|
|
||||||||

,
1 Unité Toxines et Pathogénie Bactérienne (CNRS, URA 2172), Institut Pasteur, 28 rue du Dr Roux, 75724 Paris cedex 15, France
2 Unité de Biochimie Structurale (CNRS, URA 2185), Institut Pasteur, 28 rue du Dr Roux, 75724 Paris cedex 15, France
Correspondence
Agnès Fouet
afouet{at}pasteur.fr
| ABSTRACT |
|---|
|
|
|---|
Present address: Department of Molecular and Cell Biology 401, Barker Hall, UC Berkeley, Berkeley, CA 94720, USA.
These authors contributed equally to this work.
| INTRODUCTION |
|---|
|
|
|---|
The other domain appears to be a crystallization domain (Bingle et al., 1987
; Mesnage et al., 1997
, 1999
; Howorka et al., 2000
; Jarosch et al., 2001
; Smit et al., 2002
; Mader et al., 2004
). Recent studies have focused on the structurefunction relationships of this domain. Mutagenesis approaches, be they point mutations or deletions, have identified regions within the crystallization domain that are critical for array assembly (Howorka et al., 2000
; Sillanpää et al., 2000
; Jarosch et al., 2001
; Smit et al., 2002
). However, these analyses have not provided an overall picture of how an S-layer protein self-assembles to generate an ordered array. A conclusion is that only small portions of the crystallization domain can generally be deleted before its capacity to self-assemble is lost (Sillanpää et al., 2000
; Jarosch et al., 2001
; Smit et al., 2002
). Only a few research groups have carried out structural analysis of S-layer protein crystallization (Claus et al., 2002
; Jing et al., 2002
; Pavkov et al., 2003
), and the atomic structure remains unknown. The residues lining the pores and required for self-assembly remain to be identified.
Bacillus anthracis, the aetiological agent of anthrax, synthesizes two S-layer proteins: Sap and EA1 (Etienne-Toumelin et al., 1995
; Mesnage et al., 1997
). Both proteins have the same modular organization: an N-terminal anchoring domain consisting of three SLH motifs is fused to a C-terminal domain starting at residue 211, which is thought to be the crystallization domain (Mesnage et al., 1999
). In rich medium, B. anthracis cells are surrounded by a Sap S-layer during the exponential phase, which is replaced by an EA1 S-layer as the cells enter the stationary phase (Mignot et al., 2002
; Couture-Tosi et al., 2002
). The Sap S-layer presents a fibril-like structure, and the array unit cell has the following dimensions: a, 81 Å (8·1 nm); b, 184 Å (18·4 nm); and
, 96° (Couture-Tosi et al., 2002
). There is a possible p2 symmetry, but due to poor resolution on deflated bacteria, the molecular boundaries of each molecule could not be unambiguously defined. The projection map revealed several domains that repeat themselves along the two axes of the crystal. This subdomain organization is consistent with the analysis of Sap following digestion with proteinase K, since resistant fragments smaller than, and internal to, the 600 aa C-terminal domain were obtained (Mesnage et al., 1999
, and unpublished results).
In this work, we combined electron microscopy and genetics to analyse the 604 aa C-terminal (Sapc) domain, which is suggested to be the crystallization domain. For the genetic analysis, we took advantage of a bacterial (Bordetella pertussis) two-hybrid system to study the domains necessary for the interaction (Karimova et al., 1998
). By both approaches, we showed that Sapc is the crystallization domain. The peptides responsible for the observed interactions were further sought by screening interactions of a representative library of fragments with Sapc. We describe here the polypeptides obtained.
| METHODS |
|---|
|
|
|---|
|
-Galactosidase assays.
These assays were performed on toluene-treated bacterial suspensions, as described by Miller (1972)
. Each assay was carried out at least four times using two independent cultures.
Plasmid constructions.
A DNA fragment harbouring the 3'-terminal two-thirds of the sap gene, termed sapc, was amplified by PCR using Vent DNA polymerase (New England Biolabs) with oligonucleotides sap1 (TCGCAGCAAAAGTTGAATCTGCAAAAGCTGTTAC) and sap2 (ATTTTGTTGCAGGTTTTGCTTCTTTAATAGAAAC), and using B. anthracis 9131 chromosomal DNA as a template. The PCR fragments were phosphorylated using T4 polynucleotide kinase. The vectors pT25 and pT18, which encode T25 and T18 of Bor. pertussis adenylate cyclase, respectively, were cut with SmaI, and ligated to the phosphorylated DNA fragments, giving rise to pT25-sapc and pT18-sapc, respectively.
pKT25-n, pKT25-m and pKT25-c, which were obtained during the library screening (see Results and Discussion), were cut with BamHI and Acc65I, and ligated into pUT18 digested with the same enzymes, giving rise to pUT18-n, pUT18-m and pUT18-c, respectively.
Library construction.
A library was constructed in pKT25. Five micrograms of sapc PCR product was randomly sheared by sonication with two pulses of 15 s, each at 40 W, from a Branson sonifier cell disruptor B15. DNA fragments were treated with Vent DNA polymerase, and then phosphorylated and ligated into pKT25, which had been previously digested with SmaI, and dephosphorylated with calf intestine alkaline phosphatase.
Transformations.
E. coli strains TG1 and DHP1 were transformed for library construction and two-hybrid library screening, respectively, by electroporation. Electroporation was carried out with a Bio-Rad Gene Pulser apparatus at a capacitance of 25 µF, a resistance of 200
, and a voltage of 2·5 kV. Other transformations were carried out by the heat-shock method described by Chung & Miller (1988)
.
His6-Sapc purification.
Recombinant His6-Sapc was overproduced and extracted according to Mignot et al. (2002)
, and was purified according to the procedure recommended by the manufacturer (Pharmacia). The final concentration of the protein was between 1·3 and 1·5 mg ml1.
Two-dimensional crystallization on a lipid film.
A 1 µl volume of a lipid mixture was spread on the surface of a drop in a Teflon well (60 µl) containing a buffer consisting of Tris/HCl 50 mM, pH 8·0, NaCl 250 mM. The lipid mixture was made of the ligand lipid 1,2-dioleoyl-sn-glycero-3-{[N(5-amino-1-carboxypentyl)iminodiacetic acid]succinyl} (nickel salt) (Avanti Polar Lipids) and the diluting lipid dioleyl-phosphatidylcholine (Avanti Polar Lipids) at a molar ratio of 1 : 4 in chloroform/methanol (9 : 1, v/v), and at a final concentration of 0·1 mg ml1. After overnight incubation at room temperature in a humid chamber, 1 µl Sapc protein solution was injected below the lipid layer. Crystallization samples were incubated at room temperature in a humid chamber.
After 224 h, plane carbon-coated grids were placed on top of the crystallization wells, and left in contact with the interface. After 15 min, the grids were picked up, and the transferred surface was negatively stained with 2 % phosphotungstic acid.
Electron microscopy and image analysis.
Specimens were examined in a Philips CM12 electron microscope equipped with a LaB6 filament, operating at 120 kV. Suitable two-dimensional crystals were imaged on Kodak SO-163 film at a precalibrated electron optical magnification of x43 750, using low-dose techniques. Micrographs selected by optical diffraction were digitized at 7 µm pixel size with a SCAI (Zeiss), and the lattice parameters were determined by using Ximdisp (Smith, 1999
).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
The structural approach was a crystallization assay. A His6-Sapc two-dimensional crystallization was tested on a His-ligand-containing lipid film (Fig. 1
). The position of the histidine residues (N-extremity of the Sapc domain) was identical to that of the SLH anchoring domain in the Sap S-layer protein. Electron micrographs of two-dimensional crystals were selected by optical diffraction for their highly ordered area. The best images showed the (2,10) diffraction order in the power spectrum corresponding to 18 Å resolution. This result indicates that Sapc is sufficient to form a crystalline structure. Furthermore, the unit-cell parameters were calculated as: a, 81 Å; b, 180 Å;
, 96°. These values are in agreement with those of the Sap S-layer found at the surface of negatively stained deflated bacteria, which are: a, 81 Å; b, 184 Å; and
, 96° (Couture-Tosi et al., 2002
). This result indicates that Sapc constitutes the crystallization domain. This is consistent with other studies that have shown that the C-terminal domains of S-layer proteins, which begin with an anchoring domain, are the crystallization domains (Jarosch et al., 2001
; Rünzler et al., 2004
; Mader et al., 2004
).
|
|
Screening of the library for Sapc peptides that mediate the interaction with Sapc
We screened for peptides that interact with Sapc by expressing the library in the presence of T18-Sapc. Thirty-five clones yielded a positive signal, and were selected for further investigation. To confirm the specificity of the interactions, we checked that the expression of the peptide from each clone with T18 alone did not result in a detectable interaction. Seventeen of the 35 candidates were shown to be true positives. Plasmids from all positive clones were extracted, and the inserts were sequenced (Fig. 2
). As expected, all sequenced fragments were in-frame with the ORF encoding T25. This confirms the validity of the screen. It was noteworthy that no small fragments were isolated. Indeed, the sequenced inserts were between 465 bp (155 aa) and 1812 bp [604 residues, i.e. the size of the complete sapc (Sapc) sequence] (Fig. 2
). This is significantly higher than the mean fragment size of the library. The screening method is not biased towards fairly large fragments: small fragments have been shown to be efficient in promoting the adenylate cyclase domain interaction (35 aa for the leucine zipper; Karimova et al., 1998
). The fact that we did not isolate any small fragments hampered our initial goal, which was, in view of mutagenesis analysis, to determine small interacting peptides. However, it interestingly suggests that effective interactions require folded large polypeptides rather than specific sequence motifs.
|
Subdomain interactions
Analysis of the Sapc-interacting polypeptides showed that they are not clustered in a particular region of Sapc. The existence of three non-overlapping and quasi-contiguous polypeptides of between 155 and 210 aa (from clones 8, 9 and 13; Fig. 2
), each interacting with Sapc, suggested that Sapc is organized in three subdomains. These were termed N, M and C for the N-terminal, the central and the C-terminal polypeptide, respectively (Fig. 2
).
To check these interactions, we constructed the reciprocal two-hybrid system. The inserts from pKT25 encoding the N, M and C polypeptides were thus subcloned into pUT18, generating pUT18-n, pUT18-m and pUT18-c, respectively (Table 1
). The polypeptides encoded by all these plasmids interacted with T25-Sapc. Indeed, all transformants were red (Table 2
, row two). This confirms that the N, M and C polypeptides can interact with Sapc. It further suggests that their folding is independent of the nearby heterologous polypeptide, which is compatible with these being subdomains of the Sapc domain.
To study the polypeptideSapc interaction further, we analysed putative interactions between these polypeptides. We took advantage of having constructs with each polypeptide in both vectors to test polypeptide interactions. Due to the possible orientation bias, all nine combinations were tested by co-transformation of the E. coli cya strain (Table 2
, rows three, four and five). Only polypeptide M was able to yield an interaction, which was an auto-interaction. The failure of the other polypeptides to yield any interaction, except with the complete Sapc domain, suggests that the observed interactions, including the MM interaction, are significant. The unique MM interaction suggests that a similar interaction could exist in the crystal S-layer.
Concluding remarks
In this study we have shown by two independent approaches that Sapc is the crystallization domain. We took advantage of our genetic system to further dissect the molecular interactions that lead to the assembly of the crystal. Proportionally very few peptides gave rise to a positive signal, indicative of selectivity. These were large polypeptides, showing that this two-hybrid system can accommodate such fragments. The requirement for large polypeptides to drive the Sapc interaction may be characteristic of S-layer protein assembly, as biochemical analyses carried out on other S-layer proteins showed that large polypeptides are required for crystallization and self-assembly (Jarosch et al., 2001
; Sillanpää et al., 2000
; Smit et al., 2002
). Three-dimensional crystallography has never been successfully applied to complete S-layer proteins. To understand the structural role of the polypeptides defined herein, we will carry out three-dimensional crystallography on these Sapc fragments. The projection map of Sap can then be reappraised in view of the atomic-level determination of the subdomain structure (Couture-Tosi et al., 2002
).
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bingle, W. H., Engelhardt, H., Page, W. J. & Baumeister, W. (1987). Three-dimensional structure of the regular tetragonal surface layer of Azotobacter vinelandii. J Bacteriol 169, 50085015.
Chung, C. T. & Miller, R. H. (1988). A rapid and convenient method for the preparation and storage of competent bacterial cells. Nucleic Acids Res 16, 3580.
Claus, H., Akca, E., Debaerdemaeker, T., Evrard, C., Declercq, J. P. & Konig, H. (2002). Primary structure of selected archaeal mesophilic and extremely thermophilic outer surface layer proteins. Syst Appl Microbiol 25, 312.[CrossRef][Medline]
Couture-Tosi, E., Delacroix, H., Mignot, T., Mesnage, S., Chami, M., Fouet, A. & Mosser, G. (2002). Structural analysis and evidence for dynamic emergence of Bacillus anthracis S-layer networks. J Bacteriol 184, 64486456.
Egelseer, E. M., Leitner, K., Jarosch, M., Hotzy, C., Zayni, S., Sleytr, U. B. & Sára, M. (1998). The S-layer proteins of two Bacillus stearothermophilus wild-type strains are bound via their N-terminal region to a secondary cell wall polymer of identical chemical composition. J Bacteriol 180, 14881495.
Engelhardt, H. & Peters, J. (1998). Structural research on surface layers: a focus on stability, surface layer homology domains, and surface layer cell wall interactions. J Struct Biol 124, 276302.[CrossRef][Medline]
Etienne-Toumelin, I., Sirard, J.-C., Duflot, E., Mock, M. & Fouet, A. (1995). Characterization of the Bacillus anthracis S-layer: cloning and sequencing of the structural gene. J Bacteriol 177, 614620.
Gilmour, M. W., Gunton, J. E., Lawley, T. D. & Taylor, D. E. (2003). Interaction between the IncHI1 plasmid R27 coupling protein and type IV secretion system: TraG associates with the coiled-coil mating pair formation protein TrhB. Mol Microbiol 49, 105116.[CrossRef][Medline]
Gropp, M., Strausz, Y., Gross, M. & Glaser, G. (2001). Regulation of Escherichia coli RelA requires oligomerization of the C-terminal domain. J Bacteriol 183, 570579.
Howorka, S., Sára, M., Wang, Y. J., Kuen, B., Sleytr, U. B., Lubitz, W. & Bayley, H. (2000). Surface-accessible residues in the monomeric and assembled forms of a bacterial surface layer protein. J Biol Chem 275, 3787637886.
Ilk, N., Kosma, P., Puchberger, M., Egelseer, E. M., Mayer, H. F., Sleytr, U. B. & Sára, M. (1999). Structural and functional analyses of the secondary cell wall polymer of Bacillus sphaericus CCM 2177 that serves as an S-layer-specific anchor. J Bacteriol 181, 76437646.
Jarosch, M., Egelseer, E. M., Mattanovich, D., Sleytr, U. B. & Sára, M. (2000). S-layer gene sbsC of Bacillus stearothermophilus ATCC 12980: molecular characterization and heterologous expression in Escherichia coli. Microbiology 146, 273281.
Jarosch, M., Egelseer, E. M., Huber, C., Moll, D., Mattanovich, D., Sleytr, U. B. & Sára, M. (2001). Analysis of the structurefunction relationship of the S-layer protein SbsC of Bacillus stearothermophilus ATCC 12980 by producing truncated forms. Microbiology 147, 13531363.
Jing, H., Takagi, J., Liu, J. H., Lindgren, S., Zhang, R. G., Joachimiak, A., Wang, J. H. & Springer, T. A. (2002). Archaeal surface layer proteins contain
propeller, PKD, and
helix domains and are related to metazoan cell surface proteins. Structure 10, 14531464.[Medline]
Jobling, M. G. & Holmes, R. K. (2000). Identification of motifs in cholera toxin A1 polypeptide that are required for its interaction with human ADP-ribosylation factor 6 in a bacterial two-hybrid system. Proc Natl Acad Sci U S A 97, 1466214667.
Karimova, G., Pidoux, J., Ullmann, A. & Ladant, D. (1998). A bacterial two-hybrid system based on a reconstituted signal transduction pathway. Proc Natl Acad Sci U S A 95, 57525756.
Karimova, G., Ullmann, A. & Ladant, D. (2000). Bordetella pertussis adenylate cyclase toxin as a tool to analyze molecular interactions in a bacterial two-hybrid system. Int J Med Microbiol 290, 441445.[Medline]
Karimova, G., Ullmann, A. & Ladant, D. (2001). Proteinprotein interaction between Bacillus stearothermophilus tyrosyl-tRNA synthetase subdomains revealed by a bacterial two-hybrid system. J Mol Microbiol Biotechnol 3, 7382.[Medline]
Lupas, A., Engelhardt, H., Peters, J., Santarius, U., Volker, S. & Baumeister, W. (1994). Domain structure of the Acetogenium kivui surface layer revealed by electron crystallography and sequence analysis. J Bacteriol 176, 12241233.
Mader, C., Huber, C., Moll, D., Sleytr, U. B. & Sára, M. (2004). Interaction of the crystalline bacterial cell surface layer protein SbsB and the secondary cell wall polymer of Geobacillus stearothermophilus PV72 assessed by real-time surface plasmon resonance biosensor technology. J Bacteriol 186, 17581768.
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Mesnage, S., Tosi-Couture, E., Mock, M., Gounon, P. & Fouet, A. (1997). Molecular characterization of the Bacillus anthracis main S-layer component: evidence that it is the major cell-associated antigen. Mol Microbiol 23, 11471155.[CrossRef][Medline]
Mesnage, S., Tosi-Couture, E. & Fouet, A. (1999). Production and cell surface anchoring of functional fusions between the SLH motifs of the Bacillus anthracis S-layer proteins and the Bacillus subtilis levansucrase. Mol Microbiol 31, 927936.[CrossRef][Medline]
Mesnage, S., Fontaine, T., Mignot, T., Delepierre, M., Mock, M. & Fouet, A. (2000). Bacterial SLH domain proteins are non-covalently anchored to the cell surface via a conserved mechanism involving wall polysaccharide pyruvylation. EMBO J 19, 44734484.[CrossRef][Medline]
Mignot, T., Mesnage, S., Couture-Tosi, E., Mock, M. & Fouet, A. (2002). Developmental switch of S-layer protein synthesis in Bacillus anthracis. Mol Microbiol 43, 16151627.[CrossRef][Medline]
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Pavkov, T., Oberer, M., Egelseer, E. M., Sára, M., Sleytr, U. B. & Keller, W. (2003). Crystallization and preliminary structure determination of the C-terminal truncated domain of the S-layer protein SbsC. Acta Cryst D59, 14661468.
Rünzler, D., Huber, C., Moll, D., Köhler, G. & Sára, M. (2004). Biophysical characterization of the entire bacterial surface layer protein SbsB and its two distinct functional domains. J Biol Chem 279, 52075215.
Sára, M. & Sleytr, U. B. (2000). S-layer proteins. J Bacteriol 182, 859868.
Sára, M., Kuen, B., Mayer, H. F., Mandl, F., Schuster, K. C. & Sleytr, U. B. (1996). Dynamics in oxygen-induced changes in S-layer protein synthesis from Bacillus stearothermophilus PV72 and the S-layer-deficient variant T5 in continuous culture and studies of the cell wall composition. J Bacteriol 178, 21082117.
Sillanpää, J., Martínez, B., Antikainen, J. & 9 other authors (2000). Characterization of the collagen-binding S-layer protein CbsA of Lactobacillus crispatus. J Bacteriol 182, 64406450.
Smit, E., Oling, F., Demel, R., Martinez, B. & Pouwels, P. H. (2001). The S-layer protein of Lactobacillus acidophilus ATCC 4356: identification and characterisation of domains responsible for S-protein assembly and cell wall binding. J Mol Biol 305, 245257.[CrossRef][Medline]
Smit, E., Jager, D., Martinez, B., Tielen, F. J. & Pouwels, P. H. (2002). Structural and functional analysis of the S-layer protein crystallisation domain of Lactobacillus acidophilus ATCC 4356: evidence for proteinprotein interaction of two subdomains. J Mol Biol 324, 953964.[CrossRef][Medline]
Smith, J. M. (1999). Ximdisp a visualization tool to aid structure determination from electron microscope images. J Struct Biol 125, 223228.[CrossRef][Medline]
Received 14 December 2004;
revised 20 January 2005;
accepted 28 January 2005.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |