|
|
||||||||


1 Molecular Biology Institute, University of California, Los Angeles, CA 90095-1668, USA
2 Department of Microbiology, Immunology and Molecular Genetics, University of California, Los Angeles, CA 90095-1668, USA
3 School of Dentistry, University of California, Los Angeles, CA 90095-1668, USA
4 Department of Biology, Syracuse University, Syracuse, NY 13244, USA
5 School of Molecular Biosciences, Washington State University, Pullman, WA 99164, USA
Correspondence
Wenyuan Shi
wenyuan{at}ucla.edu
| ABSTRACT |
|---|
|
|
|---|
Present address: Cardiovascular Research Institute, University of California, San Francisco, CA 94143-0130, USA.
Present address: Pediatric Cardiac Surgery Research Laboratory, Department of Cardiothoracic Surgery, Stanford University, School of Medicine, Stanford, CA 94305-5407, USA.
| INTRODUCTION |
|---|
|
|
|---|
The dif system was found to be necessary for S-motility, fibril (exopolysaccharide, EPS) production and fruiting-body formation (Yang et al., 1998
, 2000
). The operon was originally believed to have five possible genes that encode a set of proteins homologous to Escherichia coli chemotaxis proteins: DifA is homologous to the chemoreceptor MCP (methyl-accepting chemotaxis protein), DifC is homologous to CheW, DifD is homologous to the response regulator CheY, and DifE is homologous to CheA, a sensor histidine kinase. Another ORF (designated DifB) has no known protein homologies in the NCBI protein database. A recent study by Lancero et al. (2002)
found a sixth possible dif gene in the operon, and designated it DifF. DifF has 27 % identity to CheC of Bacillus subtilis (Helmann et al., 1988
). The study by Lancero et al. (2002)
also found that most previously isolated dsp mutants were actually dif mutants.
The aim of this study was to analyse the interactions between the known Dif proteins in the operon, and to search for new Dif-interacting proteins that are part of the Dif signalling pathway. Using the yeast two-hybrid system, we studied the protein partners of the Dif proteins, and based on our findings we propose a model for the Dif signalling pathway.
| METHODS |
|---|
|
|
|---|
|
|
Known dif genes were constructed into the bait vector (pGBD) and the prey vector (pGAD) (Table 3
). Given the fact that DifA has a transmembrane domain that may have limited functions in yeast two-hybrid analyses, we made two versions of DifA: the full-length DifA (DifAfull) and the cytoplasmic portion only (DifAcyto) (Table 3
). Each PCR product was ligated in-frame into the multiple cloning site of pGBD-C1 (bait vector) and pGAD-C1 (prey vector).
|
For the one-on-one interactions, the yeast transformants were plated on low-, medium- and high-stringency media. The transformants that grew on all three media were considered strong interactions. The positive clones that grew on the high-stringency medium were further confirmed with colour change on a
-galactosidase filter paper using the flash-freezing filter assay (James et al., 1996
), and examined with the
-galactosidase assay described below.
For genomic library screens, transformations were performed using the lithium acetate method (Sambrook et al., 1989
), and plated on low- and medium-stringency media. For each interaction, colonies were counted on the low-stringency medium to calculate transformation efficiency; more than four times coverage of the genome was calculated. The colonies that grew on the medium-stringency agar were transferred to high-stringency agar to screen for GAL2-ADE2 reporter activity. Colonies that grew on the high-stringency medium were tested for
-galactosidase activity using the assays described above and below. Plasmids from the positive clones were extracted and sequenced at the UCLA Genetic Core Facility.
-Galactosidase assay.
The yeast cultures were transferred into fresh medium, grown to mid-exponential phase, pelleted and resuspended in 50 µl STES buffer [0·2 M Tris/HCl (pH 7·6); 0·5 M NaCl; 0·1 % (w/v) SDS; 0·01 M EDTA]. Glass beads (0·5 mm, Fisher Scientific) and 20 µl TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 7·6) were added to each tube. This mixture was vortexed vigorously (4 min) at room temperature in a Turbo Mixer (Scientific Industries), and centrifuged at maximum speed for 5 min. The supernatant was transferred into 1·1 ml Z-buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4; pH 7·0), supplemented with 50 mM
-mercaptoethanol. A 100 µl volume of this suspension was used to determine the protein concentration of the sample. The remaining sample was used to measure
-galactosidase activity with ONPG (4 mg ml1 in Z-buffer) as a substrate. One unit (U) of enzyme activity corresponds to the hydrolysis of 1 nmol ONPG min1 (mg protein)1.
Construction of genetic mutants.
The in-frame
difB mutant (HL400) was constructed according to the following PCR fusion procedure, as described by Ho et al. (1989)
. The primers were engineered to have an EcoRI site at the 5' end, and a BamHI site at the 3' end (shown in lower-case letters). For the first PCR, two fragments, the EcoRI fragment and the BamHI fragment, were amplified. The EcoRI fragment (1250 bp) was amplified using the following primer pair: gaattcATGGGGCTGGCGCTGACG and CGTCTGGCTCATGGGCCCAGGCGGAAGCTGCGCACGAC. The BamHI fragment (474 bp) was amplified using the following primer pair: CCATGAGCCAGACGGCGGCGGGTTCGTCCCGG TCGAAG and cgggatcccgTCACTTGGAATGGGTGAA. For the ligation, 1 µl EcoRI fragment and 1 µl BamHI fragment from the PCR reaction mix were combined as the template. The following primers were used for the PCR ligation reaction: gaattcATGGGGCTGGCGCTGACG and cgggatcccgTCA CTTGGAATGGGTGAA. The resulting 1724 bp PCR fragment was cloned into PCRII-TOPO vector according to the protocol of the manufacturer (Invitrogen) to create pTOPOBKO. The fragment was digested with EcoRI and BamHI, and ligated into pBJ113 to produce pDIFBKO. pDIFBKO was transferred into M. xanthus through electroporation, as described by Kashefi & Hartzell (1995)
. Chromosomal integration was selected by plating the cells onto CYE agar containing 100 µg kanamycin ml1 (positive selection). The Kanr transformants (plasmids cannot replicate in M. xanthus) were plated onto CYE agar containing 1 % galactose for negative selection. Southern blot analysis was used to screen the galactose-resistant (Kanr Gals) mutants for proper excision of difB (Ueki et al., 1996
).
The yidC mutant (YIDC1) was constructed by amplifying a 600 bp internal region of yidC using the following primer pair, in which lower-case letters denote BamHI and EcoRI sites, respectively: cgggatcccgTGGGGTCGATGGCGCGGT and gaattcCGGTGCCGTGACGAGGGGT. The fragment was cloned into the PCRII-TOPO vector (according to the manufacturer's protocol) to create pYIDC1. pYIDC1 was transferred into M. xanthus DK1622 through electroporation, as described by Kashefi & Hartzell (1995)
. The insertional mutation was confirmed with PCR and Southern blotting (Sambrook et al., 1989
). The yidCdifB double mutant (HL800) was constructed by electroporating pYIDC1 into
difB (HL400), and selecting for Kanr transformants.
The nla19 mutant (AG319) was constructed as described by Caberoy et al. (2003)
. Briefly, to generate plasmid pNBC19, a 523 bp internal fragment of the nla19 gene was cloned into the pCRII-TOPO vector using the procedure described by the manufacturer. Next, plasmid pNBC19 was electroporated into DK1622 cells using the technique of Kashefi & Hartzell (1995)
. Chromosomal DNA was isolated from Kanr colonies, and used for Southern blot analysis to identify strains carrying an nla19 insertion mutation. SC100 and SC101 strains were constructed by transducing the nla19 mutation into DK1217 (aglB1) and DK1300 (sglG1), respectively (Hodgkin & Kaiser, 1979b
).
Phenotypic characterization.
For characterization of the developmental phenotypes, cells from overnight cultures were resuspended in MOPS buffer (10 mM MOPS, 8 mM Mg2+, 8 mM Ca2+) at about 5x109 cells ml1, spotted on MOPS plates (20 µl spots), and incubated at 32 °C for 2 days. For characterization of fibril carbohydrates (EPS), 5 µl of 5x107 cells ml1 was spotted on 1·5 % CYE containing 5 µg ml1 Calcofluor White (CW), incubated at 32 °C for 5 days, and visualized under long-wave UV light. Trypan Blue (TB) assays (Black & Yang, 2004
) were also performed to characterize the EPS on the cell surface. All strains tested were resuspended to approximately 2·8x108 cells ml1 in MOPS buffer. Stock solutions of the dyes were prepared in deionized distilled water at 100 µg ml1. A 1 : 10 dilution of dye stock to cell suspension was mixed to give a final concentration of 10 µg ml1. Control samples, containing each dye in MOPS buffer only, were included, and triplicate assays were performed for all samples. All samples were vortexed briefly, and incubated undisturbed in the dark at room temperature for 30 min. The cell suspensions were then pelleted at 16 000 g in a benchtop centrifuge for 5 min, and the absorbance of the supernatants was measured at 585 nm. For the agglutination assay, an overnight culture was resuspended in MOPS buffer at an OD600 of 0·5. Readings were taken for 2 h. For swarming assays, 5 µl of 5x107 cells ml1 were spotted on 1·5 % CYE agar or 0·3 % CYE agar, incubated at 32 °C for 5 days, and the colony edges were observed by phase-contrast microscopy.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
Most interesting, as shown in Table 5
, the DifB bait was able to pull out an interacting protein which had strong homology with a membrane protein called YidC, which was also found in E. coli, and in lower eukaryotes and plants (Dalbey & Kuhn, 2004
; Jiang et al., 2002
; Samuelson et al., 2000
; Urbanus et al., 2002
). Furthermore, the DifE bait was able to pull out Nla19, an NtrC-like protein found to be involved in delayed aggregation and fruiting body formation (Caberoy et al., 2003
). Both interactions were further confirmed in the one-on-one interaction experiment, although the interaction between DifE and Nla19 was relatively weak compared with the DifBYidC interaction (Table 5
).
Genetic and phenotypic characterization of difB, yidC and nla19 for their roles in fibril (EPS) production, S-motility and development
In this part of the study, we used a genetic approach to examine whether these newly identified Dif-interaction proteins are indeed involved in development, S-motility and fibril (EPS) production. As described in Methods, and presented in Table 1
, we constructed difB, yidC, difByidC and nla19 mutants for phenotypic characterization. CW and TB are two different assays that test for the presence of fibrils (EPS) (see Methods). As shown in Table 6
, difB and yidC mutants, and the difByidC double mutant, had wild-type levels of fibrils (EPS). Furthermore, results of assays that measure A- and S-motility on soft agar plates (0·3 % agar) and hard agar plates (1·5 % agar) (Shi & Zusman, 1993
), as well as development, were found to be similar to the wild-type (Table 6
). However, nla19 was found to have increased fibril (EPS) production and defects in S-motility (Table 6
), suggesting that it may be part of the Dif signalling pathway.
|
|
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Black, W. P. & Yang, Z. (2004). Myxococcus xanthus chemotaxis homologs DifD and DifG negatively regulate fibril polysaccharide production. J Bacteriol 186, 10011008.
Blackhart, B. D. & Zusman, D. R. (1985). Cloning and complementation analysis of the "Frizzy" genes of Myxococcus xanthus. Mol Gen Genet 198, 243254.[CrossRef][Medline]
Caberoy, N. B., Welch, R. D., Jakobsen, J. S., Slater, S. C. & Garza, A. G. (2003). Global mutational analysis of NtrC-like activators in Myxococcus xanthus: identifying activator mutants defective for motility and fruiting body development. J Bacteriol 185, 60836094.
Campos, J. M., Geisselsoder, J. & Zusman, D. R. (1978). Isolation of bacteriophage MX4, a generalized transducing phage for Myxococcus xanthus. J Mol Biol 119, 167178.[CrossRef][Medline]
Dalbey, R. E. & Kuhn, A. (2004). YidC family members are involved in the membrane insertion, lateral integration, folding, and assembly of membrane proteins. J Cell Biol 166, 769774.
Eisenbach, M. (1996). Control of bacterial chemotaxis. Mol Microbiol 20, 903910.[Medline]
Garrity, L. F. & Ordal, G. W. (1995). Chemotaxis in Bacillus subtilis: how bacteria monitor environmental signals. Pharmacol Ther 68, 87104.[CrossRef][Medline]
Grebe, T. W. & Stock, J. (1998). Bacterial chemotaxis: the five sensors of a bacterium. Curr Biol 8, R154R157.[CrossRef][Medline]
Helmann, J. D., Marquez, L. M. & Chamberlin, M. J. (1988). Cloning, sequencing, and disruption of the Bacillus subtilis sigma 28 gene. J Bacteriol 170, 15681574.
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 5159.[CrossRef][Medline]
Hodgkin, J. & Kaiser, D. (1979a). Genetics of gliding motility in Myxococcus xanthus (Myxobacterales): genes controlling movement of single cells. Mol Gen Genet 171, 167176.[CrossRef]
Hodgkin, J. & Kaiser, D. (1979b). Genetics of gliding motility in Myxococcus xanthus: two gene systems control movement. Mol Gen Genet 171, 177191.[CrossRef]
James, P., Halladay, J. & Craig, E. A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 14251436.[Abstract]
Jiang, F., Yi, L., Moore, M., Chen, M., Rohl, T., Van Wijk, K. J., De Gier, J. W., Henry, R. & Dalbey, R. E. (2002). Chloroplast YidC homolog Albino3 can functionally complement the bacterial YidC depletion strain and promote membrane insertion of both bacterial and chloroplast thylakoid proteins. J Biol Chem 277, 1928119288.
Kaiser, D. (1979). Social gliding is correlated with the presence of pili in Myxococcus xanthus. Proc Natl Acad Sci U S A 76, 59525956.
Kashefi, K. & Hartzell, P. L. (1995). Genetic suppression and phenotypic masking of a Myxococcus xanthus frzF defect. Mol Microbiol 15, 483494.[CrossRef][Medline]
Kirby, J. R. & Zusman, D. R. (2003). Chemosensory regulation of developmental gene expression in Myxococcus xanthus. Proc Natl Acad Sci U S A 100, 20082013.
Lancero, H., Brofft, J. E., Downard, J., Birren, B. W., Nusbaum, C., Naylor, J., Shi, W. & Shimkets, L. J. (2002). Mapping of Myxococcus xanthus social motility dsp mutations to the dif genes. J Bacteriol 184, 14621465.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Samuelson, J. C., Chen, M., Jiang, F., Moller, I., Wiedmann, M., Kuhn, A., Phillips, G. J. & Dalbey, R. E. (2000). YidC mediates membrane protein insertion in bacteria. Nature 406, 637641.[CrossRef][Medline]
Shi, W. & Zusman, D. R. (1993). The two motility systems of Myxococcus xanthus show different selective advantages on various surfaces. Proc Natl Acad Sci U S A 90, 33783382.
Thomasson, B., Link, J., Stassinopoulos, A. G., Burke, N., Plamann, L. & Hartzell, P. L. (2002). MglA, a small GTPase, interacts with a tyrosine kinase to control type IV pili-mediated motility and development of Myxococcus xanthus. Mol Microbiol 46, 13991413.[CrossRef][Medline]
Ueki, T., Inouye, S. & Inouye, M. (1996). Positivenegative KG cassettes for construction of multi-gene deletions using a single drug marker. Gene 183, 153157.[CrossRef][Medline]
Urbanus, M. L., Froderberg, L., Drew, D., Bjork, P., de Gier, J. W., Brunner, J., Oudega, B. & Luirink, J. (2002). Targeting, insertion, and localization of Escherichia coli YidC. J Biol Chem 277, 1271812723.
Vlamakis, H. C., Kirby, J. R. & Zusman, D. R. (2004). The Che4 pathway of Myxococcus xanthus regulates type IV pilus-mediated motility. Mol Microbiol 52, 17991811.[CrossRef][Medline]
Ward, M. J. & Zusman, D. R. (1999). Motility in Myxococcus xanthus and its role in developmental aggregation. Curr Opin Microbiol 2, 624629.[CrossRef][Medline]
Yang, Z., Geng, Y., Xu, D., Kaplan, H. B. & Shi, W. (1998). A new set of chemotaxis homologues is essential for Myxococcus xanthus social motility. Mol Microbiol 30, 11231130.[CrossRef][Medline]
Yang, Z., Ma, X., Tong, L., Kaplan, H. B., Shimkets, L. J. & Shi, W. (2000). Myxococcus xanthus dif genes are required for biogenesis of cell surface fibrils essential for social gliding motility. J Bacteriol 182, 57935798.
Zusman, D. R. (1982). "Frizzy" mutants: a new class of aggregation-defective developmental mutants of Myxococcus xanthus. J Bacteriol 150, 14301437.
Received 1 November 2004;
revised 6 January 2005;
accepted 10 January 2005.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |