|
|
||||||||
1 Institut für Molekulare Enzymtechnologie, Heinrich-Heine-Universität Düsseldorf, Forschungszentrum Juelich, D-52426 Juelich, Germany
2 Lehrstuhl für Biologie der Mikroorganismen, Ruhr-Universität Bochum, D-44801 Bochum, Germany
3 Laboratorium voor Ultrastructuur, Vlaams Interuniversitair Instituut voor Biotechnologie and Vrije Universiteit Brussel, B-1050 Brussel, Belgium
4 Biofilm Centre, Abteilung Aquatische Mikrobiologie, Universität Duisburg-Essen, D-47057 Duisburg, Germany
Correspondence
Karl-Erich Jaeger
karl-erich.jaeger{at}fz-juelich.de
| ABSTRACT |
|---|
|
|
|---|
-L-fucose, whereas treatment with D-galactose had no effect. In contrast, a LecB protein carrying the mutation D104A, which results in a defective sugar-binding site, was no longer detectable in the membrane fraction, suggesting that LecB binds to specific carbohydrate ligands located at the bacterial cell surface. Staining of biofilm cells using fluorescently labelled LecB confirmed the presence of these ligands.
-L-fucose| INTRODUCTION |
|---|
|
|
|---|
Pseudomonas aeruginosa, an important opportunistic pathogen associated with chronic airway infections, synthesizes two lectins, LecA and LecB (formerly respectively named PA-IL and PA-IIL) (Gilboa-Garber, 1982
). Strains of P. aeruginosa that produce high levels of these virulence factors exhibit an increased virulence potential (Gilboa-Garber & Garber, 1992
). The lectins play a prominent role in human infections, as it was demonstrated that a P. aeruginosa-induced otitis externa diffusa (Steuer et al., 1993
) as well as respiratory tract infections (von Bismarck et al., 2001
) could successfully be treated by application of a solution containing LecA- and LecB-specific sugars. The sugar solutions presumably prevented lectin-mediated bacterial adhesion to the corresponding host tissue. The expression of lectin genes in P. aeruginosa is coordinately regulated with certain other virulence factors and controlled via quorum sensing and by the alternative sigma factor RpoS (Winzer et al., 2000
).
The galactophilic LecA has been characterized in great detail over the last 30 years. It consists of four 12·75 kDa subunits (Gilboa-Garber, 1972
; Avichezer et al., 1992
) and has been shown to cause cytotoxic effects on respiratory epithelial cells by decreasing their growth rate, thus contributing to respiratory epithelial injury during P. aeruginosa infection (Bajolet-Laudinat et al., 1994
). In addition, it was demonstrated that LecA induces a permeability defect in the intestinal epithelium, resulting in increased absorption of exotoxin A, an important extracellular virulence factor of P. aeruginosa (Laughlin et al., 2000
).
LecB consists of four 11·73 kDa subunits, each exhibiting a high specificity for L-fucose and its derivatives (Gilboa-Garber et al., 2000
; Garber et al., 1987
) and also for D-mannose, with lower affinity. Its crystal structure was determined recently (Mitchell et al., 2002
, 2005
; Loris et al., 2003
). In cystic fibrosis (CF), increased terminal fucosylation of airway epithelial glycoproteins is found, as well as a higher percentage of sialylated and sulfated oligosaccharides in Lewis A oligosaccharide side chains, which presumably represent preferential ligands for LecB (Mitchell et al., 2002
), which thereby contributes significantly to chronic respiratory Pseudomonas infections (Scanlin & Glick, 2001
). In addition, LecB decreases in vitro the ciliary beat frequency of the airway epithelium, hence inhibiting an important defence mechanism of the human lung (Adam et al., 1997a
, b
).
Both P. aeruginosa lectins were shown to be located mainly in the cytoplasm of planktonic cells (Glick & Garber, 1983
). These findings make it difficult to explain the lectin-mediated cytotoxic and adhesive properties. Recently, it was suggested that LecB is exposed on the surface of sessile Pseudomonas cells, since the addition of L-fucose-branched chitosan leads to specific cell aggregation (Morimoto et al., 2001
).
Biofilms are accumulations of micro-organisms at solidliquid or solidair interfaces, where the cells are embedded in a matrix of self-produced extracellular polymeric substances, with polysaccharides and proteins as characteristic components (Wingender et al., 1999
). Exopolysaccharides are considered as key components which determine the structural and functional integrity of microbial biofilm aggregates by the formation of a three-dimensional, gel-like, highly hydrated and locally charged biofilm matrix, in which the micro-organisms are immobilized. Also, binding of biofilm cells (cohesion) and anchoring of biofilms to the substratum (adhesion) are mediated by exopolysaccharides. Consequently, extracellular proteins with lectin-like functions may contribute to polymer network formation in biofilms (Higgins & Novak, 1997
; Imberty et al., 2004
). The formation of P. aeruginosa biofilms on tissues of infected patients as well as on medical devices was recently shown to be responsible for the inherent resistance of the bacterium to certain antibiotics and other various antimicrobial agents (Costerton et al., 1999
; Stewart & Costerton, 2001
). Since cell-surface-exposed oligosaccharide receptors on eukaryotic host cells are ubiquitous in nature, it is reasonable to assume that both lectins are involved in the attachment of cells to biotic surfaces. Moreover, lectin-mediated cellcell interactions within a given bacterial population may be involved in the development and maintenance of biofilms, thereby determining the ability of P. aeruginosa to colonize biotic and abiotic surfaces and to persist in the biofilm mode of growth (Parsek & Greenberg, 2000
; Imberty et al., 2004
).
In this paper, we report on the role of LecB in biofilm formation and its cellular localization in planktonic and sessile P. aeruginosa cells. Confocal laser scanning microscopy (CLSM) was used to monitor biofilm formation of a LecB-deficient mutant strain and the localization of LecB in sessile cells was investigated by fractionation of bacterial cells grown as a biofilm and determination of LecB localization in the different cellular compartments using a LecB-specific polyclonal antiserum. The interaction of LecB with the outer membrane of P. aeruginosa was investigated by constructing a LecB-mutant defective in sugar binding as suggested by analysis of the LecB crystal structure we have recently solved (Loris et al., 2003
). The presence of putative ligands on the surface of biofilm cells was visualized by cell staining using fluorescently labelled LecB.
| METHODS |
|---|
|
|
|---|
was used for cloning experiments and E. coli BL21(DE3) as a heterologous expression host for plasmid-encoded LecB. E. coli S17-1 was used for conjugal transfer.
|
Cultivation of biofilms.
Biofilms were grown under static condition on glass slides. Fifteen millilitres nutrient broth (NB) [8 g nutrient broth (Oxoid); 4 g NaCl l1] in a sterile Petri dish was inoculated to an OD580 of 0·05 from overnight cultures grown in NB, glass slides were submerged and the cultures were incubated for 48 or 72 h at 30 °C. Prior to CLSM analysis, glass slides were rinsed with 2 ml 0·14 M NaCl to remove unadsorbed cells. For staining of P. aeruginosa PAO1 cells with fluorescently labelled LecB, biofilms were grown on membrane filters (Strathmann et al., 2002
). Bacteria were grown for 24 h at 37 °C on Pseudomonas isolation agar (PIA; Difco) containing 2 % glycerol. Single colonies were suspended in 0·14 M NaCl to a concentration of approximately 106 cells ml1. Ten millilitres of this suspension was vacuum-filtered onto 25 mm black polycarbonate filters (0·4 µm pore size; Millipore), which were then placed on the surface of PIA plates and cultivated for 24 h at 37 °C.
Lectin staining of biofilm cells.
The method was modified from Strathmann et al. (2002)
. Fifty microlitres of a solution containing 10 µg LecBYFP ml1 and 75 µM of the red fluorescent nucleic-acid-binding dye SYTO 62 (Molecular Probes) in 10 mM phosphate buffer, pH 7·5, was carefully applied directly on top of biofilms grown on membrane filters (Strathmann et al., 2002
). After incubation for 1 h in the dark at room temperature, excess staining solution was removed by three rinses with 1 ml phosphate buffer. Competitive inhibition of lectin binding was studied by preincubation of the LecBYFP staining solution with 100 mg L-fucose ml1 for 15 min at room temperature.
CLSM.
Biofilms were always grown in two independent experiments and at least three different sites were analysed by CLSM. Biofilms on glass slides were stained non-destructively with the green fluorescent nucleic-acid-binding dye SYTO 9 (Molecular Probes) as described by the manufacturer. Images of biofilms were obtained with a confocal laser scanning microscope (LSM 510; Zeiss) using an LD Achroplan 40x/0·60 NA (corr.) lens. Three-dimensional image stacks were recorded at 488 nm excitation wavelength using an LP 505 nm long-pass detection filter. Confocal images were recorded from at least three fields of view for each sample. The extent of the analysis was done in order to fulfil the minimum sampling area requirement as suggested by Korber et al. (1993)
for biofilm samples. The pinhole size was adjusted to equal 1·0 Airy unit. Image recording of CLSM optical thin sections was performed with the Zeiss LSM software (version 2.8). Biofilm mean thickness, surface coverage, roughness and biomass were determined by digital image processing using COMSTAT image-analysis software (Heydorn et al., 2000
). Images of the biofilms on polycarbonate filters were recorded by CLSM as described above at 488 nm excitation wavelength using a BP 505550 nm band-pass detection filter and at 633 nm excitation wavelength using an LP 650 nm long-pass detection filter for LecBYFP and SYTO 62, respectively.
DNA manipulation and PCR.
Recombinant DNA techniques were performed as described by Sambrook et al. (1989)
. DNA fragments were amplified by standard PCR methods. DNA-modifying enzymes (Fermentas) were used according to the manufacturer's instructions. Plasmid DNA was prepared as described by Birnboim & Doly (1979)
and by using the HiSpeed plasmid purification midi kit or, for genomic DNA from P. aeruginosa, the DNeasy Tissue kit (Qiagen).
Construction of a P. aeruginosa PAO1 lecB-deletion mutant.
A P. aeruginosa lecB mutant was constructed by PCR amplification of the regions located upstream and downstream of the lecB gene using primers L2USA (5'-GGGGTCTAGATTGAACCCAACGGGCAAATC)/L2USB (5'-GGGGATCCACGCGTGGTGTATCTCCACTGAATAC) and L2DSA (5'-GGGGATCCACGCGTGAGTTCGGAAGGGACGGGATG)/L2DSB (5'-GGGGAAGCTTCCGACCAGAACAATAACAAG). The resulting fragments were cloned into the XbaI/BamHI and BamHI/HindIII sites of plasmid pBCSK, giving pL2US and pL2DS, respectively. An
-gentamicin cassette was isolated as a 1·6 kb fragment by digesting the plasmid pBSL141 with MluI and subsequently cloned into the MluI site of pL2US resulting in pL2UG. This plasmid was digested with XbaI/BamHI and the resulting 2·1 kb fragment was cloned into pL2DS to give pUGD2. After restriction of this plasmid with XbaI/HindIII and blunt-ending with T4 polymerase, the resulting 2·6 kb fragment carried the
-gentamicin cassette located between the upstream and downstream sequences of lecB. This fragment was ligated into ScaI-digested pSUP202, resulting in the suicide vector pSUGD2. Replacement of the chromosomal copy of lecB by the
-gentamicin cassette was achieved after conjugation and resulted in P. aeruginosa lecB-mutant strain PATI2, as confirmed by PCR and Western-blotting. Finally, the
-gentamicin cassette was removed by digestion of plasmid pSUGD2 with MluI and religation resulting in pSUD2, which was subsequently transferred by conjugation into the
lecB : : Gmr strain of P. aeruginosa. Deletion of the
-gentamicin cassette was confirmed by PCR and Western blotting and the resulting mutant strain was named P. aeruginosa PATI4.
Cloning of lecB for localization studies.
The cellular distribution of LecB was studied using the lecB-negative strains P. aeruginosa PATI2 and PATI4, which were transformed with plasmid pBBC2 containing the lecB gene under transcriptional control of the lac promoter. This plasmid was constructed by digestion of plasmid pEC2 with SacI/XbaI. The resulting fragment consisting of the lecB gene and the ribosome-binding site of pET22b was cloned into the SacI/XbaI sites of pBBR1MCS giving pBBC2, which was transferred into P. aeruginosa PATI4 by conjugation.
Cloning of a yfp : : lecB fusion.
A 765 bp DNA fragment carrying the gene encoding YFP (a yellowish-green variant of the green fluorescent protein from Aequorea victoria) excluding the stop codon was amplified by PCR using plasmid pFF19-EYFP as the template with oligonucleotide primers YFPFusUp (5'-GCTCTAGAAAGAAGGAGATATATATATGGTGAGCAAGGGCGAGGAGCT) and YFPFusDWN (5'-GGAATTCCATATGCCATGGCTTGTACAGCTCGTCCATGC), introducing an XbaI, NdeI or NcoI site. Primer YFPFusUp contained the sequence encoding the ribosome-binding site (underlined). This fragment was digested with XbaI/NdeI and cloned into the lecB-carrying plasmid pEC2, resulting in plasmid pEYL2, which was transformed into E. coli BL21(DE3). The fusion protein expressed from this plasmid is referred to as LecBYFP.
Overexpression and purification of LecBYFP.
The overexpression and purification of LecBYFP was performed as described previously for the native LecB protein (Loris et al., 2003
).
Mutation of the sugar-binding site in LecB.
The lecB gene was amplified by PCR using the oligonucleotide primers LIINdeI (5'-AAAACATATGGCAACACAAGGAGTGTTCA) and LIIXch (5'-AAAAGGATCCCTAGCCGAGCGGCCAGTTGATCACGGCGGCGGCGGCGTTGTAGTCGTTGTC). The amplified DNA fragment was cloned into the NdeI/BamHI sites of pET22b, excised by digestion with SacI/XbaI and ligated into pBBR1MCS which had been digested with the same enzymes. The resulting plasmid pBBXCH2 was introduced into P. aeruginosa PATI4 by conjugation.
Fractionation of P. aeruginosa cells.
The method was modified from Witholt et al. (1976)
. P. aeruginosa PATI2 and PATI4, containing pBBC2 or pBBXCH2, was grown in NB medium or on NB agar plates at 37 °C for 48 h. Bacterial cells (1·2 mg dry weight) were washed off with 1 ml 0·14 M NaCl and then centrifuged at 3000 g; the supernatant was sterile-filtered and used to determine the content of LecB in the extracellular space. The cell pellet was carefully suspended in 240 µl 100 mM Tris/HCl, pH 8, containing 20 % (w/v) sucrose. After addition of 240 µl of the same buffer containing 5 mM EDTA and 20 µg lysozyme, the sample was incubated for 30 min at room temperature, spheroplasts were collected by centrifugation at 10 000 g for 20 min and the supernatant was used as the periplasmic fraction. Spheroplasts were disrupted by sonication (Sonifier W250; Branson) in 240 µl 100 mM Tris/HCl, pH 8. After centrifugation for 5 min at 5000 g to remove undisrupted cells and cell debris, the total membrane fraction was collected by centrifugation for 45 min at 13 000 g and the supernatant was used as the cytoplasmic fraction. An amount equivalent to an OD at 580 nm of 0·5 of each fraction was used for Western blotting.
Isolation of inner and outer membranes.
This was done as described by Wilhelm et al. (1999)
. P. aeruginosa PATI2 cells containing plasmid pBBC2 (50 mg dry weight) were isolated after growth for 48 h from NB agar plates by resuspension in 20 ml 0·14 M NaCl. Cells were incubated for 30 min at 37 °C with 1 mg lysozyme, disrupted using a glass bead mill followed by three freezing and thawing cycles and intact cells were separated from the cell extract by centrifugation at 5000 g for 10 min. The supernatant was centrifuged at 13 000 g for 1 h. The pellet, consisting of the total membrane fraction, was resuspended in 1 ml 10 mM Tris/HCl, pH 8, containing 1 mM EDTA and 30 % (w/v) sucrose, and layered on the top of a discontinuous gradient prepared by combining sucrose solutions of the following concentrations: 0·5 ml 60 %, 2·1 ml 55 %, 2·1 ml 50 %, 2·1 ml 45 %, 2·1 ml 40 % and 2·1 ml 35 % (w/v) sucrose in 10 mM Tris/HCl, pH 8, 1 mM EDTA. The gradient was centrifuged using an SW41 rotor in an L8-70 ultracentrifuge (Beckman) at 36 000 r.p.m. and 4 °C for 36 h, and 0·5 ml fractions were subsequently removed from the centrifugation tube.
Enzyme assays.
These were described by Wilhelm et al. (1999)
. NADH oxidase and esterase activities were determined as marker enzymes for the inner and outer membrane, respectively, by spectrophotometric determination of the absorbance decrease at 340 nm for NADH oxidase and the absorbance increase at 410 nm for esterase. For NADH oxidase, 900 µl reaction mixture (50 mM Tris/HCl, pH 7·5, 0·2 mM DTT, 0·12 mM NADH) was incubated for 5 min at 25 °C with 100 µl of each fraction. For esterase activity, 23·7 mg p-nitrophenyl caproate (pNPC; Sigma) was dissolved in 5 ml ethanol and added to 95 ml 100 mM potassium phosphate buffer, pH 7, supplemented with 10 mM MgSO4, to yield a final pNPC concentration of 1 mM. Aliquots (20 µl) of each fraction were added to 180 µl substrate solution in a microtitre plate, the samples were incubated for 10 min at 25 °C and the A410 was recorded.
The fractions with the highest NADH oxidase and esterase activities, which respectively represented the inner and outer membrane fractions, were pooled. For immunodetection of LecB, 100 µl of these fractions was diluted to 2 ml with 10 mM Tris/HCl, pH 8. Proteins were collected by precipitation with trichloroacetic acid (Sivaraman et al., 1997
).
Washing the outer membrane with solutions of different carbohydrates.
Proteins from 100 µl of the outer-membrane fraction were collected by centrifugation at 13 000 g for 1 h. The pellet was suspended in 100 µl 100 mM Tris/HCl, pH 8, containing 20 mM p-nitrophenyl
-L-fucose (pnpf; sigma) or 20 mm D-galactose (Sigma) as a negative control, and shaken gently for 1 h at 37 °C. After centrifugation of the samples, the proteins in pellets and supernatants were analysed by immunoblotting using LecB-specific antibodies.
Western blotting.
Prior to electrophoresis, samples were suspended in SDS-PAGE sample buffer, boiled for 5 min at 95 °C and loaded onto an SDS-16 % polyacrylamide gel followed by electrophoretic protein transfer at 0·3 A for 30 min to PVDF membranes. LecB was detected using the polyclonal antibody at a dilution of 1 : 20 000 in TBST (25 mM Tris/HCl, pH 8, 150 mM NaCl, 3 mM KCl, 0·2 % v/v Tween 20) followed by an anti-rabbit immunoglobulin Ghorseradish peroxidase conjugate (Bio-Rad) and developed with the ECL kit (Pharmacia).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
This study clearly demonstrates that the lectin LecB is an important factor in the development of biofilms by P. aeruginosa for the following reasons: (i) a LecB-deficient P. aeruginosa mutant strain was clearly impaired in the formation of biofilms and (ii) LecB has been shown to be localized mainly in the cytoplasm of planktonic cells (Glick & Garber, 1983
). This finding raises the question of how an internally localized lectin can contribute to the formation of a biofilm. Biofilm cells differ fundamentally from their planktonic counterparts in a variety of physiological aspects (Costerton et al., 1999
). Therefore, we decided to investigate the subcellular localization of LecB in planktonic and sessile cells. In contrast to previous observations (Glick & Garber, 1983
), our results showed that, in both cases, LecB was present in the outer membrane of P. aeruginosa, even though the protein lacks structural characteristics of outer-membrane proteins, e.g. a terminal F residue and typical
-barrel-forming structures (Mitchell et al., 2002
, 2005
; Loris et al., 2003
). The binding constants of LecB for L-fucose and D-mannose were determined to be 1·5x106 M1 and 3·1x102 M1, respectively (Garber et al., 1987
). Treatment of the outer-membrane fraction with pNPF, which has been shown to be bound by LecB with an even higher affinity than L-fucose itself (Garber et al., 1987
), caused the dissociation of LecB from the outer membrane. A mutation in the sugar-binding site of LecB resulted in a mutant LecB which no longer appeared in the membrane fraction. These results indicated that LecB is associated with the bacterial cell surface via binding to carbohydrate ligands. The presence of such putative LecB receptors on the surface of P. aeruginosa cells was demonstrated by specific cell staining using YFP-labelled LecB. As expected, this process could be inhibited by preincubation of the lectin with L-fucose. The carbohydrate ligands may reside on either lipopolysaccharide or glycosylated cell-surface proteins, which include P. aeruginosa pili and type A flagella (Brimer & Montie, 1998
; Castric et al., 2001
). Interestingly, O-antigenic oligosaccharides of different P. aeruginosa serotypes contain the
-L-fucose derivative
-L-N-acetyl fucosamine, which is also part of the trisaccharide which decorates the pili of the clinical P. aeruginosa isolate 1244 (DiGiandomenico et al., 2002
). Additionally, it was recently demonstrated that mannose is one of the primary constituents of the extracellular polysaccharide of biofilms formed by the typically non-mucoid strain P. aeruginosa PAO1 (Wozniak et al., 2003
). Furthermore, several other pathogenic bacteria are known to contain glycosylated cell-surface proteins, among them the Gram-positive organisms Streptococcus sanguinis (Erickson & Herzberg, 1993
) and Mycobacterium tuberculosis (Dobos et al., 1995
) and the Gram-negative Neisseria meningitidis, N. gonorrhoeae, Campylobacter jejuni, E. coli and Helicobacter pylori (Power & Jennings, 2003
). However, in most of these cases, the structures of the glycans are unknown, as are the physiological roles of the glycosylation of the proteins.
Surface-exposed LecB may mediate the adhesion of P. aeruginosa to receptors located on cells of either the same or different species, thus enabling the colonization of host tissues or the formation of mono- or multispecies biofilms. Several P. aeruginosa proteins, including pilus and flagellar proteins as well as the outer-membrane protein OprF, have previously been identified as adhesins, which may bind to receptors, e.g. those present on the respiratory epithelium, thus initiating bacterial adherence (Doig et al., 1990
; Arora et al., 1998
; Scharfman et al., 2001
; Azghani et al., 2002
). In an earlier report, it was shown that biotinylated LecB specifically binds to the surface of human nasal polyp explants (Adam et al., 1997a
). Interestingly, it was demonstrated that mucin from patients suffering from CF contains increased amounts of fucosylated glycoproteins (Shori et al., 2001
; Scanlin & Glick, 2001
), suggesting that surface-exposed LecB may bind to these glycoproteins and promote persistent infections with P. aeruginosa. This hypothesis is further substantiated by the recent finding that the upregulation of a Fuc(
1-2) fucosyltransferase was responsible for increased fucosylation of intestinal mucins from CF mice (Thomsson et al., 2002
). For CF, the membrane glycoproteins from respiratory epithelial cells expressing a mutated cftr gene were shown to be more fucosylated than those from cells expressing the wild-type gene (Rhim et al., 2001
). Therefore, LecB in particular may facilitate the attachment of P. aeruginosa to the CF airway epithelium. The successful treatment of a patient suffering from a Pseudomonas-induced respiratory tract infection with a solution containing LecA- and LecB-specific sugars (von Bismarck et al., 2001
) supports the hypothesis that LecB contributes to the development of chronic airway infections via binding to fucosylated glycoproteins of the mucin and/or the respiratory epithelium.
Interestingly, P. aeruginosa LecB does not contain any of the presently known secretion signals (Ma et al., 2003
). Thus, it is unlikely that it is secreted via the type I pathway or via the Sec or Tat pathway. In a previous report, it was suggested that cell lysis was responsible for release of LecB into the extracellular medium (Wentworth et al., 1991
). This hypothesis seems unlikely, as we have found that mutant LecB was produced in the cytoplasm in the same amount as the wild-type protein (see Fig. 5b
), but it was neither translocated into the outer membrane nor released into the extracellular space.
In conclusion, our findings support the notion that LecB may contribute to the pathogenicity of P. aeruginosa in CF in several different ways and therefore represents an interesting target for the development of anti-P. aeruginosa drugs.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adam, E. C., Schumacher, D. U. & Schumacher, U. (1997b). Cilia from a cystic fibrosis patient react to cilitoxic Pseudomonas aeruginosa II lectin in a similar manner to normal control cilia: a case report. J Laryngol Otol 111, 760762.[Medline]
Alexeyev, M. F., Shokolenko, I. N. & Croughan, T. P. (1995). Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vitro deletion/insertion mutagenesis. Gene 160, 6367.[CrossRef][Medline]
Arora, S. K., Ritchings, B. W., Almira, E. C., Lory, S. & Ramphal, R. (1998). The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect Immun 66, 10001007.
Avichezer, D., Katcoff, D. J., Garber, N. C. & Gilboa-Garber, N. (1992). Analysis of the amino acid sequence of the Pseudomonas aeruginosa galactophilic PA-I lectin. J Biol Chem 267, 2302323027.
Azghani, A. O., Idell, S., Bains, M. & Hancock, R. E. (2002). Pseudomonas aeruginosa outer membrane protein F is an adhesin in bacterial binding to lung epithelial cells in culture. Microb Pathog 33, 109114.[CrossRef][Medline]
Bajolet-Laudinat, O., Girod-de Bentzmann, S., Tournier, J. M., Madoulet, C., Plotkowski, M. C., Chippaux, C. & Puchelle, E. (1994). Cytotoxicity of Pseudomonas aeruginosa internal lectin PA-I to respiratory epithelial cells in primary culture. Infect Immun 62, 44814487.
Barondes, S. H., Gitt, M. A., Leffler, H. & Cooper, D. N. (1988). Multiple soluble vertebrate galactoside-binding lectins. Biochimie 70, 16271632.[Medline]
Beachey, E. H. (1981). Bacterial adherence: adhesin-receptor interactions mediating the attachment of bacteria to mucosal surface. J Infect Dis 143, 325345.[Medline]
Beuth, J., Stoffel, B., Ko, H. L., Jeljaszewicz, J. & Pulverer, G. (1995). Mistellektin-1: neue therapeutische Perspektiven in der Onkologie. Onkologie 18, 3640 (in German).[CrossRef]
Birnboim, H. C. & Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7, 15131523.
Brimer, C. D. & Montie, T. C. (1998). Cloning and comparison of fliC genes and identification of glycosylation in the flagellin of Pseudomonas aeruginosa a-type strains. J Bacteriol 180, 32093217.[Abstract]
Castric, P., Cassels, F. J. & Carlson, R. W. (2001). Structural characterization of the Pseudomonas aeruginosa 1244 pilin glycan. J Biol Chem 276, 2647926485.
Costerton, J. W. (2001). Cystic fibrosis pathogenesis and the role of biofilms in persistent infection. Trends Microbiol 9, 5052.[CrossRef][Medline]
Costerton, J. W., Stewart, P. S. & Greenberg, E. P. (1999). Bacterial biofilms: a common cause of persistent infections. Science 284, 13181322.
DiGiandomenico, A., Matewish, M. J., Bisaillon, A., Stehle, J. R., Lam, J. S. & Castric, P. (2002). Glycosylation of Pseudomonas aeruginosa 1244 pilin: glycan substrate specificity. Mol Microbiol 46, 519530.[CrossRef][Medline]
Dobos, K. M., Swiderek, K., Khoo, K. H., Brennan, P. J. & Belisle, J. T. (1995). Evidence for glycosylation sites on the 45-kilodalton glycoprotein of Mycobacterium tuberculosis. Infect Immun 63, 28462853.[Abstract]
Doig, P., Sastry, P. A., Hodges, R. S., Lee, K. K., Paranchych, W. & Irvin, R. T. (1990). Inhibition of pilus-mediated adhesion of Pseudomonas aeruginosa to human buccal epithelial cells by monoclonal antibodies directed against pili. Infect Immun 58, 124130.
Erickson, P. R. & Herzberg, M. C. (1993). Evidence for the covalent linkage of carbohydrate polymers to a glycoprotein from Streptococcus sanguis. J Biol Chem 268, 2378023783.
Gabius, H. J., Andre, S., Kaltner, H. & Siebert, H.-C. (2002). The sugar code: functional lectinomics. Biochim Biophys Acta 1572, 165177.[Medline]
Garber, N. C., Guempel, U., Gilboa-Garber, N. & Doyle, R. J. (1987). Specificity of the fucose-binding lectin of Pseudomonas aeruginosa. FEMS Microbiol Lett 48, 331334.[CrossRef]
Gilboa-Garber, N. (1972). Purification and properties of hemagglutinin from Pseudomonas aeruginosa and its reaction with human blood cells. Biochim Biophys Acta 273, 165173.[Medline]
Gilboa-Garber, N. (1982). Pseudomonas aeruginosa lectins. Methods Enzymol 83, 378385.[Medline]
Gilboa-Garber, N. & Garber, N. C. (1992). Microbial lectins. In Glycoconjugates: Composition, Structure and Function, pp. 541591. Edited by H. J. Allen & E. C. Kisailus. New York: Marcel Dekker.
Gilboa-Garber, N., Katcoff, D. J. & Garber, N. C. (2000). Identification and characterization of Pseudomonas aeruginosa PA-IIL lectin gene and protein compared to PA-IL. FEMS Immunol Med Microbiol 29, 5357.[CrossRef][Medline]
Glick, J. & Garber, N. C. (1983). The intracellular localization of Pseudomonas aeruginosa lectins. J Gen Microbiol 129, 30853090.
Grobe, S., Wingender, J. & Trüper, H. G. (1995). Characterization of mucoid Pseudomonas aeruginosa strains isolated from technical water systems. J Appl Bacteriol 79, 94102.[Medline]
Heydorn, A., Nielsen, A. T., Hentzer, M., Sternberg, C., Givskov, M., Ersbøll, B. K. & Molin, S. (2000). Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 146, 23952407.
Higgins, M. J. & Novak, J. T. (1997). Characterization of exocellular protein and its role in bioflocculation. J Environ Eng 123, 479485.[CrossRef]
Holloway, B. W., Krishnapillai, V. & Morgan, A. F. (1979). Chromosomal genetics of Pseudomonas. Microbiol Rev 43, 73102.
Imberty, A., Wimmerova, M., Mitchell, E. P. & Gilboa-Garber, N. (2004). Structures of lectins from Pseudomonas aeruginosa: insights into the molecular basis for host glycan recognition. Microbes Infect 6, 221228.[CrossRef][Medline]
Klausen, M., Heydorn, A., Ragas, P., Lambertsen, L., Aaes-Jorgensen, A., Molin, S. & Tolker-Nielsen, T. (2003). Biofilm formation by Pseudomonas aeruginosa wild type, flagella and type IV pili mutants. Mol Microbiol 48, 15111524.[CrossRef][Medline]
Korber, D. R., Lawrence, J. R., Hendry, M. J. & Caldwell, D. E. (1993). Analysis of spatial variability within mot+ and mot Pseudomonas fluorescens biofilms using representative elements. Biofouling 7, 339358.[CrossRef]
Kovach, M. E., Phillips, R. W., Elzer, P. H., Roop, R. M., II & Peterson, K. M. (1994). pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16, 800802.[Medline]
Laughlin, R. S., Musch, M. W., Hollbrook, C. J., Rocha, F. M., Chang, E. B. & Alverdy, J. C. (2000). The key role of Pseudomonas aeruginosa PA-I lectin on experimental gut-derived sepsis. Ann Surg 232, 133142.[CrossRef][Medline]
Loris, R., Tielker, D., Jaeger, K.-E. & Wyns, L. (2003). Structural basis of carbohydrate recognition by the lectin LecB from Pseudomonas aeruginosa. J Mol Biol 331, 861870.[CrossRef][Medline]
Lyczak, J. B., Cannon, C. L. & Pier, G. B. (2002). Lung infections associated with cystic fibrosis. Clin Microbiol Rev 15, 194222.
Ma, Q., Zhai, Y., Schneider, J. C., Ramseier, T. M. & Saier, M. H., Jr (2003). Protein secretion systems of Pseudomonas aeruginosa and P. fluorescens. Biochim Biophys Acta 1611, 223233.[Medline]
Mitchell, E., Houles, C., Sudakevitz, D., Wimmerova, M., Gautier, C., Perez, S., Gilboa-Garber, N. & Imberty, A. (2002). Structural basis for oligosaccharide-mediated adhesion of Pseudomonas aeruginosa in the lungs of cystic fibrosis patients. Nat Struct Biol 9, 918921.[CrossRef][Medline]
Mitchell, E. P., Sabin, C., Snajdrova, L. & 8 other authors (2005). High affinity fucose binding of Pseudomonas aeruginosa lectin PA-IIL: 1·0 Å resolution crystal structure of the complex combined with thermodynamics and computational chemistry approaches. Proteins 58, 735746.[CrossRef][Medline]
Morimoto, M., Saimoto, H., Usui, H., Okamoto, Y., Minami, S. & Shigemasa, Y. (2001). Biological activities of carbohydrate-branched chitosan derivatives. Biomacromolecules 2, 11331136.[CrossRef][Medline]
O'Toole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295304.[CrossRef][Medline]
Parsek, M. R. & Greenberg, E. P. (2000). Acyl-homoserine lactone quorum sensing in Gram-negative bacteria: a signaling mechanism involved in associations with higher organisms. Proc Natl Acad Sci U S A 97, 87898793.
Power, P. M. & Jennings, M. P. (2003). The genetics of glycosylation in Gram-negative bacteria. FEMS Microbiol Lett 218, 211222.[CrossRef][Medline]
Rhim, A. D., Stoykova, L., Glick, M. C. & Scanlin, T. F. (2001). Terminal glycosylation in cystic fibrosis (CF): a review emphasizing the airway epithelial cell. Glycoconj J 18, 649659.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Scanlin, T. F. & Glick, M. C. (2001). Glycosylation and the cystic fibrosis transmembrane conductance regulator. Respir Res 2, 276279.[CrossRef][Medline]
Scharfman, A., Arora, S. K., Delmotte, P., Van Brussel, E., Mazurier, J., Ramphal, R. & Roussel, P. (2001). Recognition of Lewis x derivatives present on mucins by flagellar components of Pseudomonas aeruginosa. Infect Immun 69, 52435248.
Shori, D. K., Genter, T., Hansen, J. & 7 other authors (2001). Altered sialyl- and fucosyl-linkage on mucins in cystic fibrosis patients promotes formation of the sialyl-Lewis X determinant on salivary MUC-5B and MUC-7. Pflugers Arch 443 (Suppl. 1), S55S61.
Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range mobilization for in vitro genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1, 784791.[CrossRef]
Simon, R., O'Connell, M., Labes, M. & Puhler, A. (1986). Plasmid vectors for the genetic analysis and manipulation of rhizobia and other gram-negative bacteria. Methods Enzymol 118, 640659.[Medline]
Singh, P. K., Schaefer, A. L., Parsek, M. R., Moninger, T. O., Welsh, M. J. & Greenberg, E. P. (2000). Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature 407, 762764.[CrossRef][Medline]
Sivaraman, T., Kumar, T. K., Jayaraman, G. & Yu, C. (1997). The mechanism of 2,2,2-trichloroacetic acid-induced protein precipitation. J Protein Chem 16, 291297.[CrossRef][Medline]
Steinberger, R. E., Allen, A. R., Hansa, H. G. & Holden, P. A. (2002). Elongation correlates with nutrient deprivation in Pseudomonas aeruginosa-unsaturated biofilms. Microb Ecol 43, 416423.[CrossRef][Medline]
Steuer, M. K., Herbst, H., Beuth, J., Steuer, M., Pulverer, G. & Matthias, R. (1993). Hemmung der bakteriellen Adhäsion durch Lektinblockade bei durch Pseudomonas aeruginosa induzierter Otitis externa im Vergleich zur lokalen Therapie mit Antibiotika. Otorhinolaryngol Nova 3, 1925 (in German).
Stewart, P. S. & Costerton, J. W. (2001). Antibiotic resistance of bacteria in biofilms. Lancet 358, 135138.[CrossRef][Medline]
Strathmann, M., Wingender, J. & Flemming, H.-C. (2002). Application of fluorescently labelled lectins for the visualization and biochemical characterization of polysaccharides in biofilms of Pseudomonas aeruginosa. J Microbiol Methods 50, 237248.[CrossRef][Medline]
Studier, F. W. & Moffat, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective high level expression of cloned genes. J Mol Biol 189, 113130.[CrossRef][Medline]
Thomsson, K. A., Hinojosa-Kurtzberg, M., Axelsson, K. A., Domino, S. E., Lowe, J. B., Gendler, S. J. & Hansson, G. C. (2002). Intestinal mucins from cystic fibrosis mice show increased fucosylation due to an induced Fuc
1-2 glycosyltransferase. Biochem J 367, 609616.[CrossRef][Medline]
Timmermans, M. C., Maliga, P., Vieira, J. & Messing, J. (1990). The pFF plasmids: cassettes utilising CaMV sequences for expression of foreign genes in plants. J Biotechnol 14, 333344.[CrossRef][Medline]
Vallet, I., Olson, J. W., Lory, S., Lazdunski, A. & Filloux, A. (2001). The chaperone/usher pathways of Pseudomonas aeruginosa: identification of fimbrial gene clusters (cup) and their involvement in biofilm formation. Proc Natl Acad Sci U S A 98, 69116916.
von Bismarck, P., Schneppenheim, R. & Schumacher, U. (2001). Successful treatment of Pseudomonas aeruginosa respiratory tract infection with a sugar solution a case report on a lectin based therapeutic principle. Klin Padiatr 213, 285287.[CrossRef][Medline]
Wentworth, J. S., Austin, F. E., Garber, N. C., Gilboa-Garber, N., Paterson, C. A. & Doyle, R. J. (1991). Cytoplasmic lectins contribute to the adhesion of Pseudomonas aeruginosa. Biofouling 4, 99104.
Wilhelm, S., Tommassen, J. & Jaeger, K. E. (1999). A novel lipolytic enzyme located in the outer membrane of Pseudomonas aeruginosa. J Bacteriol 181, 69776986.
Wingender, J., Neu, T. R. & Flemming, H.-C. (1999). What are bacterial extracellular substances? In Microbial Extracellular Polymeric Substances, pp. 119. Edited by J. Wingender, T. R. Neu & H.-C. Flemming. Berlin: Springer.
Winzer, K., Falconer, C., Garber, N. C., Diggle, S. P., Camara, M. & Williams, P. (2000). The Pseudomonas aeruginosa lectins PA-IL and PA-IIL are controlled by quorum sensing and by RpoS. J Bacteriol 182, 64016411.
Witholt, B., Boekhout, M., Brock, M., Kingma, J., Heerikhuizen, H. V. & Leij, L. D. (1976). An efficient and reproducible procedure for the formation of spheroplasts from variously grown Escherichia coli. Anal Biochem 74, 160170.[CrossRef][Medline]
Woodcock, D. M., Crowther, P. J., Doherty, J., Jefferson, S., DeCruz, E., Noyer-Weidner, M., Smith, S. S., Michael, M. Z. & Graham, M. W. (1989). Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res 17, 34693478.
Wozniak, D. J., Wyckoff, T. J., Starkey, M., Keyser, R., Azadi, P., O'Toole, G. A. & Parsek, M. R. (2003). Alginate is not a significant component of the extracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aeruginosa biofilms. Proc Natl Acad Sci U S A 100, 79077912.
Received 13 October 2004;
revised 1 February 2005;
accepted 3 February 2005.
This article has been cited by other articles:
![]() |
E. Karatan and P. Watnick Signals, Regulatory Networks, and Materials That Build and Break Bacterial Biofilms Microbiol. Mol. Biol. Rev., June 1, 2009; 73(2): 310 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chemani, A. Imberty, S. de Bentzmann, M. Pierre, M. Wimmerova, B. P. Guery, and K. Faure Role of LecA and LecB Lectins in Pseudomonas aeruginosa-Induced Lung Injury and Effect of Carbohydrate Ligands Infect. Immun., May 1, 2009; 77(5): 2065 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zilliges, J.-C. Kehr, S. Mikkat, C. Bouchier, N. T. de Marsac, T. Borner, and E. Dittmann An Extracellular Glycoprotein Is Implicated in Cell-Cell Contacts in the Toxic Cyanobacterium Microcystis aeruginosa PCC 7806 J. Bacteriol., April 15, 2008; 190(8): 2871 - 2879. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rao, A. DiGiandomenico, J. Unger, Y. Bao, R. K. Polanowska-Grabowska, and J. B. Goldberg A novel oxidized low-density lipoprotein-binding protein from Pseudomonas aeruginosa Microbiology, February 1, 2008; 154(2): 654 - 665. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Hagan and H. L. T. Mobley Uropathogenic Escherichia coli Outer Membrane Antigens Expressed during Urinary Tract Infection Infect. Immun., August 1, 2007; 75(8): 3941 - 3949. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sonawane, J. Jyot, and R. Ramphal Pseudomonas aeruginosa LecB Is Involved in Pilus Biogenesis and Protease IV Activity but Not in Adhesion to Respiratory Mucins Infect. Immun., December 1, 2006; 74(12): 7035 - 7039. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. N. Fong, K. Karplus, G. K. Schoolnik, and F. H. Yildiz Identification and Characterization of RbmA, a Novel Protein Required for the Development of Rugose Colony Morphology and Biofilm Structure in Vibrio cholerae J. Bacteriol., February 1, 2006; 188(3): 1049 - 1059. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zinger-Yosovich, D. Sudakevitz, A. Imberty, N. C. Garber, and N. Gilboa-Garber Production and properties of the native Chromobacterium violaceum fucose-binding lectin (CV-IIL) compared to homologous lectins of Pseudomonas aeruginosa (PA-IIL) and Ralstonia solanacearum (RS-IIL) Microbiology, February 1, 2006; 152(2): 457 - 463. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |