|
|
||||||||


Instituto de Investigaciones Biomédicas Alberto Sols CSIC-UAM and Departamento de Bioquímica, Facultad de Medicina de la Universidad Autónoma de Madrid, Arzobispo Morcillo 4, 28029 Madrid, Spain
Correspondence
Juan J. Aragón
juanjose.aragon{at}uam.es
| ABSTRACT |
|---|
|
|
|---|
The GenBank/EMBL/DDBJ accession number for the sequence reported in this paper is AY142710.
These authors contributed equally to this work.
| INTRODUCTION |
|---|
|
|
|---|
The metabolic peculiarities of Y. lipolytica, a yeast which diverged early from other yeasts (Souciet et al., 2000
), make it interesting to study the kinetic and regulatory characteristics of the Pfk from this organism, as well as the physiological effects of the disruption of its encoding gene(s). In the work described here, we purified to homogeneity Pfk from Y. lipolytica, and characterized its physical and regulatory properties, which are discussed with regard to the particular metabolic regulation of this organism. We also demonstrate that there is only one gene encoding this protein, and show that it is essential for growth in glucose.
| METHODS |
|---|
|
|
|---|
Organisms and growth conditions.
The following strains of Y. lipolytica were used in this study, as indicated where appropriate: CJM244 (MATA lys11-23 ura3-302 leu2-270) provided as INAG 35667 by A. Domínguez (Instituto de Microbiología Bioquíminca, Salamanca, Spain), and P01a (MATA leu2-270 ura3-302). The following S. cerevisiae strains were used: VW1a (MAT
ura3-52 leu2-3,112 his3
1 trp1-289 MAL2-8c SUC2 GAL) and the pfk1 pfk2 mutant HD152-1D (MAT
pkf1 : : HIS3 pfk2 : : HIS3 ura3-52, his3
1 leu2-3,112 trp1-289 MAL2-8c SUC2 GAL) provided by J. Heinisch (Universität Osnabrück, Germany). Yeasts were grown at 30 °C in 1 % (w/v) yeast extract, 2 % (w/v) peptone, 2 % (w/v) glucose (YPD), or in minimal medium YNB (Difco), with the carbon sources indicated in each case at 2 % (w/v). Liquid cultures were shaken at 200 r.p.m. in a New Brunswick orbital shaker. Solid media were identical to liquid, but with 2 % (w/v) agar added. Auxotrophic requirements were added when necessary at 20 µg ml1. Transformation of Y. lipolytica was done as described by Barth & Gaillardin (1996)
, and that of S. cerevisiae as described by Ito et al. (1983)
. The Escherichia coli strain DH5
[supE44
lacU169 (
80 lacZ
M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1], used for general cloning procedures and amplifications of DNA, was grown at 37 °C in either liquid or solid LuriaBertani medium (Sambrook et al., 1989
), with 50 µg ampicillin ml1 when necessary.
Purification of Pfk.
All purification steps were performed at 4 °C. Cells from a 2 l culture of Y. lipolytica CJM244 grown in YPD to stationary phase were harvested by sedimentation, washed twice in cold water, and then washed in buffer A (50 mM HEPES, 100 mM KCl, 2 mM EDTA, 1 mM DTT, 2 mM NaF, 0·5 mM PMSF, 2·5 µg leupeptin ml1, pH 6·8). Approximately 15 g (wet weight) cells were resuspended in 3 vols buffer A, and disrupted with 5 vols glass beads, as described previously (Aragón et al., 1986
). Cell debris was removed by centrifugation at 10 000 g for 10 min, followed by centrifugation of the resulting supernatant at 31 000 g for 30 min. Protamine sulfate dissolved in buffer A was added to the supernatant to a final concentration of 0·2 % (w/v). After 30 min stirring, and centrifugation as before, the supernatant fluid, designated the extract, was precipitated with 5 % (w/v) solid polyethylene glycol (Mr 8000). After 30 min stirring, and centrifugation as described above, the resulting pellet was dissolved in buffer B [50 mM HEPES, 5 mM MgCl2, 2 mM EDTA, 1 mM DTT, 0·5 mM PMSF, 2·5 µg leupeptin ml1, 20 % (v/v) glycerol, pH 6·8], and separated by chromatography on a column (2·2x8·0 cm) of DEAE-cellulose (DE52) equilibrated with buffer B. The column was washed with 120 ml buffer B, and eluted with a 200 ml linear gradient of 0500 mM KCl in buffer B. Fractions of 2 ml were collected, and analysed for protein and Pfk activity. YlPfk eluted at approximately 180 mM KCl, and the more active fractions were pooled and applied to a column (1·9x7·0 cm) of Blue Sepharose CL-6B equilibrated with buffer B. The column was washed with 60 ml buffer B, 50 ml buffer B containing 3 mM Fru-6-P and 1·5 mM MgATP, and eluted in 2 ml fractions with a 100 ml linear gradient of 01·5 M KCl in buffer B. Pfk was eluted at approximately 0·75 M KCl, and fractions having the highest activity were pooled and employed in subsequent studies. The final purified preparation had a specific activity of 10·5 U (mg protein)1. This preparation was subjected to SDS-PAGE analysis on 10 % gels, stained with Coomassie blue as previously described (Martínez-Costa et al., 1994
), and judged to be homogeneous by this criterion (see Results). For comparative kinetic studies between YlPfk and ScPfk, the cell extracts were dialysed against 10 mM HEPES, 0·5 mM PMSF, 2·5 µg leupeptin ml1 and 20 % (v/v) glycerol, pH 7·0.
Enzyme activity assay.
Total Pfk activity was measured in an assay mixture containing 50 mM HEPES, 100 mM KCl, 5 mM MgCl2, pH 7·0, 2 mM Pi, 0·4 mM
, 40 µM cAMP, 0·15 mM NADH, 1 mM MgATP, 1·2 U aldolase, 10 U triosephosphate isomerase, 1 U glycerol-3-phosphate dehydrogenase, 510 µl enzyme preparation and 2 mM Fru-6-P, in a final volume of 1 ml. Assays for kinetic studies were carried out under the same conditions, omitting Pi,
and cAMP unless otherwise stated, with 510 µl purified enzyme, and the indicated concentrations of MgATP, the corresponding effector and Fru-6-P. When the effect of citrate was studied, the concentration of MgCl2 was 20 mM. In all cases, the reaction mixture without Fru-6-P was preincubated for 5 min. The reaction was started by the addition of Fru-6-P, and followed by measuring the rate of the absorbance change at 340 nm at 25 °C. When Pfk activity was assayed during purification, glucose-6-P was added to Fru-6-P in a 3 : 1 molar proportion. Auxiliary enzymes were desalted as described previously (González-Mateos et al., 1993
; Martínez-Costa et al., 1994
). One unit (U) of activity is defined as the amount of enzyme that catalyses the conversion of 1 µmol substrate min1 under the conditions described above.
Size-exclusion FPLC.
Isocratic size-exclusion chromatography was performed at 20 °C on a Superdex 200 HR 10/30 column (Amersham Biosciences). The column was equilibrated with 50 mM sodium phosphate buffer, pH 7·0, containing 150 mM NaCl. Samples of 0·2 ml were applied to the column, and eluted at a flow rate of 0·5 ml min1 with the same buffer. Fractions of 0·1 ml were collected, and tested for Pfk activity. When indicated, the elution buffer contained 10 mM Fru-6-P. For calibration, standard proteins ranging from 13·7 to 880 kDa were used.
Isolation of the YlPFK1 gene.
Degenerate oligonucleotides were designed against two regions of Pfk in which conserved amino acid sequences were found in diverse organisms. The design took into account the high G+C content of the Y. lipolytica genome (http://www.kazusa.or.jp/codon/). The oligonucleotides were GTCGGYTCYATYGACAACGACATG for the 5' region, and GTACTCGGTRCCGGGSACRTT for the 3' region (the standard abbreviations to represent ambiguity are used; Nomenclature Committee of the International Union of Biochemistry, 1985
), corresponding to VGSIDNDM and NVPGTEY, respectively. A PCR reaction was performed using these oligonucleotides, and Y. lipolytica genomic DNA as a template. The conditions were: 30 cycles of 1 min at 94 °C, 1 min at 50 °C and 1 min at 72 °C. A DNA fragment of about 1 kb was isolated, cloned into pGEMT-easy (Promega), and sequenced. The translated sequence of this fragment was highly similar to that of other Pfks. To obtain the rest of the coding region, 5' and 3' RACE reactions were performed using the RLM-RACE kit (Ambion; catalogue no. 1700) and the following oligonucleotides: for the 5' RACE, inner primer TCGACGACAAAGGCTCGCGAGTGC, and outer primer CCCACTGAGTAGCATCGGGAGCAG, and for the 3' RACE, CAACGGTTTGACGGTCTAATCGTC. For the 5' RACE reaction, the conditions were as follows: three cycles of 1 min at 94 °C, 1 min at 60 °C, and 1 min at 72 °C; 30 cycles of 1 min at 94 °C, 1 min at 60 °C, and 2 min at 72 °C; followed by a cycle of 1 min at 94 °C, 1 min at 60 °C, and 5 min at 72 °C. For the 3' RACE, the following conditions were used: 30 cycles of 1 min at 94 °C, 1 min at 55 °C, and 1·2 min at 72 °C; followed by one cycle of 1 min at 94 °C, 1 min at 50 °C, and 5 min at 72 °C. The products of the reaction were cloned into pGEMT-easy, and sequenced. All the products were sequenced at least twice in each direction. The sequence corresponding to the coding region of the YlPFK1 gene encoding the Y. lipolytica Pfk has been deposited in the GenBank database under the accession number AY142710.
To obtain a DNA fragment comprising the whole coding region of YlPFK1, the following oligonucleotides were used: for the 5' region, CGCGCTTCAAAACACCGACAAT, and for the 3' region, AATTTCCAACACCAAACCCCCTA. A PCR reaction was done using genomic Y. lipolytica DNA and the following conditions: three cycles of 1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C; 30 cycles of 1 min at 94 °C, 1 min at 55 °C, and 3 min at 72 °C; followed by 1 min at 94 °C, 1 min at 48 °C, and 5 min at 72 °C. The product was cloned into pGEMT-easy to yield plasmid pCL79, and sequenced.
Expression of YlPFK1 in Y. lipolytica and S. cerevisiae.
YlPFK1 was expressed in Y. lipolytica using the plasmid pCL49, which carries the YlTEF1 promoter and the YlXPR2 terminator (Flores & Gancedo, 2005
). The 3 kb YlPFK1 ORF was excised from pCL79 with NotI, and cloned in the same site in pCL49. To express YlPFK1 in S. cerevisiae, a monocopy plasmid, pCL80, and a multicopy plasmid, pCL81, were constructed. Both plasmids carried the coding region of the YlPFK1 gene under the control of the S. cerevisiae ADH1 promoter, and they were constructed as follows. Plasmid pCL80 was obtained by inserting in the BamHI site of pRS316 (Sikorski & Hieter, 1989
) a cassette carrying the promoter and terminator of ADH1 excised from plasmid pAAH5 (Ammerer, 1983
), and then introducing in the blunt-ended HindIII site the PCR fragment carrying YlPFK1 (obtained using Pwo DNA Polymerase; Roche). Plasmid pCL81 was created by cutting plasmid pDB20 (Becker et al., 1991
) with NotI, and inserting the 3 kb NotINotI fragment from pCL79 carrying YlPFK1.
Disruption of the chromosomal YlPFK1 copy.
To disrupt the YlPFK1 gene, plasmid pCL79 was cut with NotI, and the fragment containing the YlPFK1 gene was inserted in the NotI site of a pKS plasmid (Stratagene) lacking the piece between XbaI and KpnI in the polylinker. The resulting construction was digested with NcoI, and the internal 1·66 kb NcoINcoI fragment from YlPFK1 was replaced by a DNA fragment of 2·1 kb containing the YlLEU2 gene obtained by NcoI digestion of plasmid pINA62 (Gaillardin & Ribet, 1987
) to give plasmid pCL83. The 3·4 kb NotINotI fragment from pCL83 was used to transform Y. lipolytica. Transformants were selected by growth in the absence of leucine on minimal medium agar containing 3 % glycerol and 2 % ethanol, and replica plated to minimal medium glucose agar. Those transformants unable to grow on glucose were selected for further study.
Nucleic acid manipulations.
Recombinant DNA techniques were done according to established protocols. DNA sequencing was performed by the dideoxy chain-termination method. Sampling of the yeast to extract RNA was done by rapid filtration and flash freezing in liquid nitrogen, as described by Belinchón et al. (2004)
. Total RNA for RACE reactions was extracted from Y. lipolytica using the TRIzol LS reagent (Invitrogen). Southern analysis was performed using established protocols. Probes were labelled with 32P using the Rediprime II Random Prime labelling system. Genomic DNA was obtained as described by Hoffman & Winston (1987)
.
Other methods.
Protein concentration was determined by Bradford's dye-binding method (Bradford, 1976
), using bovine
-globulin as the standard. Yeasts were sampled during the exponential phase of growth, and metabolite extraction was done as described previously (Gamo et al., 1993)
. Metabolites were determined by standard enzymic techniques (Bergmeyer et al., 1987
). Multialignments of Pfk sequences were conducted by means of the program CLUSTAL W (Higgins et al., 1994
).
| RESULTS |
|---|
|
|
|---|
|
|
Kinetic and regulatory properties of Y. lipolytica Pfk
We studied different kinetic properties of YlPfk using the purified enzyme, obtained as described above, and dialysed cell extracts from Y. lipolytica and S. cerevisiae to compare some parameters of the enzymes from both origins. As shown in Fig. 2
(a), YlPfk exhibited a high affinity for Fru-6-P (S0·5 52 µM), and no evidence of cooperativity for this substrate was found [h (Hill coefficient) 1·1]. This contrasts with the sigmoidal curve and S0·5 values within the mM range shown by Pfks of most organisms; compare, for example, the h and S0·5 values of ScPfk with those of YlPfk (2·8 and 1·48 mM versus 1·04 and 90 µM, respectively). Also, YlPfk was only slightly inhibited by MgATP (Fig. 2b
), showing a Ki value of 3·5 mM, about 10-fold higher than that of the S. cerevisiae Pfk (Fig. 2b
, inset). An increase in the MgATP concentration from 1 to 5 mM brought about an increase of the S0·5 value of YlPfk for Fru-6-P to 0·51 mM, as expected, but the saturation curve for this substrate remained hyperbolic (h 1·1) (results not shown). The calculated kcat value (152 s1) is about one order of magnitude lower than those known for Pfks from other yeast species, such as S. cerevisiae (Hofmann & Kopperschläger, 1982
), Schizosaccharomyces pombe (Reuter et al., 2000
), P. pastoris (Kirchberger et al., 2002
) and Kluyveromyces lactis (Bär et al., 1997
).
|
|
Table 2
shows the concentrations of glycolytic metabolites related to Pfk function that we measured in Y. lipolytica, as compared with those determined in S. cerevisiae. The most striking result concerned the reaction product of Pfk, Fru-1,6-P2, whose intracellular concentration (80 µM) in cultures of Y. lipolytica actively growing in YPD was two orders of magnitude lower than that measured in S. cerevisiae under similar conditions (4·53 mM). The concentrations of other metabolites were within the same range in both species, although the ATP concentration was lower in Y. lipolytica.
|
and
subunits, respectively, from S. cerevisiae, and as much as 4344 % with Pfk isoenzymes from mammals). An alignment of the deduced amino acid sequence of YlPfk with those of Pfks from different organisms (Fig. 4
|
Physiological effects of the disruption of the YlPFK1 gene
The chromosomal copy of YlPFK1 was disrupted by deletion of an internal 1·66 kb fragment and substitution by the YlLEU2 gene, as described in Methods. A Southern analysis showed the correctness of the disruption (Fig. 5a
). Disruption of the YlPFK1 gene resulted in glucose-negative growth (Fig. 5b
), and abolished detectable Pfk activity. The findings on protein structure, which indicated a protein composed of identical subunits, are in agreement with the findings obtained in the gene disruption. Reintroduction of the YlPFK1 gene restored growth on glucose (Fig. 5b
), thus confirming that the inability to grow in glucose of the disruptant was caused by the lack of Pfk. Although glucose did not support growth of the Ylpfk1 disruptant, it did not interfere with growth on permissive carbon sources (Fig. 5b
), which is in contrast with the situation observed in S. cerevisiae (C.-L. Flores & C. Gancedo, unpublished results).
|
| DISCUSSION |
|---|
|
|
|---|
The kinetic study of the purified Pfk from Y. lipolytica, and the isolation of its encoding gene, have revealed important differences between this organism and other yeasts. Unlike the enzyme from S. cerevisiae and most other cells, YlPfk has a high affinity for Fru-6-P, and lacks co-operative interactions in the presence of this substrate, suggesting that the enzyme is primarily in the more active R conformation, as assumed by the model of Monod et al. (1965)
. Additionally, YlPfk shows little inhibition by MgATP, and is insensitive to the allosteric activators Fru-2,6-P2, AMP and ADP, whereas it is highly sensitive to inhibition by phosphoenolpyruvate. In bacteria, phosphoenolpyruvate is the main allosteric inhibitor of Pfk (Blangy et al., 1968
), but in S. cerevisiae and animal cells, this compound is of little physiological relevance because of its intracellular concentration, which is usually several orders of magnitude lower than the Ki values of Pfk isozymes (inset of Fig. 3b
, Table 2
; Martínez-Costa et al., 2004
). In contrast, our data suggest that phosphoenolpyruvate could play a physiological role in the regulation of YlPfk, as its intracellular concentration during growth in YPD (0·27 mM) is about fourfold higher than its Ki value for YlPfk (61 µM). Under these conditions, the inhibition by phosphoenolpyruvate would not allow the enzyme to work near Vmax, even if the concentration of Fru-6-P (0·19 mM), much higher than the S0·5 value (52 µM), would permit it. Therefore, phosphoenolpyruvate, probably in conjunction with the activators Pi and
, may contribute to maintaining YlPfk within a range of in vivo activity able to respond efficiently to variations of Fru-6-P concentration, even in the absence of co-operative kinetics. To our knowledge, no data are available on the effect of this metabolite on Pfks from other yeast species, except S. cerevisiae. It has been reported (Habison et al., 1983
) that partially purified Pfk from Aspergillus niger is inhibited by phosphoenolpyruvate with a Ki value of 0·15 mM, and also by citrate (Ki 0·10·4 mM), the latter inhibition being released by Fru-2,6-P2 activation (Arts et al., 1987
). Inhibition by citrate is a common feature of different eukaryotic Pfks; however, in Y. lipolytica, at least during growth in YPD, the role of this inhibitory effect is uncertain because of the high Ki value of 3·3 mM, and the undetectable intracellular concentration of citrate under these conditions.
The atypical kinetic properties of YlPfk, and the levels of key glycolytic intermediates determined in Y. lipolytica, point to a role of this enzyme in the regulation of glycolysis that is different from the role played in S. cerevisiae. The high concentration of Fru-1,6-P2 found in S. cerevisiae during growth in glucose, greatly exceeding the concentration of Fru-6-P (Table 2
; Bañuelos et al., 1977
; Breitenbach-Schmitt et al., 1984
), suggests that in this yeast, a rate-limiting step of the glycolytic pathway is located after the reaction catalysed by Pfk. However, in Y. lipolytica, the situation appears to be different since the concentration of Fru-1,6-P2 in cultures growing in YPD (over 50-fold lower than that in S. cerevisiae) was about half that of Fru-6-P, thus suggesting that in this organism, Pfk may have an important role on the control of glucose utilization.
All the amino acid residues assigned to the binding of Fru-2,6-P2 and AMP/ADP are conserved in YlPfk (Fig. 4
). Therefore, the lack of activation by these effectors could be related to other unidentified residues important for either the binding to their allosteric sites or the signal transduction route from these sites to the catalytic site. It is also possible that the insensitivity of YlPfk towards Fru-2,6-P2 may be due to an evolutionary adaptation to the lack of this compound; however, this seems unlikely. Although no data on Fru-2,6-P2 concentration in Y. lipolytica are available, two ORFs, YALI0E17633g and YALI0F27885g, have been found in the available Y. lipolytica genome (http://cbi.labri.fr/Genolevures) with similarity to S. cerevisiae 6-phosphofructose-2-kinase and fructose-2,6-bisphosphatase, respectively, the enzymes responsible for the metabolism of this compound.
Among eukaryotic Pfks with abnormal allosteric properties, the Sch. pombe enzyme was reported to have little sensitivity to ATP inhibition (Reuter et al., 2000
), and that from K. lactis shows no Fru-6-P co-operativity (Bär et al., 1997
); however, both enzymes are sensitive to usual Pfk effectors, including Fru-2,6-P2 and AMP. A nonallosteric Pfk has been described in the slime mould D. discoideum (Martínez-Costa et al., 1994
).
S. cerevisiae mutants lacking Pfk activity do not grow in glucose because of limited functionality of the pentose phosphate pathway, and because of the fermentative sugar metabolism in this yeast. In contrast, in K. lactis, a yeast with a more oxidative metabolism than S. cerevisiae, pfk mutants grow in glucose at a rate similar to that of the wild-type (Heinisch et al., 1993
). However, an additional block of respiration, or mutations that affect the function of the pentose phosphate pathway, precluded growth of K. lactis pfk mutants in glucose (Jacoby et al., 1993
). In this context, the lack of growth in glucose of the Y. lipolytica pfk mutant is unexpected, since this yeast has an obligate oxidative metabolism, and even possesses an active complex I in the respiratory chain (Djafarzadeh et al., 2000
). The most likely explanation of this growth phenotype would be a problem with the functionality of the pentose phosphate pathway, perhaps related to NADP+ regeneration. However, direct measurements of the glucose flux going through this pathway in Y. lipolytica are not yet available.
An interesting difference between the behaviour of Y. lipolytica pfk1 and S. cerevisiae pfk1 pfk2 mutants is their response to glucose. This sugar inhibits growth in media with gluconeogenic carbon sources not only of the S. cerevisiae pfk1 pfk2 mutant (C.-L. Flores & C. Gancedo, unpublished results), but also of other glycolytic mutants (Ciriacy & Breitenbach, 1979
). In contrast, the growth of the Y. lipolytica pfk1 mutant under similar conditions remained unaffected by the sugar. This difference might be due to a variation in the magnitude of catabolite repression among the two yeasts. While glucose exerts a strong repression on pathways that allow the use of gluconeogenic carbon sources in S. cerevisiae (Gancedo, 1998
; Carlson, 1999
), this repression is less marked in Y. lipolytica (Barth & Scheuber, 1993
; R. Jardón, C.-L. Flores & C. Gancedo, unpublished results). This fact, and the function of an active respiration, may allow the Y. lipolytica pfk1 mutant to withstand the presence of glucose.
The peculiar regulatory characteristics of the YlPfk, together with the differences in kinetic properties of pyruvate kinase (Hirai et al., 1975
), and the low hexokinase activity found in this organism (Petit & Gancedo, 1999
), indicate that the glycolytic flux in this organism is regulated in a different way from that described in the conventional yeast S. cerevisiae.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aragón, J. J., Sánchez, V. & Boto, L. (1986). Fructose 2,6-bisphosphate in Dictyostelium discoideum. Independence of cyclic AMP production and inhibition of fructose-1,6-bisphosphatase. Eur J Biochem 161, 757761.[Medline]
Arts, E., Kubicek, C. P. & Rohr, M. (1987). Regulation of phosphofructokinase from Aspergillus niger: effect of fructose 2,6-bisphosphate on the action of citrate, ammonium ions and AMP. J Gen Microbiol 133, 11951199.
Bañuelos, M., Gancedo, C. & Gancedo, J. M. (1977). Activation by phosphate of yeast phosphofructokinase. J Biol Chem 252, 63946398.
Bär, J., Schellenberger, W. & Kopperschläger, G. (1997). Purification and characterization of phosphofructokinase from the yeast Kluyveromyces lactis. Yeast 13, 13091317.[CrossRef][Medline]
Barth, G. & Gaillardin, C. (1996). Yarrowia lipolytica. In Non-Conventional Yeasts in Biotechnology. A Handbook, pp. 313388. Edited by K. Wolf. New York, NY: Springer.
Barth, G. & Scheuber, T. (1993). Cloning of the isocitrate lyase gene (ICL1) from Yarrowia lipolytica and characterization of the deduced protein. Mol Gen Genet 24, 422430.
Becker, D. M., Fikes, J. D. & Guarente, L. (1991). A cDNA encoding a human CCAAT-binding protein cloned by functional complementation in yeast. Proc Natl Acad Sci U S A 8, 19681972.
Belinchón, M. M., Flores, C. L. & Gancedo, J. M. (2004). Sampling Saccharomyces cerevisiae cells by rapid filtration improves the yield of mRNAs. FEMS Yeast Res 4, 751756.[CrossRef][Medline]
Bergmeyer, H. U., Bergmeyer, J. & Graßl, M. (1987). Methods of Enzymatic Analysis, 3rd edn, vols VI and VII. Weinheim: VCH.
Blangy, D., Buc, H. & Monod, J. (1968). Kinetics of the allosteric interactions of phosphofructokinase from Escherichia coli. J Mol Biol 31, 1335.[CrossRef][Medline]
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem 72, 248254.[CrossRef][Medline]
Breitenbach-Schmitt, I., Schmitt, H. D., Heinisch, J. & Zimmermann, F. K. (1984). Genetic and physiological evidence for the existence of a second glycolytic pathway in yeasts parallel to the phosphofructokinasealdolase reaction sequences. Mol Gen Genet 195, 536540.[CrossRef]
Carlson, M. (1999). Glucose repression in yeast. Curr Opin Microbiol 2, 202207.[CrossRef][Medline]
Ciriacy, M. & Breitenbach, I. (1979). Physiological effects of seven different blocks in glycolysis in Saccharomyces cerevisiae. J Bacteriol 139, 152160.
Davies, S. E. C. & Brindle, K. M. (1992). Effects of overexpression of phosphofructokinase on glycolysis in the yeast Saccharomyces cerevisiae. Biochemistry 31, 47294735.[CrossRef][Medline]
Djafarzadeh, R., Kerscher, S., Zwicker, K., Radermacher, M., Lindahl, M., Schagger, H. & Brandt, U. (2000). Biophysical and structural characterization of proton-translocating NADH-dehydrogenase (complex I) from the strictly aerobic yeast Yarrowia lipolytica. Biochim Biophys Acta 1459, 230238.[Medline]
Domínguez, A., Fermiñán, E. & Gaillardin, C. (2000). Yarrowia lipolytica: an organism amenable to genetic manipulation as a model for analysing dimorphism in fungi. In Contributions to Microbiology, vol. 5, pp. 151162. Edited by J. F. Ernst & A. Schmidt. Basel, Switzerland: Karger.
Dujon, B., Sherman, D., Durrens, P. & 63 other authors (2004). Genome evolution in yeasts. Nature 430, 3544.[CrossRef][Medline]
Flores, C.-L. & Gancedo, C. (2005). Yarrowia lipolytica mutants devoid of pyruvate carboxylase activity show an unusual growth phenotype. Eukaryot Cell 4, 356364.
Flores, C.-L., Rodriguez, C., Petit, T. & Gancedo, C. (2000). Carbohydrate and energy-yielding metabolism in non-conventional yeasts. FEMS Microbiol Rev 24, 507529.[Medline]
Gaillardin, C. & Ribet, A. M. (1987). LEU2-directed expression of
-galactosidase activity and phleomycin resistance in Yarrowia lipolytica. Curr Genet 11, 369375.[CrossRef][Medline]
Gamo, F. J., Portillo, F. & Gancedo, C. (1993). Characterization of mutations that overcome the toxic effect of glucose on phosphoglucose isomerase less strains of Saccharomyces cerevisiae. FEMS Microbiol Lett 106, 233238.[CrossRef][Medline]
Gancedo, J. M. (1998). Yeast carbon catabolite repression. Microbiol Mol Biol Rev 62, 334361.
González-Mateos, F., Gómez, M.-E., García-Salguero, L., Sánchez, V. & Aragón, J. J. (1993). Inhibition of glycolysis by amino acids in ascites tumor cells. Specificity and mechanism. J Biol Chem 268, 78097817.
Habison, A., Kubicek, C. P. & Rohr, M. (1983). Partial purification and regulatory properties of phosphofructokinase from Aspergillus niger. Biochem J 209, 669676.[Medline]
Heinisch, J., Ritzel, R. G., von Borstel, R. C., Aguilera, A., Rodicio, R. & Zimmermann, F. K. (1989). The phosphofructokinase genes of yeast evolved from two duplication events. Gene 78, 309321.[CrossRef][Medline]
Heinisch, J., Kirchrath, L., Liesen, T., Vogelsang, K. & Hollenberg, C. P. (1993). Molecular genetics of phosphofructokinase in the yeast Kluyveromyces lactis. Mol Microbiol 8, 559570.[CrossRef][Medline]
Higgins, D., Thompson, J., Gibson, T., Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.
Hirai, M., Tanaka, A. & Fukui, S. (1975). Difference in pyruvate kinase regulation among three groups of yeasts. Biochim Biophys Acta 391, 282291.[Medline]
Hoffman, C. S. & Winston, F. (1987). A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of E. coli. Gene 57, 266272.
Hofmann, E. & Kopperschläger, G. (1982). Phosphofructokinase from yeast. Methods Enzymol 90, 4960.
Hofmeyr, J. H. & Cornish-Bowden, A. (1991). Quantitative assessment of regulation in metabolic systems. Eur J Biochem 200, 223236.[Medline]
Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983). Transformation of intact yeast cells treated with alcali cations. J Bacteriol 153, 163168.
Jacoby, J., Hollenberg, C. P. & Heinisch, J. J. (1993). Transaldolase mutants in the yeast Kluyveromyces lactis provide evidence that glucose can be metabolized through the pentose phosphate pathway. Mol Microbiol 10, 867876.[CrossRef][Medline]
Kemp, R. G. & Foe, L. G. (1983). Allosteric regulatory properties of muscle phosphofructokinase. Mol Cell Biochem 57, 147154.[Medline]
Kirchberger, J., Bär, J., Schellenberger, W., Dihazi, H. & Kopperschläger, G. (2002). 6-phosphofructokinase from Pichia pastoris: purification, kinetic and molecular characterization of the enzyme. Yeast 19, 933947.[CrossRef][Medline]
Kopperschläger, G., Bär, J., Nissler, K. & Hofmann, E. (1977). Physicochemical parameters and subunit composition of yeast phosphofructokinase. Eur J Biochem 81, 317325.[Medline]
Kurtzman, C. P. & Blanz, P. A. (1998). Ribosomal RNA/DNA sequence comparisons for assessing phylogenetic relationships. In The Yeasts. A Taxonomic Study, 4th edn, pp. 6974. Edited by C. P. Kurtzman & J. W. Fell. Amsterdam: Elsevier.
Lorberg, A., Kirchrath, L., Ernst, J. F. & Heinisch, J. J. (1999). Genetic and biochemical characterization of phosphofructokinase from the opportunistic pathogenic yeast Candida albicans. Eur J Biochem 260, 217226.[Medline]
Martínez-Costa, O. H., Estévez, A. M., Sánchez, V. & Aragón, J. J. (1994). Purification and properties of phosphofructokinase from Dictyostelium discoideum. Eur J Biochem 226, 10071017.[Medline]
Martínez-Costa, O. H., Hermida, C., Sánchez-Martínez, C., Santamaría, B. & Aragón, J. J. (2004). Identification of C-terminal motifs responsible for transmission of ATP inhibition of mammalian phosphofructokinase, and their contribution to other allosteric effects. Biochem J 377, 7784.[CrossRef][Medline]
Monod, J., Wyman, J. & Changeux, J.-P. (1965). On the nature allosteric transitions: a plausible model. J Mol Biol 12, 88118.[Medline]
Nomenclature Committee of the International Union of Biochemistry (1985). Nomenclature for incompletely specified bases in nucleic acid sequences. Recommendations 1984. Eur J Biochem 150, 15.[Medline]
Ogushi, S., Lawson, J. W. R., Dobson, G. P., Veech, R. L. & Uyeda, K. (1990). A new transient activator of phosphofructokinase during initiation of rapid glycolysis in brain. J Biol Chem 265, 1094310949.
Orosz, F., Santamaría, B., Ovádi, J. & Aragón, J. J. (1999). Phosphofructokinase from Dictyostelium discoideum is a potent inhibitor of tubulin polymerization. Biochemistry 38, 18571865.[CrossRef][Medline]
Petit, T. & Gancedo, C. (1999). Molecular cloning and characterization of the gene HXK1 encoding the hexokinase from Yarrowia lipolytica. Yeast 15, 15731581.[CrossRef][Medline]
Poorman, R. A., Randolph, A., Kemp, R. G. & Heinrikson, R. L. (1984). Evolution of phosphofructokinase: gene duplication and creation of new effector sites. Nature 309, 467469.[CrossRef][Medline]
Reuter, R., Naumann, M., Bär, J., Haferburg, D. & Kopperschläger, G. (2000). Purification, molecular and kinetic characterization of phosphofructokinase-1 from the yeast Schizosaccharomyces pombe: evidence for an unusual subunit composition. Yeast 16, 12731285.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schröter, A. & Kopperschläger, G. (1996). 6-phosphofructo-1-kinase from the lipid-accumulating, non-fermentative, red yeast Rhodotorula glutinis. FEMS Microbiol Lett 142, 247252.[CrossRef][Medline]
Shirakihara, Y. & Evans, P. R. (1988). Crystal structure of the complex of phosphofructokinase from Escherichia coli with its reaction products. J Mol Biol 204, 973994.[CrossRef][Medline]
Sikorski, R. S. & Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 1927.
Sols, A. (1981). Multimodulation of enzyme activity. Curr Top Cell Regul 19, 77101.[Medline]
Souciet, J., Aigle, M., Artiguenave, F. & 21 other authors (2000). Genomic exploration of the hemiascomycetous yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett 487, 312.[CrossRef][Medline]
Tornheim, K. (1988). Fructose 2,6-bisphosphate and glycolytic oscillations in skeletal muscle extracts. J Biol Chem 263, 26192624.
Uyeda, K. (1979). Phosphofructokinase. Adv Enzymol Relat Areas Mol Biol 48, 193244.[Medline]
Van Schaftingen, E. (1987). Fructose 2,6-bisphosphate. Adv Enzymol Relat Areas Mol Biol 59, 315395.[Medline]
Yuan, W., Tuttle, D. L., Shi, Y. J., Ralph, G. S. & Dunn, W. A., Jr (1997). Glucose-induced microautophagy in Pichia pastoris requires the alpha-subunit of phosphofructokinase. J Cell Sci 110, 19351945.[Abstract]
Received 27 December 2004;
revised 11 February 2005;
accepted 15 February 2005.
This article has been cited by other articles:
![]() |
C. Gancedo and C.-L. Flores Moonlighting Proteins in Yeasts Microbiol. Mol. Biol. Rev., March 1, 2008; 72(1): 197 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tanneberger, J. Kirchberger, J. Bar, W. Schellenberger, S. Rothemund, M. Kamprad, H. Otto, T. Schoneberg, and A. Edelmann A Novel Form of 6-Phosphofructokinase: IDENTIFICATION AND FUNCTIONAL RELEVANCE OF A THIRD TYPE OF SUBUNIT IN PICHIA PASTORIS J. Biol. Chem., August 10, 2007; 282(32): 23687 - 23697. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||