were tested for having an Sx [suppression of dnaX2016(Ts)] phenotype linked to Tn10 and thus having the suppressor mutation located in the vicinity of the tna gene. Some of the suppressor mutations were suspected to be in the dnaA gene located 5 kb away from tna on the E. coli chromosome. The dnaA genes from 17 suppressor clones were sequenced and nine of these had changes in the dnaA gene. A total of seven different single-nucleotide mutations were found and all mutations changed a single amino acid in the DnaA protein (Table 1Down). The changed amino acids all resided in the C-terminal half of the DnaA protein where the previously isolated dnaA(Cs,Sx) mutations dnaA71, dnaA73 and dnaA721 (Ginés-Candelaria et al., 1995Down) also resided (Fig. 1Down). The remaining eight clones are puzzling. The suppressor mutations must be near tna, and it was suspected that they could reside in oriC and/or dnaN. The dnaN gene and the oriC regions were therefore sequenced in these eight clones, but no mutations were found (not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. The new dnaA mutations and their effect on autorepression and DnaA protein concentration

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1. Localization of dnaA(Sx) mutations relative to known functional regions. The new mutations are indicated in bold; the previously described dnaA(Cs,Sx) mutations (Ginés-Candelaria et al., 1995Down) are in lighter type.

 
To ensure that the Sx phenotype resulted from the mutations in the dnaA gene only and not from additional mutations in nearby genes, five of the dnaA(Sx) mutations were transferred into a new host by gene replacement (Methods, Table 1Up). The Sx phenotype followed the dnaA allele in all cases, demonstrating that this alone was sufficient for suppression of the dnaX2016 mutation. Strains with gene-replaced alleles were used in all subsequent experiments.

Previously isolated dnaX2016(Ts) suppressors residing in the dnaA gene were all selected by sensitivity to growth at 20 °C (Walker et al., 1982Down; Ginés-Candelaria et al., 1995Down). None of the new mutants isolated as described above were cold-sensitive, demonstrating that cold-sensitivity and Sx phenotype are independent.

The dnaA(Sx) mutations reduce the SOS induction in a dnaX2016 strain
The role of the {tau} and {gamma} proteins in organizing the DNA polymerase III holoenzyme and loading of the {beta}-clamp suggests that cells carrying the dnaX2016 mutation might suffer replication fork collapse at non-permissive temperatures and consequently induce the SOS response (Seigneur et al., 1998Down). The SOS response was measured as {beta}-galactosidase activity from a sulA''lacZ fusion carried by a {lambda} phage (Lin & Little, 1988Down).

During steady-state growth at 34 °C, the amount of {beta}-galactosidase expressed from this fusion in wild-type cells was 62 units. The {beta}-galactosidase activity of wild-type cells did not change upon a shift to 38 °C (Fig. 2Down, filled squares). In cells carrying the dnaX2016 mutation the amount of {beta}-galactosidase was 102 units, an indication of slight SOS induction even at permissive temperature. After shifting the dnaX2016 strain to 38 °C the {beta}-galactosidase activity increased immediately; over time a fivefold increase was observed (Fig. 2Down, open squares). When the dnaX2016 mutation was combined with either of the dnaA(Sx) mutations, the activity of the sulA''lacZ fusion was reduced to levels between 80 and 92 units, indicating a partial relief of the signal for SOS induction at permissive temperature. No or little increase in {beta}-galactosidase activity upon a shift to 38 °C was observed for any of the dnaX2016 dnaA(Sx) double mutants (Fig. 2Down).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2. SOS induction in dnaA(Sx) dnaX2016 strains after temperature upshift. Cultures were grown exponentially at 34 °C in ABTG-caa medium with doubling times between 36 and 41 min. At time zero, cultures were diluted 10-fold into the same prewarmed medium at 38 °C and samples for {beta}-galactosidase activity from the sulA''lacZ fusion were taken every 30 min. Data presented are from one representative experiment.

 
It can therefore be concluded that dnaX2016 cells are somewhat SOS-induced even at permissive temperature, and that this induction increases dramatically upon a shift to nonpermissive temperature. The dnaA(Sx) mutations isolated here were able to suppress this SOS induction. This may in turn suggest that the SOS-inducing signal is no longer generated in the dnaA(Sx) cells.

The dnaA(Sx) mutants have reduced autorepression
The E. coli dnaA gene is autoregulated by a mechanism in which the DnaA protein binds to a region between promoters p1 and p2 of the dnaA gene, thereby repressing transcription from both promoters (Braun et al., 1985Down). The expression of a dnaA gene transcriptionally fused to lacZ is therefore a convenient way of measuring DnaA protein–DnaA-box interaction in vivo (Braun et al., 1985Down). A dnaA''lacZ gene fusion integrated in the {lambda} attachment site attB of the chromosome (Berenstein et al., 2002Down) was used. This was convenient because the gene dosage of attB changes little with changing growth rates and/or replication times (C-periods). Transcription from dnaAp was increased for all of the new dnaA(Sx) mutants. The degree of derepression was in the range 1·5–2·0 fold (Table 1Up).

The observed derepression of dnaA gene transcription could be due either to instability of the DnaA(Sx) proteins resulting in lowered DnaA protein concentration, or to a poor interaction with DnaA-boxes. The concentration and the stability of each DnaA(Sx) protein was therefore determined (Fig. 3Down, Table 1Up). Most of the dnaA(Sx) mutations led to little or no change in DnaA protein concentration in the cells relative to wild-type. There was, however, one exception. The dnaA893 mutation had less than 50 % of wild-type DnaA protein concentration. The reduced DnaA concentration resulting from the dnaA893 allele was due to a greatly decreased stability of this protein because this protein was already absent 30 min after de novo protein synthesis was stopped with chloramphenicol (Fig. 3Down). Wild-type DnaA protein as well as the remaining DnaA(Sx) proteins were stable over a 120 min period (Fig. 3Down).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Concentration and stability of DnaA proteins. Samples from exponentially growing cultures of the indicated dnaA strains were withdrawn and de novo protein synthesis blocked with chloramphenicol at time zero. Samples were taken at 0, 30, 60 and 120 min as indicated. Proteins were separated by SDS-PAGE and immunoblotted with DnaA antibody. The marker contains 5·0, 2·5, 1·2 and 0·6 ng purified DnaA protein.

 
It can be concluded that all of the isolated dnaA(Sx) suppressor mutations led to a derepression of the dnaA promoter. For one of the mutations (dnaA893) the derepression resulted from instability of the DnaA protein itself causing a reduction in intracellular concentration. For the remaining mutants the DnaA protein content was around normal or elevated, indicating that these mutations resulted in DnaA proteins with a lower than normal affinity for the DnaA-boxes contained in the dnaA promoter region.

The dnaA(Sx) mutants have increased initiation mass
The reduced ability to repress dnaA gene transcription suggests that the mutant DnaA(Sx) proteins may also interact poorly with the DnaA-boxes located in oriC, leading to feeble initiation of chromosome replication.

A flow cytometric analysis of cells treated with rifampicin and cephalexin (for details see Methods) revealed that the number of origins per cell was 5·9 for both dnaX+ and dnaX2016(Sx) mutant cells at permissive temperature (Table 2Down). All dnaA(Sx) mutations reduced this number of origins per cell by 15–30 % in combination with the dnaX+ allele and by 20–40 % in combination with the dnaX2016 allele (Table 2Down). The mean cell mass was also determined for each culture (Table 2Down) and this value was used to calculate the mean cell mass per origin. The mean cell mass per origin is equal to the initiation mass of the cells multiplied by ln 2 (Bremer et al., 1979Down) and is therefore a reliable measure of the relative initiation mass. All dnaA(Sx) mutants had an increased initiation mass (Table 2Down). The increase in initiation mass was around 50 % for most mutants but smaller (8–23 %) in the dnaA893 mutant. This clearly demonstrates that all dnaA(Sx) mutations resulted in reduced initiation efficiency that led to delayed initiation in the cell cycle.


View this table:
[in this window]
[in a new window]
 
Table 2. Effect on initiation of DNA replication

Cells were grown in ABTG-caa medium at 34 °C, subjected to rifampicin plus cephalexin run-out and analysed by flow cytometry. Data presented are from one representative experiment. The origin distributions are shown in Fig. 4Up.

 
The synchrony of initiation is reduced in dnaA(Sx) mutants
In E. coli wild-type cells all origins of replication are initiated simultaneously. Cells consequently contain 2n (n=0, 1, 2, 3 or 4) origins (Skarstad et al., 1986Down). In agreement with this, dnaA+ cells mainly contained 4 or 8 fully replicated chromosomes after treatment with rifampicin and cephalexin. The synchrony of dnaX2016 cells was slightly reduced relative to dnaX+ cells (Fig. 4Down, lower panels). Asynchrony indices, Ai, were calculated according to Olsson et al. (2003)Down and are indicated on each panel of Fig. 4Down. The presence of either dnaA(Sx) mutation led to a greater fraction of cells containing numbers of origins different from 2n, indicating that origins were no longer initiated in synchrony (Fig. 4Down). However, the degree of asynchrony conferred by the individual dnaA(Sx) mutations varied greatly. The dnaA1112, dnaA1113, dnaA1114 and dnaA1117 alleles led to only slight asynchrony of initiation in otherwise wild-type cells (Ai 0·03–0·08), whereas dnaA893, dnaA895 and dnaA1111 alleles led to a higher degree of asynchrony (Ai 0·13–0·14). Similar asynchrony indices were found in combination with the dnaX2016 mutation (Fig. 4Down). For comparison, the asynchrony index of the well-characterized dnaA46 mutant is 0·21 (Olsson et al., 2003Down).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. Distributions of origin numbers in individual cells. Cultures of strains with the indicated combinations of dnaA(Sx) and dnaX2016 alleles were grown exponentially and samples were subjected to flow cytometry after rifampicin/cephalexin treatment. The number of fully replicated chromosomes after rifampicin/cephalexin treatment reflects the number of origins present in the cell at the time of drug treatment. Asynchrony indices were calculated as Ai=(f3+f5+f6+f7)/(f2+f4+f8)/(origins per cell) (Olsson et al., 2003Down), and are indicated in each panel.

 
The dnaA(Sx) mutants have a decreased replication time and reduced number of replication forks per cell
Cells carrying dnaA(Sx) mutations grew with doubling times that were only slightly increased compared to wild-type cells at permissive temperature (Table 3Down). The low origin content of these cells (Table 2Up) therefore indicated that dnaA(Sx) cells replicated their chromosome faster than wild-type cells, i.e. had a reduced C-period. The ratio of oriC to terC for each dnaA(Sx) mutant alone or in combination with the dnaX2016 mutation was determined by hybridization with specific probes. This ratio is solely dependent on the duration of the replication time and the culture doubling time (Methods).


View this table:
[in this window]
[in a new window]
 
Table 3. Effect on DNA-replication time (C)

The doubling time ({tau}) and the oriC to terC ratio (O/T) was determined in cells growing exponentially in ABTG-caa medium at 34 °C. The replication time (C) of one round of DNA replication and the number of replication forks (Fc) were calculated; see Methods. Each O/T value is the mean of three determinations.

 
The C-period was 49 min in wild-type cells growing with a doubling time of 34 min (Table 3Up). Introduction of dnaX2016 increased the C-period slightly to 53 min without any effect on the doubling time. This may indicate a slight defect of the DnaX2016 protein even at permissive temperature. The dnaA893 allele only reduced the C-period slightly, from 49 to 43 min in wild-type cells and from 53 to 52 min in dnaX2016 cells. All other dnaA(Sx) mutations reduced the C-period significantly either alone (27–37 min) or in combination with the dnaX2016 mutation (34–44 min) (Table 3Up).

The low origin content of the dnaA(Sx) cells also indicated that these cells contained fewer replication forks than their wild-type counterparts. The mean number of replication forks per cell in exponentially growing cells, Fc, is a function of the replication time, C, the time from termination of replication to cell division, D, and the doubling time, {tau}, of the culture (Bremer & Churchward, 1977Down). We calculated the mean number of replication forks per cell, Fc, from the number of origins per cell (Table 2Up) and the origin to terminus (O/T) ratio (Table 3Up). All the dnaA(Sx) mutations reduced Fc significantly and irrespectively of the dnaX allele carried (Table 3Up). For most mutations Fc was reduced to approximately 50–60 % of the wild-type, but the dnaA893 mutation only reduced Fc to 75 % of the wild-type.

It can be concluded that the increased initiation mass observed for dnaA(Sx) cells was accompanied by a decrease in replication time. This indicates that replication forks in wild-type cells either do not travel with maximal velocity or make frequent pauses during replication of the chromosome. The decreased replication time subsequently resulted in a reduction of active replication forks per cell.

Increased gene dosage of datA suppresses the dnaX2016 Ts phenotype
The datA locus titrates large amounts of DnaA protein and an increased gene dosage of datA therefore delays initiation of DNA replication from oriC (Ogawa et al., 2002Down; Morigen et al., 2001Down), induces asynchrony and decreases the replication time (C) (Morigen et al., 2003Down). These phenotypes are similar to those observed for the dnaA(Sx) mutations isolated here. It was therefore tempting to speculate that the mechanism of suppression of the dnaX2016 mutation is related to one of these phenotypes.

Transformation of a dnaX2016 strain with either of the datA-containing plasmids pMOR8 (~5 copies per cell; Morigen et al., 2001Down) or pMOR6 (~10 copies per cell; Morigen et al., 2001Down) increased the permissive temperature by 2 °C, whereas transformation with the parent plasmids pMW119 or pACYC177 did not change the permissive temperature (data not shown). The pMOR6 and pMOR8 plasmids also suppressed the SOS induction in a dnaX2016 mutant at 38 °C (Fig. 2Up) and restored the plating efficiency (EOP) at 39 °C (Table 4Down).


View this table:
[in this window]
[in a new window]
 
Table 4. Efficiency of plating at 39 °C

Overnight cultures of strains with the indicated genotypes were diluted in steps of 10-fold; 100 µl samples of relevant dilutions were spread on pairs of LB plates that were incubated at 34 °C and 39 °C respectively. EOP is the fraction of colonies formed at 39 °C compared to colonies at 34 °C.

 
It can therefore be concluded that a reduction in free DnaA protein in the cell by introduction of datA-containing plasmids suppresses the temperature sensitivity of the dnaX2016 allele partly and to the same extent as the dnaA(Sx) mutations.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Seven dnaA mutations that partially suppressed temperature sensitivity and SOS induction of the dnaX2016 mutant were isolated and characterized. Each of the seven dnaA(Sx) mutations gave rise to a single amino acid change in domain III or IV of the DnaA protein. Flow cytometric studies revealed that cells carrying any one of the dnaA(Sx) mutations initiated DNA replication later in the cell cycle and at an increased initiation mass and somewhat asynchronously, relative to wild-type cells. The time required to replicate the chromosome (C-period) was reduced for all dnaA(Sx) mutants. Plasmids containing the datA region, known to lower the availability of DnaA for initiation of replication, also partially suppressed the dnaX2016 mutation.

SOS induction in dnaX2016 cells
The dnaX2016 mutation causes an immediate stop of DNA synthesis and gradual inhibition of cell division after temperature shift from 30 °C to 42 °C, whereas protein synthesis continues for at least 30 min (Chu et al., 1977Down). The SOS response was found to be somewhat induced even at permissive temperature in dnaX2016 cells. Because the dnaX2016 mutation affects the {tau} and {gamma} clamp loader subunits of the replisome, the most likely explanation for this is that replication forks collapse with low frequency at permissive temperature, generating an SOS-inducing signal, but the collapsed forks can be efficiently restarted, and cells are fully viable (Seigneur et al., 1998Down). At higher temperatures a strong SOS response was elicited in dnaX2016 cells, indicating that the SOS-inducing signal persisted or was continuously generated. An increased frequency of replication fork collapse that exceeds the cells' capacity for replication fork restart is the most likely explanation for the increased SOS induction. At high temperature, cell division is consequently inhibited and viability lost. The presence of any dnaA(Sx) allele or one of the datA plasmids suppressed the SOS induction of dnaX2016 mutant cells. This suggests that the dnaA(Sx) mutations reduce replication fork collapse in dnaX2016 cells.

Chromosome replication in the dnaA(Sx) mutants
Transcription of the dnaA gene was derepressed in all dnaA(Sx) mutants compared to wild-type, indicating that the DnaA(Sx) proteins were somewhat deficient in autorepression. Efficient repression of dnaA transcription is dependent on binding of DnaA associated with either ATP or ADP to a single DnaA-box and subsequent cooperative DnaA-ATP binding to adjacent 6-mer regions, located between the dnaAp1 and p2 promoters. The DnaA(Sx) mutant proteins were therefore expected to fall into two groups: those with altered binding to the DnaA-box and those that affected nucleotide binding. Both of these deficiencies were also expected to affect replication initiation from oriC, where binding of DnaA protein to DnaA-boxes and subsequently to DnaA-ATP-specific sites ensures open complex formation. In agreement with this it was found that all dnaA(Sx) mutations led to initiation at increased cell mass per origin (initiation mass; Table 2Up). In all cases, the increased initiation mass was accompanied by a decrease in the chromosome replication time (C-period). This is in agreement with previous observations where a decrease in availability of wild-type DnaA protein led to increased initiation mass and decreased C-period (Morigen et al., 2003Down). A decreased C-period has also been observed in cells carrying dnaA mutations (Boye et al., 1996Down; Morigen et al., 2003Down) or a mutation in the hns gene (Atlung & Hansen, 2002Down). An increased replication rate might therefore be a general consequence of reduced initiation frequency that in turn leads to fewer replication forks per cell mass. In wild-type cells activity of DNA polymerase III may therefore normally be limited by availability of nucleotides or other factors. Alternatively, frequent pausing of polymerase III could occur in wild-type cells, and a reduced concentration of active replication forks alleviates this pausing.

The synchrony of initiation with the single cell was also reduced by the dnaA(Sx) mutations, albeit to different extents. This reduced affinity of DnaA(Sx) proteins for the origin DnaA-boxes most likely led to an extended initiation interval in these cells. The extended initiation interval causes asynchrony because timely once-per-cell-cycle initiation (synchrony) is dependent on a period of initiation significantly shorter than the sequestration period (Skarstad & Løbner-Olesen, 2003Down) and the latter is not expected to be affected by dnaA(Sx) mutations. One group of mutants (dnaA893, dnaA895 and dnaA1111) initiate DNA replication very asynchronously and another group (dnaA1112, dnaA1113, dnaA1114 and dnaA1117) are only weakly asynchronous (Fig. 4Up). The amino acid changes in the two groups of synchrony mutants are not clustered to a particular region of the DnaA protein (Fig. 1Up), but connections to a particular property of the DnaA protein can be made (discussed below).

The highly asynchronous dnaA(Sx) mutants
Domains IIIa and IIIb of the DnaA protein comprise an AAA+ nucleotide-binding fold (Neuwald et al., 1999Down). The structure of domains III and IV was solved for the Aquifex aeolicus DnaA protein complexed with ADP (Erzberger et al., 2002Down) and the structure of domain IV complexed with a DnaA-box was solved for E. coli DnaA (Fujikawa et al., 2003Down). Fig. 5Down shows the predicted structure of domains III+IV of the E. coli DnaA protein complexed with a DnaA-box. The positions of individual mutations are indicated.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 5. Positions of mutated amino acids in the DnaA protein. The structure of domains III and IV of E. coli DnaA complexed with a DnaA-box and ADP was predicted by threading the primary sequence of the E. coli DnaA protein on the structures of the Aquifex aeolicus DnaA protein complexed with ADP (Erzberger et al., 2002Down) and domain IV of E. coli complexed with a DnaA-box (Fujikawa et al., 2003Down) using the ExPASy server (Gasteiger et al., 2003Down). Green, domain IIIa; red, domain IIIb; orange, domain IV; black sphere, Mg2+ ion; blue string, the ribose-phosphate backbone of the complexed DnaA-box. {alpha}-Helices and {beta}-strands are numbered according to Erzberger et al. (2002)Down. {alpha}7 did not form and {alpha}12 was broken into two helices, here marked as {alpha}12a and {alpha}12b, during the modelling. The locations of the dnaA(Cs,Sx) (Ginés-Candelaria et al., 1995Down) mutations are indicated in blue and the new dnaA(Sx) mutations are indicated in red.

 
Three dnaA(Sx) mutations resulted in a very asynchronous phenotype (Fig. 4Up). The Q208, changed to K in dnaA895, is in contact with E204, important for the intrinsic ATPase activity of DnaA (Mizushima et al., 1997Down; Nishida et al., 2002Down). The A213 changed to D in the previously described dnaA73 (Ginés-Candelaria et al., 1995Down) is also located in this {alpha}3-helix (Erzberger et al., 2002Down) and also confers asynchrony (Blinkova et al., 2003Down). Altered ATPase activity is therefore a likely reason for the defect of the DnaA895 and DnaA73 proteins.

The dnaA1111 (S268T) mutation is located in the sensor I motif in {beta}4, very close to where the {gamma}-phosphate would be if ATP was bound (Erzberger et al., 2002Down). A changed sensing of the bound nucleotide is therefore the suggested cause of the reduced initiation capacity.

The dnaA893 (I379M) mutation is located in {alpha}-helix {alpha}12 (Erzberger et al., 2002Down), but outside the amphipathic part of this helix. This mutant deviated from the other dnaA(Sx) mutants by having only slightly increased initiation mass and replication rate. The present data show that the DnaA893 protein is very unstable (Fig. 3Up), and the DnaA protein concentration is much lower than in wild-type cells. The DnaA893 protein therefore must be more active than the wild-type DnaA protein in DNA replication and autorepression. The increased activity of the DnaA893 protein suggests that this mutation eliminates a negative element; perhaps it escapes the RIDA-dependent inactivation.

The asynchrony of dnaA73, dnaA895 and dnaA1111 together with the classical dnaA mutants in the ATP-binding site (dnaA5, dnaA46, dnaA601 and dnaA604) (Skarstad et al., 1988Down) could indicate that asynchrony is a common property of mutations affecting binding, hydrolysis or sensing of the ATP molecule.

The slightly asynchronous dnaA(Sx) mutants
Four dnaA(Sx) mutations were only slightly affected in initiation synchrony. Two of these, dnaA1112 (T291N) located in the {beta}5 strand (Erzberger et al., 2002Down), and dnaA1113 (F250C) located in the {alpha}6 helix (Erzberger et al., 2002Down), are in regions for which no specific function is known (Fig. 5Up). F250 is however a very conserved amino acid and close to H252, which is changed to Y in dnaA46.

The dnaA1114 (Q370K) mutation is located in the amphipathic {alpha}-helix 12, which in the model in Fig. 5Up is broken by a random structure. This region is associated with phospholipids involved in rejuvenation of DnaA-ATP from DnaA-ADP (Garner et al., 1998Down) and consequently the dnaA1114 mutation may alter the balance between these two species of DnaA protein to favour the DnaA-ADP form, inactive for both autorepression and initiation.

The dnaA1117 (R401S) mutation is located in the basic loop (Fig. 5Up; Erzberger et al., 2002Down) and is in contact with the backbone phosphate of DNA via a water molecule during DnaA-box binding (Fujikawa et al., 2003Down). This suggests that the dnaA1117 mutation leads to a weakening of DnaA-box binding, but maintains the specificity for DnaA-boxes. This is different from the base-specific binding of T435, changed to K in the asynchronous dnaA71 mutant (data not shown), which leads to loss of specificity in DNA binding (Blaesing et al., 2000Down). This suggests an explanation for the clear differences in their effect on DNA replication in vivo.

The suppression mechanism is indirect
At least two different scenarios by which mutations in the dnaA gene suppress the dnaX2016 temperature sensitivity can be imagined. The DnaA [and DnaA(Sx)] proteins may contact the {tau} and/or {gamma} components of the DNA polymerase III holoenzyme either directly or indirectly. The suppressors obtained could be considered allele-specific suppressors of the dnaX2016 mutation. Because the affected amino acids in the mutant DnaA(Sx) proteins are located in both domains III and IV of DnaA (Fig. 1Up), and affect different functions of the protein, we consider the DnaA and {tau} and/or {gamma} interaction unlikely and therefore we investigated indirect suppression mechanisms.

All the dnaA(Sx) mutants analysed shared three characteristics: first, the SOS induction in dnaX2016 was suppressed at elevated temperature; second, initiation of replication was delayed in the cell cycle and occurred at an increased initiation mass; and third, replication of the chromosome was faster than in wild-type cells (the C-period was shorter). The presence of plasmids carrying the datA locus also delayed initiation of DNA replication in the cell cycle, and increased the replication rate and suppressed the dnaX2016 mutation. Delayed initiation in the cell cycle and an increased chromosomal replication rate both contribute to a reduced number of replication forks in cells. It is conceivable that the number of replication forks that collapse in the dnaX2016 cells also carrying a dnaA(Sx) suppressor is reduced at nonpermissive temperature as well. We speculate that the frequency of replication fork collapse in suppressed cells is such that they can be efficiently repaired by the host. This explains why the dnaA(Sx) mutations suppress both temperature sensitivity and SOS induction in cells carrying dnaX2016. Recently, support for an initiation deficiency model was obtained by Blinkova et al. (2003)Down, who analysed the classical dnaA(Cs,Sx) mutants, primarily dnaA721. Like the dnaA(Sx) mutants described here, dnaA721 cells had increased length and reduced number of origins per cell. Suppression of the dnaX2016 temperature-sensitive phenotype by multicopy plasmids carrying the datA locus (this work) or by certain oriC mutations (Blinkova et al., 2003Down) also supports an initiation deficiency model; in both cases binding of DnaA+ protein to oriC is reduced, leading to delayed initiation and an increase in the initiation mass.


    ACKNOWLEDGEMENTS
 
We thank Tove Atlung and Flemming G. Hansen for helpful discussions, advice and material, J. Walker for the AX727 strain and Kirsten Olesen and Christa Persson for expert technical assistance. Jeanette Gregersen and Charlotte Hubert sequenced the dnaA893 and dnaA895 mutations initially. This work was supported by a grant from the Danish Natural Sciences Research Council.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Atlung, T. & Hansen, F. G. (1999). Low-temperature-induced DnaA protein synthesis does not change initiation mass in Escherichia coli K-12. J Bacteriol 181, 5557–5562.[Abstract/Free Full Text]

Atlung, T. & Hansen, F. G. (2002). Effect of different concentrations of H-NS protein on chromosome replication and the cell cycle in Escherichia coli. J Bacteriol 184, 1843–1850.[Abstract/Free Full Text]

Berenstein, D., Olesen, K., Speck, C. & Skovgaard, O. (2002). Genetic organization of the Vibrio harveyi dnaA gene region and analysis of the function of the V. harveyi DnaA protein in Escherichia coli. J Bacteriol 184, 2533–2538.[Abstract/Free Full Text]

Bipatnath, M., Dennis, P. P. & Bremer, H. (1998). Initiation and velocity of chromosome replication in Escherichia coli B/r and K-12. J Bacteriol 180, 265–273.[Abstract/Free Full Text]

Blaesing, F., Weigel, C., Welzeck, M. & Messer, W. (2000). Analysis of the DNA-binding domain of Escherichia coli DnaA protein. Mol Microbiol 36, 557–569.[CrossRef][Medline]

Blinkova, A. & Walker, J. R. (1990). Programmed ribosomal frameshifting generates the Escherichia coli DNA polymerase-III {gamma} subunit from within the {tau}-subunit reading frame. Nucleic Acids Res 18, 1725–1729.[Abstract/Free Full Text]

Blinkova, A., Hervas, C., Stukenberg, P. T., Onrust, R., O'Donnell, M. E. & Walker, J. R. (1993). The Escherichia coli DNA polymerase III holoenzyme contains both products of the dnaX gene, {tau} and {gamma}, but only {tau} is essential. J Bacteriol 175, 6018–6027.[Abstract/Free Full Text]

Blinkova, A., Hermandson, M. J. & Walker, J. R. (2003). Suppression of temperature-sensitive chromosome replication of an Escherichia coli dnaX(Ts) mutant by reduction of initiation efficiency. J Bacteriol 185, 3583–3595.[Abstract/Free Full Text]

Boye, E., Stokke, T., Kleckner, N. & Skarstad, K. (1996). Coordinating DNA replication initiation with cell growth: differential roles for DnaA and SeqA proteins. Proc Natl Acad Sci U S A 93, 12206–12211.[Abstract/Free Full Text]

Braun, R. E., O'Day, K. & Wright, A. (1985). Autoregulation of the DNA replication gene dnaA in E. coli K-12. Cell 40, 159–169.[CrossRef][Medline]

Bremer, H. & Churchward, G. (1977). An examination of the Cooper-Helmstetter theory of DNA replication in bacteria and its underlying assumptions. J Theor Biol 69, 645–654.[CrossRef][Medline]

Bremer, H., Churchward, G. & Young, R. (1979). Relation between growth and replication in bacteria. J Theor Biol 81, 533–545.[CrossRef][Medline]

Campbell, J. L. & Kleckner, N. (1990). E. coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the passage of the chromosomal replication fork. Cell 62, 967–979.[CrossRef][Medline]

Chu, H., Malone, M. M., Haldenwang, W. G. & Walker, J. R. (1977). Physiological effects of growth of an Escherichia coli temperature-sensitive dnaZ mutant at nonpermissive temperatures. J Bacteriol 132, 151–158.[Abstract/Free Full Text]

Donachie, W. (1968). Relationship between cell size and time of initiation of DNA replication. Nature 219, 1077–1079.[CrossRef][Medline]

Erzberger, J. P., Pirruccello, M. M. & Berger, J. M. (2002). The structure of bacterial DnaA: implications for general mechanisms underlying DNA replication initiation. EMBO J 21, 4763–4773.[CrossRef][Medline]

Filip, C. C., Allen, J. S., Gustafson, R. A., Allen, R. C. & Walker, J. R. (1974). Bacterial cell division regulation: characterization of the dnaH locus of Escherichia coli. J Bacteriol 119, 443–449.[Abstract/Free Full Text]

Flower, A. M. & McHenry, C. S. (1990). The {gamma}-subunit of DNA polymerase-III holoenzyme of Escherichia coli is produced by ribosomal frameshifting. Proc Natl Acad Sci U S A 87, 3713–3717.[Abstract/Free Full Text]

Fujikawa, N., Kurumizaka, H., Nureki, O., Terada, T., Shirouzu, M., Katayama, T. & Yokoyama, S. (2003). Structural basis of replication origin recognition by the DnaA protein. Nucl Acids Res 31, 2077–2086.[Abstract/Free Full Text]

Fuller, R. S., Funnell, B. E. & Kornberg, A. (1984). The DnaA protein complex with the E. coli chromosomal origin (oriC) and other sites. Cell 38, 889–900.[CrossRef][Medline]

Garner, J., Durrer, P., Kitchen, J., Brunner, J. & Crooke, E. (1998). Membrane-mediated release of nucleotide from an initiator of chromosomal replication, Escherichia coli DnaA, occurs with insertion of a distinct region of the protein into the lipid bilayer. J Biol Chem 273, 5167–5173.[Abstract/Free Full Text]

Gasparini, P., Bonizzato, A., Dognini, M. & Pignatti, P. F. (1992). Restriction site generating-polymerase chain reaction (RG-PCR) for the probeless detection of hidden genetic variation: application to the study of some common cystic fibrosis mutations. Mol Cell Probes 6, 1–7.[CrossRef][Medline]

Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R. D. & Bairoch, A. (2003). ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res 31, 3784–3788.[Abstract/Free Full Text]

Ginés-Candelaria, E., Blinkova, A. & Walker, J. R. (1995). Mutations in Escherichia coli dnaA which suppress a dnaX(Ts) polymerization mutation and are dominant when located in the chromosomal allele and recessive on plasmids. J Bacteriol 177, 705–715.[Abstract/Free Full Text]

Kitagawa, R., Ozaki, T., Moriya, S. & Ogawa, T. (1998). Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein. Genes Dev 12, 3032.[Abstract/Free Full Text]

Lin, L. L. & Little, J. W. (1988). Isolation and characterization of noncleavable (Ind) mutants of the LexA repressor of Escherichia coli K-12. J Bacteriol 170, 2163–2173.[Abstract/Free Full Text]

Løbner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K. & Boye, E. (1989). The DnaA protein determines the initiation mass of Escherichia coli K-12. Cell 57, 881–889.[CrossRef][Medline]

Lu, M., Campbell, J. L., Boye, E. & Kleckner, N. (1994). SeqA: a negative modulator of replication initiation in E. coli. Cell 77, 413–426.[CrossRef][Medline]

Marszalek, J. & Kaguni, J. M. (1994). DnaA protein directs the binding of DnaB protein in Escherichia coli. J Biol Chem 269, 4883–4890.[Abstract/Free Full Text]

McGarry, K. C., Ryan, V. T., Grimwade, J. E. & Leonard, A. C. (2004). Two discriminatory binding sites in the Escherichia coli replication origin are required for DNA strand opening by initiator DnaA-ATP. Proc Natl Acad Sci U S A 101, 2811–2816.[Abstract/Free Full Text]

McHenry, C. S. (2003). Chromosomal replicases as asymmetric dimers: studies of subunit arrangement and functional consequences. Mol Microbiol 49, 1157–1165.[CrossRef][Medline]

Messer, W. (2002). The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol Rev 26, 355–374.[Medline]

Miller, J. F. (1992). A Short Course in Bacterial Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Mizushima, T., Nishida, S., Kurokawa, K., Katayama, T., Miki, T. & Sekimizu, K. (1997). Negative control of DNA replication by hydrolysis of ATP bound to DnaA protein, the initiator of chromosomal DNA replication in Escherichia coli. EMBO J 16, 3724–3730.[CrossRef][Medline]

Morigen, Boye, E., Skarstad, K. & Løbner-Olesen, A. (2001). Regulation of chromosomal replication by DnaA protein availability in Escherichia coli: effects of the datA region. Biochim Biophys Acta 1521, 73–80.[Medline]

Morigen, Lobner-Olesen, A. & Skarstad, K. (2003). Titration of the Escherichia coli DnaA protein to excess datA sites causes destabilization of replication forks, delayed replication initiation and delayed cell division. Mol Microbiol 50, 349–362.[CrossRef][Medline]

Murphy, K. C. (1998). Use of bacteriophage {lambda} recombination functions to promote gene replacement in Escherichia coli. J Bacteriol 180, 2063–2071.[Abstract/Free Full Text]

Neuwald, A. F., Aravind, L., Spouge, J. L. & Koonin, E. V. (1999). AAA+: a class of chaperone-like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res 9, 27–43.[Abstract/Free Full Text]

Nishida, S., Fujimitsu, K., Sekimizu, K., Ohmura, T., Ueda, T. & Katayama, T. (2002). A nucleotide switch in the Escherichia coli DnaA protein initiates chromosomal replication: evidence from a mutant DnaA protein defective in regulatory ATP hydrolysis in vitro and in vivo. J Biol Chem 277, 14986–14995.[Abstract/Free Full Text]

Ogawa, T., Yamada, Y., Kuroda, T., Kishi, T. & Moriya, S. (2002). The datA locus predominantly contributes to the initiator titration mechanism in the control of replication initiation in Escherichia coli. Mol Microbiol 44, 1367–1375.[CrossRef][Medline]

Olsson, J. A., Nordstrom, K., Hjort, K. & Dasgupta, S. (2003). Eclipse-synchrony relationship in Escherichia coli strains with mutations affecting sequestration, initiation of replication and superhelicity of the bacterial chromosome. J Mol Biol 334, 919–931.[CrossRef][Medline]

Seigneur, M., Bidnenko, V., Ehrlich, S. D. & Michel, B. (1998). RuvAB acts at arrested replication forks. Cell 95, 419–430.[CrossRef][Medline]

Seitz, H., Weigel, C. & Messer, W. (2000). The interaction domains of the DnaA and DnaB replication proteins of Escherichia coli. Mol Microbiol 37, 1270–1279.[CrossRef][Medline]

Skarstad, K. & Løbner-Olesen, A. (2003). Stable co-existence of separate replicons in Escherichia coli is dependent on once-per-cell-cycle initiation. EMBO J 22, 140–150.[CrossRef][Medline]

Skarstad, K., Boye, E. & Steen, H. B. (1986). Timing of initiation of chromosome replication in individual E. coli cells. EMBO J 5, 1711–1717.[Medline]

Skarstad, K., von Meyenburg, K., Hansen, F. G. & Boye, E. (1988). Coordination of chromosome-replication initiation in Escherichia coli – effects of different dnaA alleles. J Bacteriol 170, 852–858.[Abstract/Free Full Text]

Speck, C., Weigel, C. & Messer, W. (1999). ATP- and ADP-DnaA protein, a molecular switch in gene regulation. EMBO J 18, 6169–6176.[CrossRef][Medline]

Su'etsugu, M., Takata, M., Kubota, T., Matsuda, Y. & Katayama, T. (2004). Molecular mechanism of DNA replication-coupled inactivation of the initiator protein in Escherichia coli: interaction of DnaA with the sliding clamp-loaded DNA and the sliding clamp-Hda complex. Genes Cells 9, 509–522.[Abstract/Free Full Text]

Walker, J. R., Ramsey, J. A. & Haldenwang, W. G. (1982). Interaction of the Escherichia coli DnaA initiation protein with the DnaZ polymerization protein in vivo. Proc Natl Acad Sci U S A 79, 3340–3344.[Abstract/Free Full Text]

Received 16 September 2004; revised 15 November 2004; accepted 17 November 2004.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skovgaard, O.
Right arrow Articles by Løbner-Olesen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skovgaard, O.
Right arrow Articles by Løbner-Olesen, A.
Agricola
Right arrow Articles by Skovgaard, O.
Right arrow Articles by Løbner-Olesen, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2005 Society for General Microbiology.