Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 151 (2005), 1239-1254; DOI  10.1099/mic.0.27535-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coppi, M. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coppi, M. V.
Agricola
Right arrow Articles by Coppi, M. V.
Microbiology 151 (2005), 1239-1254; DOI  10.1099/mic.0.27535-0
© 2005 Society for General Microbiology

The hydrogenases of Geobacter sulfurreducens: a comparative genomic perspective

Maddalena V. Coppi

Department of Microbiology, 203N Morrill Science Center IVN, University of Massachusetts-Amherst, Amherst, MA 01003, USA

Correspondence
Maddalena V. Coppi
mcoppi{at}microbio.umass.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The hydrogenase content of the genome of Geobacter sulfurreducens, a member of the family Geobacteraceae within the {delta}-subdivision of the Proteobacteria, was examined and found to be distinct from that of Desulfovibrio species, another family of {delta}-Proteobacteria on which extensive research concerning hydrogen metabolism has been conducted. Four [NiFe]-hydrogenases are encoded in the G. sulfurreducens genome: two periplasmically oriented, membrane-bound hydrogenases, Hya and Hyb, and two cytoplasmic hydrogenases, Mvh and Hox. None of these [NiFe]-hydrogenases has a counterpart in Desulfovibrio species. Furthermore, the large and small subunits of Mvh and Hox appear to be related to archaeal and cyanobacterial hydrogenases, respectively. Clusters encoding [Fe]-hydrogenases and periplasmic [NiFeSe]-hydrogenases, which are commonly found in the genomes of Desulfovibrio species, are not present in the genome of G. sulfurreducens. Hydrogen-evolving Ech hydrogenases, which are present in the genomes of at least two Desulfovibrio species, were also absent from the G. sulfurreducens genome, despite the fact that G. sulfurreducens is capable of hydrogen production. Instead, the G. sulfurreducens genome contained a cluster encoding a multimeric Ech hydrogenase related (Ehr) complex that was similar in content to operons encoding Ech hydrogenases, but did not appear to encode a hydrogenase. Phylogenetic analysis revealed that the G. sulfurreducens ehr cluster is part of a family of related clusters found in both the Archaea and Bacteria.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The ability to metabolize hydrogen is widespread among the prokaryotes, and is catalysed by a diverse array of enzymes called hydrogenases, which can catalyse both the oxidation and production of hydrogen (reviewed by Adams, 1990Down; Albracht, 1994Down; Frey, 2002Down; Vignais et al., 2001Down; Vignais & Colbeau, 2004Down). Hydrogenases can play a critical role in proton-motive force generation and can also be involved in redox homeostasis. Proton-reducing hydrogenases can dispose of excess reducing equivalents as hydrogen, and cytoplasmic hydrogenases can oxidize and reduce a variety of electron carriers, including NAD(P), cytochromes, ferredoxin, and cofactor F420. The majority of hydrogenases belong to one of two phylogenetically distinct classes of metalloenzymes, [NiFe]-hydrogenases and [Fe]-hydrogenases. [NiFe]-hydrogenases are common among the prokaryotes, but [Fe]-hydrogenases are primarily found in the clostridia, Thermotogales and Desulfovibrionaceae. Many Bacteria and Archaea express multiple hydrogenases, which differ in phylogenetic class, intracellular localization and function.

Among the {delta}-Proteobacteria, the study of hydrogen metabolism has, thus far, been largely confined to Desulfovibrio species (reviewed by Fauque et al., 1988Down; Frey, 2002Down; Vignais et al., 2001Down; Vignais & Colbeau, 2004Down). However, approximately 40 % of the Geobacteraceae, another family of anaerobic {delta}-Proteobacteria, can grow utilizing hydrogen as an electron donor (Lovley, 2000Down; Lovley et al., 2004Down). The Geobacteraceae have been found to be the predominant members of a variety of microbial communities in which dissimilatory iron reduction is the terminal electron-accepting process (Anderson et al., 2003Down; Anderson & Lovley, 1999Down; Cummings et al., 2003Down; Ikenaga et al., 2003Down; Petrie et al., 2003Down; Roling et al., 2001Down; Rooney-Varga et al., 1999Down; Snoeyenbos-West et al., 2000Down; Stein et al., 2001Down). The ability of many of the Geobacteraceae to respire two common fermentation by-products, acetate and hydrogen (Lovley, 2000Down; Lovley et al., 2004Down), may help them to compete effectively in the subsurface. The metabolic activities of the Geobacteraceae can influence the cycling of organic matter and minerals in the subsurface (Lovley, 2000Down; Lovley et al., 2004Down) and play a crucial role in biological electricity production (Bond et al., 2002Down; Bond & Lovley, 2003Down; Holmes et al., 2004aDown) and the bioremediation of both organic and metal contamination (Anderson et al., 2003Down; Anderson & Lovley, 1999Down; Cummings et al., 2003Down; Istok et al., 2004Down; Roling et al., 2001Down; Rooney-Varga et al., 1999Down; Snoeyenbos-West et al., 2000Down). The establishment of a genetic system for the hydrogen-respiring species Geobacter sulfurreducens (Coppi et al., 2001Down), coupled with the availability of its complete genome sequence (Methé et al., 2003Down), has enabled the investigation of the molecular basis of hydrogen metabolism in this environmentally significant family of iron-reducing bacteria.

This report presents a comparative genomic analysis of the hydrogenases of G. sulfurreducens. The results of this analysis, in conjunction with information obtained from the genome of the closely related species, Geobacter metallireducens (www.jgi.doe.gov), and those of two Desulfovibrio species, Desulfovibrio vulgaris (Heidelberg et al., 2004Down) and Desulfovibrio desulfuricans (www.jgi.doe.gov), indicate that hydrogenase metabolism in the {delta}-Proteobacteria is very diverse.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Nomenclature.
All G. sulfurreducens hydrogenase large and small subunits, maturation proteases and b-type cytochromes were designated L, S, P and B irrespective of the nomenclature of their closest relatives. ORFs lacking hydrogenase-specific designations in the NCBI database were assigned names analogous to those of G. sulfurreducens hydrogenases.

Identification of hydrogenase-encoding gene clusters.
The complete genomes of G. sulfurreducens (Methé et al., 2003Down), the draft genome sequence of G. metallireducens (www.jgi.doe.gov), and genome sequence from a co-culture of Desulfuromonas acetoxidans and Desulfuromonas palmitatis (www.jgi.doe.gov) were searched for hydrogenase-encoding gene clusters with the TBLASTN algorithm (Altschul et al., 1990Down), using a variety of hydrogenase subunit sequences as probes. These included the Hmd hydrogenase of Methanothermobacter thermoautotrophicus (von Bunau et al., 1991Down), the catalytic subunit (HydA) of the periplasmic [Fe]-hydrogenase of Desulfovibrio fructosovorans (Casalot et al., 1998Down), an [Fe]-hydrogenase H-cluster consensus sequence (pfam02906, Bateman et al., 2002Down), and the small and large subunits of several [NiFe]-hydrogenases: the quinone-reducing [NiFe]-hydrogenase of Wolinella succinogenes (Dross et al., 1992Down), the hydrogen-sensing hydrogenase of Bradyrhizobium japonicum strain USDA 110 (Black et al., 1994Down), the methyl viologen-reducing hydrogenase of Methanococcus voltae (Halboth & Klein, 1992Down), the F420-reducing hydrogenase of Methanococcus voltae (Halboth & Klein, 1992Down), hydrogenase 3 of Escherichia coli (Sauter et al., 1992Down), hydrogenase IV of E. coli (Andrews et al., 1997Down) and the Ech hydrogenase of Desulfovibrio gigas (Rodrigues et al., 2003Down).

In order to determine the origin of the hya and ehr clusters identified in the genome sequence derived from the Desulfuromonas acetoxidans and Desulfuromonas palmitatis co-culture, genomic DNA from pure cultures of these two species (obtained from ATCC and our laboratory culture collection) were screened with PCR primers based on the co-culture genome sequence. Fragments of the ehrL and hyaL genes were amplified from Desulfuromonas palmitatis genomic DNA with primer combinations DhyaLsense and DhyaLanti (GGACATCATCAAGATCCACG and ACATTCAGCTTGCCGAGGAC) and DehrLsense and DehrLanti (GAGCTGGAGCGTGGCCAACC and GATTGAAACTCTTGTTGCAGAG), respectively.

Phylogenetic analysis.
Hydrogenase subunit alignments were created with CLUSTAL X (Thompson et al., 1994Down). Following manual optimization of alignments and excision of hypervariable regions with Se-Al (Rambaut, 1996Down), aligned sequences were imported into PAUP* version 4.0 (http://paup.csit.fsu.edu/ Sinauer Associates) where phylogenetic trees were inferred. Distances and branching order were determined by the neighbour-joining method (Saitou & Nei, 1987Down) using the BioNJ algorithm (Gascuel, 1997Down). Bootstrap values were determined for 100 replicates. Alignments are available upon request.

During alignment and phylogenetic analysis of large subunits, all selenocysteine residues were treated as cysteine residues. In the cases of FrhA of Methanopyrus kandleri, VhuA of Methanococcus voltae, and VhuA of Methanocaldococcus jannaschii, in which the conserved C-terminal NiFeSe centre-binding domain is found in a separate subunit (FrhU or VhuU), these short subunits were also incorporated into the alignment.

Percentage similarity was determined for global pairwise alignments created using the algorithm of Needleman & Wunsch (1970)Down and scored using the blosum62 matrix (Henikoff & Henikoff, 1992Down).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hydrogenase content of the G. sulfurreducens genome
The genome of G. sulfurreducens contains four distinct [NiFe]-hydrogenase-encoding gene clusters: two encoding membrane-bound hydrogenases with periplasmic active sites (hya and hyb), one encoding a cytoplasmic bidirectional NAD-reducing hydrogenase (hox) of the type found in cyanobacteria (Tamagnini et al., 2002Down), and one encoding a cytoplasmic hydrogenase (mvh) related to the methyl viologen-reducing hydrogenases of methanogens (Halboth & Klein, 1992Down; Reeve et al., 1989Down).

Surprisingly, [Fe]-hydrogenases, which are common in Desulfovibrio species (Fauque et al., 1988Down; Vignais et al., 2001Down), do not appear to be encoded in the G. sulfurreducens genome. Only one G. sulfurreducens gene had weak homology to the H-cluster consensus sequence of the catalytic subunit of [Fe]-hydrogenases (pfam02906, Bateman et al., 2002Down). This gene (AAR36753 appeared to encode a hybrid protein with an N-terminus that was related to the catalytic subunits of the [Fe]-hydrogenases and a C-terminus with homology to transcription factors. The degree of similarity of the N-terminus of this protein to the [Fe]-hydrogenase H-cluster consensus sequence (pfam02906, Bateman et al., 2002Down) was significantly lower than that of a variety of characterized [Fe]-hydrogenases: 39 % similarity versus 71–76 % similarity for the H-clusters of various Desulfovibrio [Fe]-hydrogenases, and 59–77 % similarity for a variety of prokaryotic and eukaryotic [Fe]-hydrogenases. Although alignment of the N-terminus of this protein to the H-clusters of a variety of characterized [Fe]-hydrogenases revealed that the four cysteine residues critical for coordination of the FeFe centre were conserved (Vignais et al., 2001Down), several of the invariant residues surrounding them were not. In addition, roughly 20 % of the H-cluster domain appears to be deleted in the N-terminus of the G. sulfurreducens protein. While it is possible that this protein may have some role in hydrogen-dependent gene regulation, its N-terminus is clearly distinct from the H-clusters of the characterized [Fe]-hydrogenases, especially those of Desulfovibrio species. It was, therefore, not classified as a hydrogenase or analysed further.

[NiFeSe]-hydrogenases, which are also frequently found in Desulfovibrio species (Fauque et al., 1988Down; Vignais et al., 2001Down), were likewise absent from the G. sulfurreducens genome. Likewise, Ech hydrogenases, which are found in a variety of hydrogen-metabolizing organisms (Vignais et al., 2001Down), including two Desulfovibrio species (Heidelberg et al., 2004Down; Rodrigues et al., 2003Down), were not detected in the G. sulfurreducens genome. Instead, an Ech hydrogenase related (ehr) cluster was identified. The composition of this ehr cluster resembled that of Ech hydrogenase operons, except that the Ehr subunit most homologous to the large subunits of the Ech hydrogenases (EhrL) lacked NiFe centre-binding residues. This indicated that the ehr cluster of G. sulfurreducens does not encode a [NiFe]-hydrogenase.

The hya and hyb clusters
The genome of G. sulfurreducens contains two clusters, hya and hyb (Fig. 1a, bDown) encoding membrane-bound hydrogenases with periplasmically oriented active sites belonging to Group 1 of the [NiFe]- and [NiFeSe]-hydrogenase classification system of Vignais et al. (2001)Down. Group 1 includes a variety of periplasmically oriented hydrogenases, including numerous heterotrimeric membrane-bound respiratory hydrogenases, the heterotetrameric membrane-bound respiratory hydrogenase of E. coli, HYD2, and the heterodimeric [NiFe]- and [NiFeSe]-hydrogenases of Desulfovibrio species (Vignais et al., 2001Down). Like many of the members of Group 1, both Hya and Hyb have small subunits (HyaS and HybS) with N-terminal twin arginine motifs, indicative of a periplasmic active site (Gross et al., 1999Down; Robinson & Bolhuis, 2001Down; Weiner et al., 1998Down; Wu et al., 2000Down), and integral membrane subunits (HyaB and HybB), which imply an association with the membrane and menaquinone pool (Cauvin et al., 1991Down; Gross et al., 1998aDown, bDown; Menon et al., 1994Down; Sayavedra-Soto & Arp, 1992Down).



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 1. Group 1 [NiFe]-hydrogenases of G. sulfurreducens. (a) Comparison of the G. sulfurreducens hya cluster (Coppi et al., 2004Down) to the hox operon of W. eutropha (Kortlüke et al., 1992Down; Schwartz et al., 2003Down) and the hyn operon of Desulfovibrio gigas (Li et al., 1987Down; Rousset et al., 1998Down). Small and large subunits are shaded in grey. ?, Unusual proximal iron-sulfur cluster ligating site. Its sequence is provided to the right with putative ligating cysteine residues indicated in bold type and the position of the C to D substitution indicated in underlined bold type. (b) Similarity of the G. sulfurreducens hyb cluster (Coppi et al., 2004Down) to the hyb operon of E. coli (Menon et al., 1994Down; Sargent et al., 1998Down). Small and large subunits are shaded in grey. Hydrogenase motifs and domains were identified according to Gross et al. (1998a)Down, Meek & Arp (2000)Down, Przybyla et al. (1992)Down, Vignais et al. (2001)Down, Volbeda et al. (1995)Down and the Pfam protein families database (Bateman et al., 2002Down). Putative transmembrane helices were identified using THMM version 2.0 (www.cbs.dtu.dk/services/TMHMM). (c) Phylogenetic tree of proteobacterial Group 1 [NiFe]-hydrogenase small subunits. Distances and branching order were determined for protein sequences by the neighbour-joining method (Saitou & Nei, 1987Down) using the BioNJ algorithm (Gascuel, 1997Down). Small subunits deriving from the Geobacteraceae are indicated in bold type. Accession numbers are provided in parentheses, except for Desulfuromonas palmitatis Hya, which was identified as described in Methods. *, Gene symbol assigned by the author.

 
The G. sulfurreducens hya cluster (Fig. 1aUp) consists of four genes, hyaS, hyaL, hyaB and hyaP, which encode a small subunit with an N-terminal twin arginine motif (SRRDFLK), a large subunit, a hydrophobic b-type cytochrome with four conserved haem b-binding histidine residues (Cauvin et al., 1991Down; Gross et al., 1998aDown, bDown, 1999Down; Sayavedra-Soto & Arp, 1992Down; Meek & Arp, 2000Down) and a maturation protease, respectively. Thus, the hya cluster resembles a variety of operons (Fig. 1aUp) encoding heterotrimeric, membrane-bound, respiratory hydrogenases with periplasmic active sites (Vignais et al., 2001Down). These include the operons of the characterized respiratory hydrogenases of Wautersia eutropha (Kortlüke et al., 1992Down; Schwartz et al., 2003Down), Wolinella succinogenes, (Dross et al., 1992Down) and a variety of nitrogen-fixing Proteobacteria (Vignais et al., 2001Down). The HyaS, HyaL, and HyaB subunits of G. sulfurreducens Hya are 58–57, 59–65 and 39–51 % similar to their respective homologues in Wau. eutropha, Wol. succinogenes and the nitrogen-fixing {alpha}-Proteobacterium Rhodobacter capsulatus (Leclerc et al., 1988Down; Richaud et al., 1990Down).

Homologous hya clusters were found in the genomes of the closely related species, G. metallireducens (Lovley et al., 1993Down) and the more distantly related marine Geobacteraceae, Desulfuromonas palmitatis (Coates et al., 1995Down; Holmes et al., 2004bDown). The three subunits of G. sulfurreducens Hya are 90–95 % similar to their G. metallireducens counterparts, but only 65–78 % similar to those of Desulfuromonas palmitatis. With the exception of HyaS, each of the ORFs encoded in the three Geobacteraceae hya clusters contains features typical of the subunits of the periplasmically oriented heterotrimeric uptake hydrogenases (Fig. 1aUp). The three Geobacteraceae HyaS subunits contain an aspartate residue in place of the conserved cysteine residue that ligates the proximal [4Fe-4S] cluster (CXXD versus CXXC, Fig. 1aUp) in all of the other Group 1 [NiFe]-hydrogenases (Przybyla et al., 1992Down; Volbeda et al., 1995Down).

The hyb cluster of G. sulfurreducens is larger than the hya cluster and contains six ORFs (Fig. 1bUp), including four with homology to the subunits of E. coli HYD2, a periplasmically oriented heterotetrameric respiratory hydrogenase (Laurinavichene & Tsygankov, 2001Down; Laurinavichene et al., 2002Down; Menon et al., 1994Down; Sargent et al., 1998Down). Like E. coli HYD2, G. sulfurreducens Hyb also appears to consist of four subunits: 1) HybS, a small subunit with an N-terminal twin arginine motif (SRRDFMK) and three classical Group 1 hydrogenase iron-sulfur cluster-binding motifs; 2) HybA, a subunit with an N-terminal twin arginine motif (TRRDFLK) and four iron-sulfur cluster-binding motifs; 3) HybB, an integral membrane subunit predicted to have eight transmembrane helices; and 4) HybL, a large subunit. Similar heterotetrameric [NiFe]-hydrogenase-encoding clusters can be found in the genomes of at least two other {gamma}-Proteobacteria, Salmonella enterica and Actinobacillus pleuropneumoniae, as well as an {alpha}-Proteobacterium, Magnetospirillum magnetotacticum, and an unclassified Proteobacterium, Magnetococcus sp. MC-1. A homologous hyb cluster could not be found in the genome of G. metallireducens. The small and large subunits of G. sulfurreducens Hyb are 66–67 and 71–74 % similar to the large and small subunits of the heterotetrameric hydrogenases of E. coli and Magnetococcus sp. MC-1, respectively. The G. sulfurreducens HybA and HybB subunits are slightly less similar, 49–51 and 55–57 %, to their respective E. coli and Magnetococcus counterparts.

Alignment of the various subunits of G. sulfurreducens Hyb with those of E. coli HYD2 revealed that all of the defining features of the subunits of HYD2 (Menon et al., 1994Down; Sargent et al., 1998Down) are present (Fig. 1bUp). However, G. sulfurreducens HybB contains an unusual hydrophilic 35 amino acid insertion between putative transmembrane helices 4 and 5 which is not present in any of the other heterotetrameric hydrogenase integral membrane subunits currently present in the NCBI database.

The subunits of G. sulfurreducens Hyb were clearly most similar to those of other heterotetrameric membrane-bound hydrogenases. However, the large and small subunits of G. sulfurreducens Hya were 50–60 % similar to those of two subgroups of the Group 1 hydrogenases, the heterotrimeric, membrane-bound, respiratory hydrogenases and the heterodimeric periplasmic [NiFe]-hydrogenases of Desulfovibrio species. In order to clarify the relationship of the Hya and Hyb hydrogenases of G. sulfurreducens to the rest of the Group 1 hydrogenases, phylogenetic analysis of the large and small subunits of a variety of proteobacterial Group 1 hydrogenases was performed using distance methods (Fig. 1cUp). The results of the two phylogenetic analyses were similar (large subunit data not shown). The small and large subunits of the [NiFeSe]-hydrogenases [Fig. 1c(v)Up] of Desulfovibrio species were the most divergent and were therefore used as the outgroup. The next most deeply branching cluster (iv) was also composed of hydrogenases from Desulfovibrio species, specifically the heterodimeric [NiFe]-hydrogenases. The separation of the Desulfovibrio [NiFe]-hydrogenases from the other Group 1 [NiFe]-hydrogenases, including those of the Geobacteraceae, also occurred when trees were inferred by parsimony methods (data not shown). The remaining Group 1 hydrogenases, including Hya and Hyb of G. sulfurreducens, were divided into three clusters. The first cluster (i) consisted entirely of heterotrimeric uptake hydrogenases and was split into two subclusters: (a) hydrogenases from a variety of {alpha}-, {beta}- and {gamma}-Proteobacteria and (b) hydrogenases from several {varepsilon}-Proteobacteria and a single {gamma}-Proteobacterium, Shewanella oneidensis MR-1. The second cluster (ii) contained the three Geobacteraceae HyaS subunits. The third cluster (iii) consisted exclusively of heterotetrameric membrane-bound [NiFe]-hydrogenases, including G. sulfurreducens HybS. In summary, Hya and Hyb of G. sulfurreducens are more closely related to Group 1 hydrogenases found in other subdivisions of the Proteobacteria than to those of Desulfovibrio species, the closest relatives of the Geobacteraceae according to phylogenetic analysis based on the 16S rRNA gene.

The hox cluster
The third hydrogenase-encoding cluster of G. sulfurreducens (Fig. 2Down) was designated hox because of its homology to the cytoplasmic, bidirectional, NAD-reducing hydrogenases of the cyanobacteria (Tamagnini et al., 2002Down). The physiological function of the cyanobacterial NAD-reducing hydrogenases is not well understood (Schutz et al., 2004Down; Tamagnini et al., 2002Down). These multimeric hydrogenases consist of two dissociable moieties with distinct enzymic activities, an NADH diaphorase and a hydrogenase. The diaphorase consists of three subunits with homology to the peripheral subunits of respiratory complex I (HoxE, HoxF and HoxU), whereas the hydrogenase is a heterodimer composed of the small and large subunits (HoxY and HoxH). The G. sulfurreducens hox cluster contains all five of these genes arranged in tandem followed by a gene encoding a maturation protease (Fig. 2aDown). A homologous cluster is present in the genome of G. metallireducens. NAD-reducing hydrogenase-encoding gene clusters are also found in the genomes of several other Proteobacteria: Wautersia eutropha (Fig. 2aDown), Burkholderia fungorum, Rhodococcus opacus and Magnetospirillum magnetotacticum.



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 2. The hox cluster of G. sulfurreducens. (a) Comparison of the G. sulfurreducens hox cluster (AAR36094ndash;AAR36089) to those of Synechocystis (Appel & Schulz, 1996Down) and Wau. eutropha (Schwartz et al., 2003Down; Tran-Betcke et al., 1990Down). Hydrogenase large and small subunits are shaded in grey, whereas NAD diaphorase subunits are white. ORFs unrelated to bidirectional NAD-reducing hydrogenase function are shaded in black. Hydrogenase and diaphorase motifs and domains were identified according to Tamagnini et al. (2002)Down, Vignais et al. (2001)Down and the Pfam protein families database (Bateman et al., 2002Down). (b) Phylogenetic tree of representative Group 3 hydrogenase small subunits. Distances and branching order were determined for protein sequences by the neighbour-joining method (Saitou & Nei, 1987Down) using the BioNJ algorithm (Gascuel, 1997Down). Small subunits deriving from the Geobacteraceae are indicated in bold type. Accession numbers are provided in parentheses. *, Gene symbol assigned by the author.

 
The bidirectional NAD-reducing hydrogenases belong to Group 3d of the classification system of Vignais et al. (2001)Down. Phylogenetic analysis of the large and small subunits of the Group 3 hydrogenases was performed to assess the relationship of the two Geobacter Hox hydrogenases to the other Group 3 hydrogenases. Similar results were obtained for the two analyses (large-subunit data not shown). The NAD-reducing hydrogenases form a discrete cluster (i), which is split into two subclusters: one (a) consisting of the cyanobacterial and Geobacter hox subunits as well as those of a phototrophic green non-sulfur bacterium, Chloroflexus aurantiacus, and the other (b) comprising the {alpha}- and {beta}-proteobacterial hox clusters described above. The division between these two subclusters was also supported by parsimony methods. Thus, the Geobacter Hox hydrogenases appear to be more closely related to those of the cyanobacteria than those found in the genomes of other Proteobacteria. Pairwise comparison of the six G. sulfurreducens Hox subunits to those of Synechocystis sp. 6803 (Appel & Schulz, 1996Down) and the {beta}-Proteobacterium Wau. eutropha (Schwartz et al., 2003Down) confirmed this relationship (Fig. 2aUp). The G. sulfurreducens Hox genes are 59–71 % similar to those of Synechocystis but only 37–49 % similar to those of Wau. eutropha. In addition, the G. sulfurreducens HoxU and HoxF subunits contain iron-sulfur cluster-binding motifs that are found in cyanobacterial subunits, but are absent from the {alpha}- and {beta}-proteobacterial HoxU and HoxF subunits (Fig. 2aUp). Furthermore, the various {alpha}- and {beta}-proteobacterial hox clusters lack a hoxE gene.

The mvh cluster
The G. sulfurreducens mvh cluster (Fig. 3bDown) is composed of eight closely spaced genes, and a homologous cluster (87–97 % similar) is found in the genome of G. metallireducens. These two clusters were designated mvh due to the homology of their small subunits to those of a group of cytoplasmic methanogenic methyl viologen-reducing (Mvh) hydrogenases (Halboth & Klein, 1992Down; Reeve et al., 1989Down), which belong to Group 3c of the [NiFe]-hydrogenase classification system of Vignais et al. (2001)Down. Phylogenetic analysis of the small subunits of the Group 3 hydrogenases revealed that the two Geobacter small (MvhS) subunits clustered with those of the methanogenic Mvh hydrogenases (Fig. 2bUp). The two Geobacter MvhS subunits are 46–51 % similar to those of the methanogenic Mvh hydrogenases and contain all 12 of the iron-sulfur cluster ligating cysteine residues found in methanogenic Mvh small subunits (Bingemann & Klein, 2000Down; Halboth & Klein, 1992Down; Reeve et al., 1989Down) at analogous positions.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3. Structure and features of representative clusters encoding methyl viologen-reducing (Mvh) hydrogenases and heterodisulfide reductases (Hdr). (a) Methanogenic mvh and hdr clusters: Methanothermobacter thermoautotrophicus (Hedderich et al., 1994Down; Reeve et al., 1989Down), Methanocaldococcus jannaschii (NP_248184–NP_248188; P81335 (vhuU); Q58513–Q58592; Q58273–Q58274) and Methanopyrus kandleri (AAM10485ndash;AAM10482; AAM01787ndash;AAM01788). (b) G. sulfurreducens mvh cluster (AAR35789ndash;AAR35796). (c) G. sulfurreducens hdr cluster (AAR33427ndash;AAR33420) and homologous Desulfovibrio desulfuricans (ZP_00128694–ZP_00128689) and C. tepidum (AAM72475ndash;AAM72480) hdr clusters. Hydrogenase large and small subunits are crosshatched. Homologues of the subunits of the hydrogen-dependent heterodisulfide reductase complex purified from Methanothermobacter marburgensis (Stojanowic et al., 2003Down) are shaded in grey. Hdr motifs were identified according to Hedderich et al. (1994)Down and Stojanowic et al. (2003)Down. Mvh hydrogenase domains and motifs were identified according to Halboth & Klein (1992)Down, Reeve et al. (1989)Down and Vignais et al. (2001)Down. The maturation protease domain, NAD(P)-binding site and FAD-binding site were identified using the Pfam protein families database (Bateman et al., 2002Down).

 
The relationship between the large subunits encoded in the Geobacter mvh clusters and those of the methanogenic Mvh hydrogenases is less clear. The Geobacter Mvh large subunits (MvhL) are approximately 50 % similar to the large subunits of two distinct subclasses of Group 3 hydrogenases (Vignais et al., 2001Down), the Mvh hydrogenases (Group 3c, Fig. 2bUp, cluster ii) and the bidirectional, NADH-reducing hydrogenases (Group 3d, Fig. 2bUp, cluster iii). Phylogenetic analysis of the two Geobacter MvhL subunits confirmed this ambiguity (data not shown). The two Geobacter MvhL subunits did not group with either of these subclasses, but were part of a larger cluster that encompassed both the Group 3c and Group 3d large subunits.

Although the structure and content of methanogenic Mvh hydrogenase-encoding clusters varies, the content and organization of the two Geobacter mvh clusters (Fig. 3bUp) is quite different from that of any of the methanogenic Mvh hydrogenase-encoding clusters (Fig. 3aUp). Only four of the eight genes in the Geobacter mvh clusters encode products with counterparts among the methanogenic Mvh hydrogenase-encoding clusters or other hydrogenase operons. These include the hydrogenase large and small subunits (MvhL and MvhS), the maturation protease (MvhP), and a ferredoxin domain-containing subunit (MvhF) that is considerably shorter than its methanogenic counterparts (MvhB, VhcB and VhuB), which contain six such domains (Halboth & Klein, 1992Down; Reeve et al., 1989Down). MvhQ and MvhV contain domains found in proteins involved in signal transduction during chemotaxis in other bacteria. MvhQ contains a cheW-like domain (pfam01584, Bateman et al., 2002Down), and MvhV contains both a HAMP domain (IPR000566, Zdobnov & Apweiler, 2001Down) and a methyl-accepting chemotaxis protein-signalling domain (pfam00015, Bateman et al., 2002Down). The remaining two ORFs, mvhR and mvhU, code for hypothetical proteins with no homologues in the NCBI database.

The physiological significance of the presence of the mvh clusters in G. metallireducens and G. sulfurreducens is unclear. In methanogens, the Mvh hydrogenases are hypothesized to donate electrons to the heterodisulfide reductase (Hdr) during growth on carbon dioxide and hydrogen (Stojanowic et al., 2003Down). This hypothesis is based upon genetic (Sorgenfrei et al., 1993Down) and biochemical studies (Stojanowic et al., 2003Down) and the presence of putative operons containing genes that encode both Mvh hydrogenase subunits and heterodisulfide reductase subunits in the genomes of two methanogens, Methanocaldococcus jannaschii and Methanopyrus kandleri (Fig. 3aUp). The heterodisulfide reductase of methanogens catalyses a critical step in energy generation via methanogenesis, the reduction of a heterodisulfide of coenzyme M and coenzyme B (Thauer, 1998Down). In Methanothermobacter marburgensis, the Mvh hydrogenase can be purified as part of a stable complex that can catalyse the hydrogen-dependent reduction of heterodisulfide (Stojanowic et al., 2003Down).

Surprisingly, the genomes of both G. metallireducens and G. sulfurreducens do contain clusters encoding proteins with homology to methanogenic heterodisulfide reductases (Fig. 3cUp). However, the two Geobacter heterodisulfide reductase-encoding (hdr) clusters are most homologous to clusters found in the genomes of two Desulfovibrio species, Desulfovibrio vulgaris (Heidelberg et al., 2004Down) and Desulfovibrio desulfuricans (www.jgi.doe.gov), and in the genome of Chlorobium tepidum (Eisen et al., 2002Down), an anaerobic photosynthetic green sulfur bacterium (Fig. 3cUp). Only three of the seven genes in the G. sulfurreducens hdr cluster, hdrA, hdrB and mvhD, encode products that are homologous (48–65 % similar) to the subunits of the Mvh hydrogenase/heterodisulfide reductase complex isolated from Methanothermobacter marburgensis. These subunits contain all of the conserved domains identified in the subunits of the methanogenic heterodisulfide reductases (Fig. 3aUp versus c), but are more similar to their C. tepidum and Desulfovibrio orthologues (57–74 and 58–68 % similar, respectively). Orthologues (46–73 % similar) of the remaining four proteins encoded in the G. sulfurreducens hdr cluster (HdrC, HdrD, HdrE and HdrF) are found only in the hdr clusters of C. tepidum and the two Desulfovibrio species (Fig. 3cUp). HdrC, HdrD and HdrE are iron-sulfur cluster-containing proteins, whereas HdrF contains a diaphorase domain (pfam00175, Bateman et al., 2002Down) found in NAD(P)H-dependent ferredoxin and flavodoxin oxidoreductases and in the {gamma} subunits of the sulfhydrogenases (Fig. 3cUp).

Unlike the G. sulfurreducens genome, the genomes of C. tepidum, Desulfovibrio vulgaris and Desulfovibrio desulfuricans do not contain Mvh hydrogenase-encoding operons. The genomes of Desulfovibrio vulgaris (Heidelberg et al., 2004Down) and Desulfovibrio desulfuricans (www.jgi.doe.gov) lack cytoplasmic Group 3 [NiFe]-hydrogenases altogether, and the single hydrogenase of C. tepidum (Eisen et al., 2002Down) clearly clusters with the sulfhydrogenases and not with the Mvh hydrogenases (Fig. 2bUp). The fact that the hdr cluster of G. sulfurreducens is most closely related to clusters found in the genomes of organisms devoid of Mvh hydrogenases suggests that a functional coupling between the Mvh hydrogenase and the heterodisulfide reductase of G. sulfurreducens is unlikely.

The Ehr clusters
G. sulfurreducens has been shown to produce hydrogen during growth on acetate and fumarate (Cord-Ruwisch et al., 1998Down). In many Archaea and Proteobacteria, hydrogen evolution is catalysed by the Ech hydrogenases (Hedderich, 2004Down; Vignais et al., 2001Down), a phylogenetically distinct family of membrane-bound, cytoplasmically oriented [NiFe]-hydrogenases (Group 4 in the classification system of Vignais et al., 2001Down). Many, but not all of the characterized Ech hydrogenases can generate energy by coupling the oxidation of carbon compounds to the reduction of protons (Hedderich, 2004Down; Vignais et al., 2001Down). For example, hydrogenase 3 of E. coli is a component of a formate hydrogen lyase complex, which couples the oxidation of formate, a fermentation by-product, to the production of hydrogen without energy generation (Bock & Sawers, 1996Down). The Ech hydrogenase of Pyrococcus furiosus, Mbh, in contrast, has been shown to generate proton-motive force by coupling the oxidation of reduced ferredoxin, generated during the oxidative metabolism of carbon compounds, to the reduction of protons (Sapra et al., 2000Down, 2003Down). Recently, the Ech hydrogenase of Methanosarcina barkeri (Kunkel et al., 1998Down; Meuer et al., 1999Down, 2002Down) has been shown to be bidirectional, participating in energy generation by transferring electrons from ferredoxin to protons, and, under autotrophic growth conditions, harvesting the energy of the electrochemical gradient to drive the reduction of ferredoxin using hydrogen as an electron donor (Meuer et al., 2002Down).

The Ech hydrogenases are multimeric membrane-bound complexes with a minimum of six subunits, all of which have homology to subunits of respiratory complex I (Hedderich, 2004Down). When the G. sulfurreducens genome was searched for the presence of Ech hydrogenases, a cluster that encoded six subunits with homology to both the Ech hydrogenases and subunits of complex I was identified (Fig. 4aDown). However, as described below, a detailed analysis of this cluster revealed that it does not encode a [NiFe]-hydrogenase. This cluster was therefore designated ehr, Ech-hydrogenase-related.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 4. Structure and features of ech and ehr clusters. (a) Comparison of Ech hydrogenase-encoding operons to representative ehr clusters, including that of G. sulfurreducens. Motifs and domains were identified according to Andrews et al. (1997)Down, Vignais et al. (2001)Down and Volbeda et al. (1995)Down. Putative transmembrane helices were identified using THMM version 2.0 (www.cbs.dtu.dk/services/TMHMM). References or accession numbers for the various ech and ehr clusters are as follows: E. coli hyf (Andrews et al., 1997Down), Methanosarcina barkeri ech (Kunkel et al., 1998Down), P. furiosus mbh (Sapra et al., 2000Down), Desulfovibrio gigas (Rodrigues et al., 2003Down), G. sulfurreducens ehr (AAR34069ndash;AAR34074), Methanosarcina mazei ehr (AAM30755ndash;AAM30760) and B. japonicum ehr (BAC51604ndash;BAC51609). (b) Phylogenetic tree of Ech hydrogenase and Ehr complex small subunits. Distances and branching orders were determined for protein sequences by the neighbour-joining method (Saitou & Nei, 1987Down) using the BioNJ algorithm (Gascuel, 1997Down). Small subunits deriving from the Geobacteraceae are indicated in bold type. *, Gene symbol assigned by the author. Accession numbers are provided in parentheses, except for Desulfuromonas palmitatis EhrS, which was identified as described in Methods. Despite variations in gene symbol and annotation, all sequences in the group designated Ehr derive from clusters similar to the G. sulfurreducens ehr cluster which contain large subunits lacking the critical CXXC and CXSCTD/ER motifs found at the N- and C-termini of Ech hydrogenase large subunits. Conversely, all of the sequences in groups designated Ech, despite variations in gene name and annotation, derive from clusters containing large subunits containing the critical N- and C-terminal NiFe centre-binding motifs.

 
Comparison of the various G. sulfurreducens Ehr subunits to those of a variety of characterized Ech hydrogenases (Fig. 4aUp) revealed that they were most similar to those of E. coli hydrogenase IV (HYD4), which is encoded by the hyf operon (Andrews et al., 1997Down). At present, the physiological role of E. coli HYD4 is controversial. Some studies suggest that HYD4 plays a role in generating energy from formate oxidation under selected growth conditions (Bagramyan et al., 2002Down, 2003Down). However, others report insignificant levels of hydrogenase IV expression in wild-type cells and a failure to correlate hydrogenase IV expression with the presence of hydrogenase activity (Self et al., 2004Down; Skibinski et al., 2002Down).

The G. sulfurreducens ehrA and ehrB genes encode integral membrane proteins that are homologous to chains L and H of complex I as well as to subunits found in all of the characterized Ech hydrogenases (Hedderich, 2004Down). G. sulfurreducens EhrA and EhrB are 51 % and 48 % similar to HyfB and HyfC of E. coli HYD4, respectively, but are only 35–39 % similar to corresponding subunits of the other Ech hydrogenases in Fig. 4(a)Up (EchA and EchB, and Mbh8 and Mbh13). The G. sulfurreducens EhrC and EhrD subunits, which are also integral membrane proteins, are 45 and 51 % similar to HyfE and HyfF of E. coli HYD4, respectively, but do not have orthologues among the subunits of the other characterized Ech hydrogenases (Fig. 4aUp). The degree of conservation of the fifth G. sulfurreducens Ehr subunit (EhrL) to that of its corresponding Ech counterparts is significantly lower. EhrL is only 37 % similar to the large subunit of E. coli HYD4 (HyfG) and ~30 % similar to the other Ech hydrogenase large subunits in Fig. 4(a)Up (EchE and Mbh12). Alignment of EhrL to various Ech hydrogenase large subunits revealed that it lacked critical NiFe centre-binding cysteine residues at its N- and C-termini (Fig. 5Down). This indicates that the G. sulfurreducens Ehr cluster does not encode a [NiFe]-hydrogenase.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 5. Alignment of the N- and C-termini of representative Ech and Ehr large subunits. Strictly conserved residues are indicated by an asterisk. Indentical residues are indicated in black and similar residues are shaded in grey. The positions of L1 and L2 NiFe centre-binding domains of the Ech hydrogenases are indicated by a bracket below the alignment. Accession numbers or references for the various subunits can be found in the legend for Fig. 4Up.

 
BLAST searches of the NCBI database revealed the presence of EhrL subunits similar to G. sulfurreducens EhrL in a variety of prokaryotes, including the mycobacteria, the firmicutes, the {alpha}- and {beta}-Proteobacteria, the Methanosarcinales and at least two other Geobacteraceae, G. metallireducens and Desulfuromonas palmitatis. Although cysteine residues that could potentially substitute for the missing NiFe centre-binding residues are frequently present at the N- and C-termini of these EhrL subunits, their position and spacing is not conserved, suggesting that they are not critical to the catalytic activity of these subunits. Examination of the genes surrounding these EhrL subunits reveals that they, too, are encoded in gene clusters which are similar in content and organization to those of the G. sulfurreducens ehr cluster (Fig. 4aUp). The G. sulfurreducens Ehr subunits are 45–57 % similar to their B. japonicum and Methanosarcina mazei counterparts, with the exception of EhrS, for which the degree of similarity is lower. This is due to the fact that the three Geobacteraceae EhrS subunits have an N-terminal extension, which is not found in any of the other EhrS subunits examined. The N-terminal extensions of the three Geobacteraceae EhrS subunits appear to be related to the N-termini of the iron-sulfur cluster-containing subunits of the Ech hydrogenases (HyfF, EchF and Mbh14 in Fig. 4aUp) and contain conserved cysteine residues that may ligate an iron-sulfur cluster. The C-termini of the Geobacteraceae EhrS subunits contain the four conserved cysteine residues which serve as ligands for the single [4Fe-4S] iron-sulfur cluster of the Ech hydrogenase small subunits. G. sulfurreducens EhrS is 35–52 % and 49–56 % similar to the Ech and Ehr small subunits shown in Fig. 4Up, respectively. Thus, the small subunit of Geobacteraceae ehr clusters appears to be a hybrid protein containing elements of two Ech hydrogenase subunits, the hydrogenase small subunit and the iron-sulfur cluster-binding subunit.

Phylogenetic analysis was performed to gain insight into the relationship of the complexes encoded by the ehr clusters to the Ech hydrogenases (Fig. 4bUp). Not surprisingly, the various EhrS (Fig. 4bUp) and EhrL subunits (data not shown) grouped together in a separate cluster [Fig. 4b(v)Up]. As indicated in Fig. 4(b)Up, EhrS and EhrL subunits were often misannotated as homologues of HycC and HycG, the large and small subunits of E. coli hydrogenase 3 (Sauter et al., 1992Down).

Unlike the EhrL and EhrS subunits, the large and small subunits of the Ech hydrogenases failed to form a cohesive group (Fig. 4bUp) and were divided among at least four clades. One of these clades (iv) contained the small subunit of E. coli hydrogenase 3, which is part of a formate hydrogen lyase. Interestingly, this formate hydrogen lyase-associated clade grouped with the EhrS clade and was clearly separated from the clusters containing the remaining Ech hydrogenase subunits (i–iii). This finding suggests that there may be an evolutionary link between the formate hydrogen lyase-associated Ech hydrogenases and the electron transport complexes encoded in the ehr clusters.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hydrogenase diversity among the {delta}-Proteobacteria
One of the surprising results of this study is that none of the four [NiFe]-hydrogenases identified in the genome of G. sulfurreducens groups with those of Desulfovibrio species, its closest hydrogenase-expressing relatives outside of the Geobacteraceae according to phylogenetic analysis based on the 16S rRNA gene. Thus, there appears to be high degree of diversity among genes encoding proteins involved in hydrogen metabolism in the {delta}-Proteobacteria. Comparison of the hydrogenase content of G. sulfurreducens to that of two Desulfovibrio species (Table 1Down) also indicates that there are likely to be significant differences in hydrogen metabolism between the Geobacteraceae and the Desulfovibrionaceae. For example, the genome of G. sulfurreducens is devoid of [Fe]-hydrogenases, whereas the genomes of at least three Desulfovibrio species, Desulfovibrio vulgaris, Desulfovibrio desulfuricans and Desulfovibrio fructosovorans, contain [Fe]-only hydrogenases (Fauque et al., 1988Down; Vignais et al., 2001Down). Periplasmic heterodimeric [NiFeSe]-hydrogenases, which are also commonly found in Desulfovibrio species (Fauque et al., 1988Down; Vignais et al., 2001Down), are also not present in the G. sulfurreducens genome. Likewise, the genome of G. sulfurreducens lacks Ech hydrogenases, whereas Ech hydrogenases are present in the genomes of both Desulfovibrio vulgaris (Heidelberg et al., 2004Down) and Desulfovibrio gigas (Rodrigues et al., 2003Down). Currently, the genome of G. metallireducens also appears to lack all three of these types of hydrogenases (Table 1Down). The genomes of Desulfovibrio species and G. sulfurreducens both contain clusters encoding [NiFe]-hydrogenases with periplasmic active sites. However, those of Desulfovibrio are heterodimeric and only loosely associated with the inner membrane (Fauque et al., 1988Down; Vignais et al., 2001Down), whereas those of G. sulfurreducens have integral membrane subunits, and can be either heterotrimeric or heterotetrameric. Finally, the genome of G. sulfurreducens contains two hydrogenases, Hox and Mvh, which do not have close proteobacterial homologues and whose small subunits cluster with cyanobacterial and archaeal hydrogenases, respectively.


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of the hydrogenase content of the genomes of G. sulfurreducens (Methé et al., 2003Down) and G. metallireducens (www.jgi.doe.gov) to that of the genomes of Desulfovibrio vulgaris str. Hildenborough (Heidelberg et al., 2004Down) and Desulfovibrio desulfuricans (www.jgi.doe.gov)

Each ‘+’ denotes a single copy of a particular hydrogenase.

 
Insights into G. sulfurreducens hydrogen metabolism
For two of the four G. sulfurreducens hydrogenases, Hya and Hyb, predictions based on genomic and phylogenetic studies can be combined with genetic data to yield insights into physiological function. The clearest case is Hyb. Both genetic and genomic studies indicate that G. sulfurreducens Hyb functions as a respiratory-uptake hydrogenase. As indicated in this report, Hyb is clearly homologous to and groups with E. coli HYD2, a characterized respiratory-uptake hydrogenase (Laurinavichene & Tsygankov, 2001Down; Laurinavichene et al., 2002Down; Menon et al., 1994Down; Sargent et al., 1998Down). In addition, Hyb is the only hydrogenase present in the G. sulfurreducens genome that is not present in the genome of G. metallireducens, a closely related species (Holmes et al., 2004bDown) that is unable to grow utilizing hydrogen as an electron donor (Lovley et al., 1993Down). This suggests that it is the presence of Hyb that permits G. sulfurreducens to exploit hydrogen as an electron donor. In genetic studies, Hyb was found to be required for growth of G. sulfurreducens with hydrogen as the electron donor and three distinct electron acceptors: fumarate, anthraquinone disulfonate (AQDS) and Fe(III) (Coppi et al., 2004Down). In addition, microarray analysis indicates that Hyb is the only hydrogenase that is induced during growth under nitrogen-fixing conditions, suggesting that Hyb may be involved in generating energy from hydrogen produced during nitrogen fixation (Methé et al., 2005Down).

In the case of Hya, both genetic and genomic data indicate that Hya may not play a direct role in hydrogen-dependent growth. Genetic studies performed on G. sulfurreducens suggested that Hya was not required for hydrogen-dependent growth with fumarate, AQDS or Fe(III) citrate serving as the electron acceptor (Coppi et al., 2004Down). Three lines of comparative genomic evidence also support the hypothesis that the Hya hydrogenases of the Geobacteraceae are not directly involved in generating energy from hydrogen oxidation. Hya-encoding clusters are present in two species of Geobacteraceae that cannot grow utilizing hydrogen as an electron donor, G. metallireducens (Lovley et al., 1993Down) and Desulfuromonas palmitatis (Coates et al., 1995Down). Furthermore, the Geobacteraceae Hya hydrogenases do not cluster with any of the characterized heterotrimeric respiratory-uptake hydrogenases. These include those of Wol. succinogenes (Dross et al., 1992Down), Wau. eutropha (Kortlüke et al., 1992Down; Schwartz et al., 2003Down) and three species of nitrogen-fixing Proteobacteria: R. capsulatus (Cauvin et al., 1991Down; Leclerc et al., 1988Down; Richaud et al., 1990Down), B. japonicum (Moshiri et al., 1983Down; Sayavedra-Soto et al., 1988Down) and A. vinelandii (Menon et al., 1992Down). Finally, the small subunits of the three Geobacteraceae Hya hydrogenases contain a substitution in a cysteine residue critical for iron-sulfur cluster ligation (Fig. 1aUp). The presence of this uncommon substitution suggests that the catalytic activity of Hya may differ from that of the characterized Group 1 heterotrimeric [NiFe]-hydrogenases.

Only phylogenetic and genomic data are available for the remaining two hydrogenases of G. sulfurreducens, Hox and Mvh. Surprisingly, clusters encoding both of these hydrogenases are present in the genome of G. metallireducens, which cannot grow with hydrogen as the sole electron donor. This suggests that Hox and Mvh may not play a direct role in hydrogen-dependent growth. Hox appears to be a bidirectional, NAD-reducing hydrogenase related to those of the cyanobacteria, which have a high affinity for hydrogen (Tamagnini et al., 2002Down). However, the physiological function of the cyanobacterial NAD-reducing hydrogenases is not well understood (Schutz et al., 2004Down; Tamagnini et al., 2002Down). In G. sulfurreducens, Hox may be involved in regulating intracellular NADH levels, converting excess NADH-reducing equivalents to hydrogen and utilizing hydrogen to reduce NAD during conditions such as hydrogen-dependent growth, when flux through the TCA cycle and, as a consequence, intracellular NADH concentrations are comparatively low.

It is unclear what the physiological function of the G. sulfurreducens Mvh hydrogenase might be. The small subunits of G metallireducens and G. sulfurreducens Mvh clearly group with those of the methanogenic methyl viologen-reducing hydrogenases (Mvh). These hydrogenases are purported to donate electrons to the heterodisulfide reductase (Hdr), which catalyses the energy-conserving step of methanogenesis (Stojanowic et al., 2003Down; Thauer, 1998Down). Both the G. metallireducens and G. sulfurreducens genomes contain clusters encoding heterodisulfide reductase-like complexes. However, there is little evidence that the Geobacter Mvh hydrogenases and heterodisulfide reductases form a functional couple. The Hdr-encoding cluster of G. sulfurreducens is most similar in content and structure to clusters found in the genomes of C. tepidum and two Desulfovibrio species, all three of which appear to be devoid of clusters encoding Mvh hydrogenases. Furthermore, many of the ORFs in the Geobacter mvh clusters have no counterparts in methanogenic operons. In addition, the large subunit of Geobacter Mvh hydrogenases, unlike the small subunit, does not cluster with those of the methanogenic Mvh hydrogenases. Thus, the physiological role of the Geobacter Mvh hydrogenases is likely to be distinct from that of the methanogenic Mvh hydrogenases.

The presence of four distinct hydrogenases in the genome of G. sulfurreducens suggests that some form of hydrogen cycling may be occurring in this organism. In fact, G. sulfurreducens has been shown to both produce and consume hydrogen (Caccavo et al., 1994Down; Coppi et al., 2004Down; Cord-Ruwisch et al., 1998Down). Given the absence of an Ech hydrogenase-encoding cluster in the genome and genetic evidence that Hyb is a respiratory-uptake hydrogenase (Coppi et al., 2004Down), it is likely that Hya, Mvh and/or Hox is involved in hydrogen production. Hox could potentially play a role in converting excess NADH-reducing equivalents to hydrogen. Mvh might play a role in the conversion of some other form of cytoplasmic reducing power to and from hydrogen. Finally, since Hya has an integral membrane b-cytochrome subunit, it is possible that Hya could be involved in converting excess reducing equivalents in the menaquinone pool to hydrogen. Genetic and comparative genomic data suggest that Hya should be functional, in spite of the presence of the CXXC to CXXD substitution, and may possibly be bidirectional or hydrogen evolving. Hydrogenase III of Aquifex aeolicus, a cytoplasmic hydrogenase of unknown function, also appears to lack a cysteine residue at the same position but nevertheless retains the ability to catalyse high rates of hydrogen oxidation in vitro (Brugna-Guiral et al., 2003Down). More importantly, the CXXC to CXXD substitution is also found in the small subunit of the bidirectional F420-reducing hydrogenase (Frh) of Methanothermobacter thermoautotrophicus (Alex et al., 1990Down). Furthermore, when an analogous cysteine residue was mutated to serine in the small subunit of the respiratory-uptake hydrogenase of A. vinelandii, the enzyme lost essentially all hydrogen-oxidation activity but retained a significant amount (20 % of wild-type) of hydrogen-evolution activity (Sayavedra-Soto & Arp, 1993Down). Additional study will be required to identify the hydrogenases involved in hydrogen evolution by G. sulfurreducens.

The ehr clusters
Another important contribution of this work is the discovery of ehr clusters in a variety of Bacteria and Archaea. In many genomes available in the NCBI database, Ehr subunits are incorrectly annotated as homologues of the subunits of E. coli hydrogenases 3 and 4. Given the absence of the conserved NiFe centre-binding cysteine residues in the EhrL subunits, it is very unlikely that the complexes encoded by the ehr clusters function as proton-reducing [NiFe]-hydrogenases. However, the similarity of the various Ehr subunits to those of Complex I and the Ech hydrogenases subunits suggests that they do encode some sort of electron-transport complex.

The physiological function of the Ehr complexes has never been investigated. The phylogenetic analysis shown in Fig. 4(b)Up suggests an evolutionary link between the Ehr complexes and Ech hydrogenases that are associated with formate hydrogen lyases. The genome of G. sulfurreducens contains a cluster encoding a periplasmically oriented membrane-bound formate dehydrogenase (Methé et al., 2003Down). The {alpha} and {beta} subunits of this formate dehydrogenase are 40–50 % similar to those of the nitrate-inducible formate dehydrogenase of E. coli (Fdh-N), which is required for growth on formate and nitrate but has never been demonstrated to be part of a formate hydrogen lyase (Berg & Stewart, 1990Down; Darwin et al., 1993Down). This suggests that, at least in G. sulfurreducens, the formate dehydrogenase and the Ehr complex may not be functionally linked.

Genetic and biochemical experimentation will be required to elucidate the physiological function of the G. sulfurreducens Ehr cluster. The investigation of the physiological role of this and other members of the Ehr family of electron transport complexes should yield interesting discoveries.


    ACKNOWLEDGEMENTS
 
This work was supported by the Office of Science (BER), US Department of Energy, grant no. DE-FC02-02ER63446. I would like to thank Kathleen O'Neill and Dawn Holmes for their invaluable help with the phylogenetic analyses presented in this paper. I would also like to acknowledge Jessica Butler, Ching Leang, Dawn Holmes, Helen Vrionis and Jeffrey Blanchard for their excellent editorial assistance. Finally, I would like to thank Dr Derek Lovley for supporting and encouraging this work.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION