|
|
||||||||
1 University of Cambridge, Department of Pathology, Tennis Court Road, Cambridge CB2 1QP, UK
2 Genome Damage and Stability Centre, University of Sussex, Science Park Road, Falmer, Brighton BN1 9QG, UK
Correspondence
Graham P. Stafford
gps25{at}cam.ac.uk
| ABSTRACT |
|---|
|
|
|---|
70 promoters, as is the case with FlhD2C2-dependent class II flagellar promoters. The data indicate a wider FlhD2C2 regulon, in which non-flagellar genes are bound and activated directly, albeit less strongly, by the same mechanism as that regulating the flagella gene hierarchy.
| INTRODUCTION |
|---|
|
|
|---|
28 that switches on class III genes encoding chemotaxis proteins and the structural subunits of the flagellum (Chadsey et al., 1998
In addition to its role in swimming motility, the flhDC operon is pivotal to multicellular swarming migration (Allison & Hughes, 1991
; Fraser et al., 2002
), during which it is strongly upregulated, and contributes to virulence-factor expression in several pathogens (Allison et al., 1994
; Dufour et al., 1998
; Young et al., 1999
; Kim et al., 2003
). In addition, microarray comparisons of mRNA levels from E. coli wild-type and flhDC mutant strains have suggested that the flagellar master operon regulates several non-flagellar genes (Prüss et al., 2001
, 2003
). These observations have encouraged the concept of a substantial flhDC transcriptional regulon, but it is not clear whether flhDC-dependent regulation is determined directly by FlhD2C2 binding to non-flagellar promoters or reflects indirect pathways in which FlhD2C2 acts by influencing other regulators.
DNase footprinting and primer extension analyses of class II flagellar promoter sequences from P. mirabilis, E. coli and S. typhimurium (Kutsukake et al., 1990
; Liu & Matsumura, 1996
; Claret & Hughes, 2002
) have generated a consensus FlhD2C2 binding sequence of a 4244 bp imperfect inverted repeat in which two FlhD2C2 box arms, each AA(C/T)G(C/G)N2/3AAATA(A/G)CG, are separated by a non-conserved spacer of 1012 nucleotides (N1012) (Claret & Hughes, 2002
). To assess the nature and extent of the proposed flhDC regulon, we have used this consensus recognition sequence to identify putative target genes in the E. coli genome. Putative target promoters identified were assayed by in vitro binding of reconstituted, transcriptionally active FlhD2C2, and by in vivo FlhD2C2-dependent transcription of the chromosomal genes.
| METHODS |
|---|
|
|
|---|
4·64x106 possible 4244 base sequences of the genome by adding the HI for appropriately spaced (N1012) inverted FlhD2C2 box arms. This allowed identification of sites with a range of HI values from 6·1 upwards. A perfect consensus binding site would have an HI value of 0, with HI values above 20 indicating weak potential for true FlhD2C2 binding, judging from their high frequency (
500), and previous experiments on other regulons (Berg & Von Hippel, 1988
Bacterial strains.
E. coli strains were grown at 37 °C in LB broth or on LB agar. E. coli XL-1 Blue or XL10 Gold (Stratagene) transformants were selected by appropriate antibiotics (gentamicin, 5 µg ml1; kanamycin and ampicillin, 50 µg ml1) plus 80 µg X-Gal ml1 and 20 mM IPTG. Motile E. coli MC1000 wild-type and the non-motile flhD : : km derivative containing a polar Tn5 transposon insertion were obtained from B. Prüss (University of Illinois, Chicago, USA). E. coli MC1000 strains fur : : km, fliA : : km and hns : : km were created by P1 phage transduction from MC4100 hns : : km, MG1655 fliA : : km and MC4100 fur : : km, obtained from Simon Andrews (University of Reading, UK) and the University of Wisconsin E. coli genome project (Kang et al., 2004
).
In vitro DNA binding.
The FlhD and FlhC proteins were expressed separately in E. coli BL21 DE3 from plasmids pET11-FlhD and pET15-FlhC and recovered from insoluble pellets after cell lysis in a French pressure cell, as previously described (Claret & Hughes, 2000a
). The FlhD pellet was resuspended in 6 M urea, 20 mM Tris/HCl (pH 8·0), and the protein purified by anion-exchange chromotography; the FlhC pellet was resuspended in 6 M guanidine/HCl, pH 8·0, and His-tagged FlhC protein was affinity purified by Ni-NTA chromatography. The two proteins were mixed, refolded and solubulized during dialysis against binding buffer (20 mM Tris/HCl, pH 8·0, 0·1 M NaCl, 0·1 mM EDTA, 1 mM DTT, 1 mM MgCl2, 100 mg BSA ml1, 15 %, w/v, glycerol) according to Claret & Hughes (2000a)
to form the transcriptionally active FlhD2C2 complex. The His-tagged FlhC is comparable to the native FlhC in FlhD2C2 complex formation and DNA binding, and was able to complement the non-motile phenotype of an flhC mutant (not shown). The complex was pre-incubated in 20 ml binding buffer for 20 min at 25 °C, then incubated for 20 min with radiolabelled DNA probes of 175226 bp PCR amplified from the E. coli chromosome with Pfu Turbo polymerase and oligonucleotide primers containing EcoRI and BamHI sites. Each PCR product was digested with EcoRI and dephosphorylated by calf intestinal alkaline phosphatase (Roche) before 5' phosphorylation with [
-32P]ATP (Amersham) using phage T4 polynucleotide kinase (NEB) and purification on a 5 % (w/v) polyacrylamide gel containing 1x TBE (100 mM Tris/borate, pH 8·3, 2 mM EDTA). The resulting end-labelled probes were included at a concentration of 0·3 nM (i.e. providing a molar excess of protein complex) with a 1000-fold excess of non-specific competitior poly(dIdC). After electrophoresis of DNA : protein complexes through 6 % polyacrylamide (0·5x TBE), the gels were dried and the relative intensities of the bound/unbound DNA were detected using a cyclone phosphorimager and quantified by OPTIQUANT software (Packard). Binding affinity was expressed as KD, the concentration of FlhD2C2 complex required to achieve a ratio of 1 : 1 for the free : bound DNA probe. All assays were performed at least twice and the mean binding affinities (KD) reported.
Construction of chromosomal transcriptional fusions.
Plasmid pGPS123 was constructed by excision of the kanamycin resistance gene of pRS551 (Simons et al., 1987
) using XhoI and HindIII and replacement with the gentamicin resistance cassette of p34SGm (Dennis & Zylstra, 1998
). DNA sequences used as probes in in vitro DNA-band shift assays were PCR amplified with Pfu Turbo polymerase from the E. coli chromosome using specific oligonucleotide primers that each generated a 5' EcoRI site and a 3' BamHI site. DNA fragments were cleaned using QIAspin columns (Qiagen), digested with EcoRI and BamHI, and ligated with EcoRI/BamHI digested pGPS123. After transformation into E. coli XL1 Blue or XL10, blue GmR colonies were selected, and inserts verified by PCR and sequencing (Department of Genetics, University of Cambridge) using vector-specific primers.
The flhB-80 promoter fragment was obtained by first amplifying the FlhD2C2 binding site plus 95 bp of 5' DNA using primers FlhBFor (TTGAATTCATGGTGGCGTGACCACCACGTCAT) and FlhB-DCRev (TAGCCGCGGTGATGCCAGAAAAAAACCCCGTCACGTTCAAGCTTAATGGTTGAGTAAGG), then the
70 promoter plus 57 bp of 3' DNA using primers FlhBRev (CGGGATCCTTTTGTCGTCGCTCTCG) and FlhBs70 (TAGCCCGCGGTGATGCGCTTGATGGCCGAGTCTCCGATTACAAGCTTGAACGCTTTGCGC). These two primers contain SacII restriction sites (CCGCGG) at their 5' ends, allowing ligation of the PCR products to form the 270 bp flhB-80 fragment construct and its cloning into pGPS123. The source of the intervening extra sequence in primers FlhBs70For and FlhB-DCRev is the flhA gene, which contains no transcriptional features.
MC1000 strains containing each pGPS123 transcriptional-fusion-bearing plasmid were individually infected with phage
RS45, and lysates were used to produce blue GmR ApS lysogen colonies (Simons et al., 1987
). Fusion inserts in the chromosome were confirmed by sequencing using vector- and insert-specific primers, and correct insertion into the
att site was verified according to the method of Powell et al. (1994)
.
The flhDC complementation plasmid pflhDC was constructed by amplification of the flhDC genes and flanking DNA containing the native promoter sequence, using the primers DC-coliF (GGAATTCTGCGCAACATCCCATTTCG) and DC-coliR (GGGAATTCCAGTTAAACAGCCTGTACTCT), restriction with EcoRI, and ligation into EcoRI-restricted pAcTrc (provided by Dr Gillian Fraser, Department of Pathology, University of Cambridge).
In vivo assay of transcription activity.
Chromosomal transcriptional fusion expression was assessed as whole-cell
-galactosidase activity (Miller, 1972
). Triplicate overnight cultures were diluted to OD600=0·001 in LB and sampled hourly during batch culture. We performed the assays at 37 °C.
The E. coli MC1000 strain showed comparable motility at 37 °C and 30 °C (not shown), in agreement with observations of constant swimming speeds between 24 °C and 37 °C, and comparable FliC protein and transcript levels over a similar temperature range (Adler & Templeton, 1967
; Mizushima et al., 1994
). Activities were recorded as means of at least three cultures. In complementation experiments, flhDC was provided in trans by expression without induction from the plasmid pflhDC.
| RESULTS |
|---|
|
|
|---|
The search identified 7834 genome sequences with an HI lower than 25, while 499 had an HI below 20, and 145 an HI equal to or below 18. Of the 145 sequences, 99 were within coding sequences and/or located more than 250 bp 5' of predicted start codons. These were excluded, since the known FlhD2C2 binding sequences of flagellar class II promoters are all between 74 bp and 160 bp 5' of their respective start codons. This left 47 putative FlhD2C2 binding sequences with an HI lower than our arbitrary cut-off of 18 or in non-coding sequence close to genes putatively transcribed alone or in operons. These are listed in Table 1
with the known or indicated function of the gene immediately 3' of the promoter. This number is comparable with the 69 putative LexA regulon binding sites similarly identified with an HI lower than 15 (Fernandez de Henestrosa et al., 2000
). The 47 promoter regions are estimated to control 86 of the 4287 predicted ORFs in the E. coli genome (http://genolist.pasteur.fr/Colibri/help/current.html).
|
In vitro binding of FlhD2C2 to target sites of the E. coli genome
The theoretical assumptions underlying this search approach have been validated by experimental binding affinities of the CRP and LexA proteins for target promoters of their regulons (Berg & Von Hippel, 1988
; Lewis et al., 1994
; Fernandez De Henestrosa et al., 2000
). In our studies, DNA-band shift assays were used to assess recognition by the FlhD2C2 complex of 13 representative sequence targets with low HI chosen from the 47 listed in Table 1
. Four were located 5'of the flagellar operons flgB (HI 6·1), flhB (HI 11·9), fliA (HI 13·1) and fliL (HI 14·7), representing a range of HI, to establish a positive control dataset for the study. Nine were upstream of the putative non-flagella targets b1904 (HI 10·9), b2446 (HI 11·5), yejO (HI 13·7), gltI (HI 13·7), icc (HI 14·1), yegH (HI 14·6), hns (HI 14·7), wzzfepE (HI 14·9) and hupB (HI 15·5). Two sequences with HI scores outside the 18 cut-off, rcsA (HI 18·8) and argR (18·7), were assessed in parallel as negative controls. In each case, a radiolabelled probe of 150230 bp, containing the putative FlhD2C2 binding site near its centre, was made by PCR amplification of genomic DNA from E. coli MC1000. Each probe was incubated with increasing concentrations of transcriptionally active heterotetrameric FlhD2C2 complex reconstituted from purified FlhD and FlhC proteins (Claret & Hughes, 2000b
, 2002
) in the presence of a large excess of the non-specific competitor poly(dIdC).
All 13 test probes, four flagellar and nine non-flagellar, were bound by FlhD2C2. This resulted in each case in a shift of the DNA to a slower-migrating species during native PAGE. Autoradiographs of three representative binding assays with sequences of differing HI are shown in Fig. 1A
. To quantify this assay, phosphoimage analysis of the migrating band intensities allowed the ratio of bound : free DNA intensity to be plotted against protein concentration. The plots in Fig. 1B
(i), (ii) show a broad range of FlhD2C2 affinities, with binding to several putative non-flagellar targets, such as b1904, comparable to that of the four class II flagella genes analysed.
|
In vivo FlhD2C2-dependent promoter transcription
To assess whether the in vitro binding of FlhD2C2 correlated with FlhD2C2-dependent in vivo promoter activity, single-copy chromosomal lacZ transcriptional fusions were constructed to each of the promoter regions assessed in the DNA-band shift assay. Each of the 15 DNA probe sequences was fused to the lacZ reporter gene in the plasmid vector pGPS123, and the resulting construct was transferred as a single-copy fusion to the chromosome of both E. coli MC1000 wild-type and the isogenic flhDC null mutant by the phage
RS45 (Simons et al., 1987
). The
-galactosidase activity of each transcriptional fusion was compared in the two strains grown at 37 °C and also in the flhDC mutant complemented in trans by the pflhDC plasmid, which expresses FlhD2C2 from its native promoter.
During batch growth in LB medium, peak expression of the four class II flagella gene promoter regions was substantially higher in the wild-type than the flhDC mutant (Table 2
): flgB, 136-fold; flhB, 31-fold; fliA, 990-fold; fliL, 209-fold. Expression from the strongly bound b1904 promoter region was comparably higher, 191-fold, in the wild-type, while the b2446, wzzfepE and gltI promoter fusions were activated 11-, six- and twofold, respectively. Expression of these four differentially activated non-flagellar gene fusions in the flhDC mutant was enhanced by at least tenfold when FlhD2C2 was provided by plasmid pflhDC. In addition, although expression from the yejO promoter fusion was not different in the wild-type and flhDC strains, it was marginally complemented, 1·5- to twofold, by flhDC in trans. The promoters of yegH, hns, icc and hupB, with HI below 18 but weak FlhD2C2 binding (KD 160250 nM), were not activated, as was the case for the rcsA and argR control sequences with KD values of 356 and >450 nM.
|
70 promoter is also critical. All seven of the genes activated in vivo, including gltI, have putative FlhD2C2 binding sites which overlap by 1 or 2 bp the known or likely
70 35 motif. Those promoter regions that bound, but were nonetheless not activated, that is, those of yegH, hns, icc, rcsA and argR, do not show this binding site overlap. The only apparent exception to this is the hupB promoter, which was not activated in this assay.
|
70 35 sequence (TTGACA), the binding site overlapping the strongly flhDC-activated flagellar class II flhB promoter was moved 5' 80 bp away from its 35 motif (TTGAAC), while keeping the
70 promoter and FlhD2C2 binding sequence intact (Fig. 2A
70 promoter of the uncoupled site was no longer activated by FlhD2C2 (Fig. 2C
|
| DISCUSSION |
|---|
|
|
|---|
All nine non-flagellar sequences were bound by FlhD2C2, with affinities (KD 38250 nM) one- to 20-fold weaker than those of the four representative class II flagella promoter sequences tested (flgB, flhB, fliA and fliL; HI 6·514·7; KD 1243 nM). No false positive sites were identified, which contrasts with the LexA screen, in which the dinJ promoter of HI 7·1 was not bound in vitro (Fernandez de Henestrosa et al., 2000
). Like the four class II flagella promoters, four of the nine non-flagellar promoters tested were FlhD2C2 regulated: b1904 (HI 10·5) was bound strongly (KD 38 nM) and activated more than 30 fold; b2446 (HI 11·5) and wzzfepE (HI 14·9) had KD values of 60 nM and 86 nM and were activated tenfold and sixfold, respectively. Activation of the weakly bound gltI promoter (HI 13·7, KD 220 nM) was twofold higher in the wild-type than in the flhDC null mutant, but as was the case with b1904, b2446 and wzzfepE, it was strongly activated by flhDC in trans.
The four FlhD2C2 bound and regulated non-flagellar genes b1904, b2446, wzzfepE and gltI are not in the same operon. Gene b1904 is located at 42·81 min, adjacent to ftn (encoding the iron storage protein ferritin) in the 10 kb region between the fliAZY and flagellar flhDC operons (43·09 and 42·59 min, respectively). It has no known function or significant homologues, but does have a putative outer membrane lipoprotein cleavage signal (LGAC) near the N-terminus of its deduced amino acid sequence. The product of the b2446 gene also has no known function or homology and lies at 55·18 min in an as yet anonymous region of the chromosome. It has a DNA-binding AT-hook motif, present in many transcriptional regulators (Bustin & Reeves, 1996
; Cayuela et al., 2003
). The wzzfepE gene (13·31 min) was originally named fepE, putatively encoding part of the enterobactin uptake system in E. coli, but its role in iron transport has not been established (Ozenberger et al., 1987
; Murray et al., 2003
), and wzz fepE has been shown to modulate O-antigen chain length in the polysaccharide capsule of S. typhimurium (Murray et al., 2003
). Polysaccharide is an important factor in the swarming motility of S. typhimurium and P. mirabilis (Gygi et al., 1995
; Toguchi et al., 2000
), and a recent microarray study observed upregulation of the wzzfepE gene during swarming of S. typhimurium (Wang et al., 2004
). The fourth gene, gltI, encodes a periplasmic glutamate/aspartate binding protein (Urbanowski et al., 2000
) lying at 14·79 min in, or 5' of, the gltJKL operon responsible for glutamate uptake. It is possible that FlhD2C2 regulation of these genes may reflect connections to motility, but this is unknown. We searched for FlhD2C2 binding sites in the genomes of the uropathogenic (UPEC) E. coli CFT073 (accession no. NC_004431) and the enterohaemorrhagic (EHEC) E. coli O157 (accession no. AE00517) to assess if there might be co-regulation of flagellar and virulence genes. The findings (not shown) were very similar to those for E. coli K-12, and no putative sites were identified in the pathogenicity islands of either organism.
In the four FlhD2C2-dependent non-flagellar promoters, the binding site overlaps the putative
70 35 motif by 12 bp (Fig. 3
). These four
70 35 motifs have
50 % identity with the consensus (TTGACA), and in each case TT nucleotides form the end of the right hand (3') FlhD2C2 box. This overlap is also seen in all flagellar class II gene promoters from E. coli, S. typhimurium and P. mirabilis (Fig. 3
) (Kutsukake et al., 1990
; Liu et al., 1995
; Claret & Hughes, 2002
). This identity strengthens the likelihood that FlhD2C2 activates flagellar and non-flagellar genes by the same mechanism, in other words, as a class I transcription factor contacting the
-C-terminal domain of the RNA polymerase holoenzyme during transcriptional initiation (Liu et al., 1995
; Claret & Hughes, 2002
). The significance of this proximity was emphasized by uncoupling FlhD2C2 binding and promoter dependence following insertion of 80 bp of transcriptionally inert DNA between the FlhD2C2 binding site and the 35 motif. In the low-affinity non-regulated
70 promoter regions of argR, rcsA, icc/cpdA and hns, the FlhD2C2 binding site does not overlap the 35 site: it is separated by 50 bp or more. The only possible exception to this is the weak FlhD2C2 binding site (HI 15·5, KD 250 nM) of the hupB P3 promoter, which was not regulated in the in vivo assay. However, in this complex promoter region, the FlhD2C2 binding site overlaps high-affinity binding sites (KD 510 nM) for the transcriptional regulators CRP and FIS (factor for inversion stimulation), which may be dominant under the conditions tested (Claret & Rouviere-Yaniv, 1996
).
|
100 nM, and which overlaps by 12 bp the
70 35 promoter motif.
While the differential affinity of FlhD2C2 for the binding sites of its regulon promoters seems important for the sequential activation of class II gene expression, these promoters are also subject to fine tuning by FliA (
28) (Kalir & Alon, 2004
). We assessed the influence of FliA on the four novel FlhD2C2-regulated genes (wzzfepE, b2446, b1904 and gltI) by measuring the activity of the respective lacZ fusions in the MC1000 fliA : : Km strain and comparing to their activity in the wild-type strain: there was no difference except for a 50 % reduction in transcription of the gltI promoter (data not shown). The DNA sequence 5' of the gltI start codon contains a putative FliA 10 motif, GACGATAA. This may explain the difference in the regulation of the gltI and yejO promoter fusions (twofold and non-regulated), which have identical binding affinities (220 nM) and
70 sequences.
Prüss and colleagues (Prüss et al., 2001
) have postulated an extended FlhD2C2 regulon in E. coli, chiefly based on microarray studies in which the expression of several non-flagellar genes was influenced by the flhDC operon. However, their assay of corresponding multicopy plasmid transcriptional fusions did not establish direct activation of these genes by FlhD2C2. Similarly, we found no in vitro binding of FlhD2C2 to the promoter of mreB (data not shown), a gene identified in these microarray comparisons. Further microarrays have indicated regulation of genes encoding enzymes of the EntnerDoudoroff pathway by FlhD2C2 via the aer gene. This has a characteristic
28 (FliA)-dependent promoter sequence (TAAAN15GCCGACAT) 5' of its translational start site (Park et al., 2001
), but no putative FlhD2C2 binding sequence, suggesting that regulation proceeds indirectly from FlhD2C2 to fliA then aer. Our data indicate that regulation of many other of these microarray-highlighted genes is probably indirect, since we did not find any putative promoter FlhD2C2 binding sequences with an HI below 18, or indeed 22 (the lowest HI of these genes is that of napF: 22·9). The microarray comparisons did not detect regulation of the FlhD2C2 regulon genes established in our study, b1904, b2446, wzzfepE and gltI. It is possible that their transcript signals are below the detection level of the microarray technology, as was the case in microarray comparisons in Yersinia enterocolitica (Kapatral et al., 2004
), which failed to detect flhDC regulation of the class II and III genes flhA, fleC and cheY, which RT-PCR analysis confirmed were subject to two- to 12-fold regulation.
The main role for FlhD2C2 is the tight control of gene expression underlying flagella biosynthesis. Our study indicates a wider FlhD2C2 regulon, in which direct activation of non-flagellar promoters follows binding of the flagellar master regulator at the RNA polymerase binding site, though less avidly than to class II flagellar promoters.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allison, C. & Hughes, C. (1991). Closely linked genetic loci required for swarm cell differentiation and multicellular migration by Proteus mirabilis. Mol Microbiol 5, 19751982.[Medline]
Allison, C., Emody, L., Coleman, N. & Hughes, C. (1994). The role of swarm cell differentiation and multicellular migration in the uropathogenicity of Proteus mirabilis. J Infect Dis 169, 11551158.[Medline]
Berg, O. G. & Von Hippel, P. H. (1988). Selection of DNA binding sites by regulatory proteins. II. The binding specificiity of the cyclic AMP receptor protein to recognition sites. J Mol Biol 200, 709723.[CrossRef][Medline]
Bustin, M. & Reeves, R. (1996). High-mobility-group chromosomal proteins, architectural components that facilitate chromatin function. Prog Nucleic Acid Res Mol Biol 54, 35100.[Medline]
Cayuela, M. L., Elias-Arnanz, M., Penalver-Mellado, M., Padmanabhan, S. & Murillo, F. J. (2003). The Stigmatella aurantiaca homolog of Myxococcus xanthus high-mobility-group A-type transcription factor CarD: insights into the functional modules of CarD and their distribution in bacteria. J Bacteriol 185, 35273537.
Chadsey, M. S., Karlinsey, J. E. & Hughes, K. T. (1998). The flagellar anti-sigma factor FlgM actively dissociates Salmonella typhimurium
28 RNA polymerase holoenzyme. Genes Dev 12, 31233136.
Claret, L. & Hughes, C. (2000a). Rapid turnover of FlhD and FlhC, the flagellar regulon transcriptional activator proteins, during Proteus swarming. J Bacteriol 182, 833836.
Claret, L. & Hughes, C. (2000b). Functions of the subunits in the FlhD2C2 transcriptional master regulator of bacterial flagellum biogenesis and swarming. J Mol Biol 303, 467478.[CrossRef][Medline]
Claret, L. & Hughes, C. (2002). Interaction of the atypical prokaryotic transcription activator FlhD2C2 with early promoters of the flagellar gene hierarchy. J Mol Biol 321, 185199.[CrossRef][Medline]
Claret, L. & Rouviere-Yaniv, J. (1996). Regulation of HU alpha and HU beta by CRP and FIS in Escherichia coli. J Mol Biol 263, 126139.[CrossRef][Medline]
Dennis, J. J. & Zylstra, G. J. (1998). Plasposons: modular self-cloning minitransposon derivatives for rapid genetic analysis of Gram-negative bacterial genomes. Appl Environ Microbiol 64, 27102715.
Dufour, A., Furness, R. B. & Hughes, C. (1998). Novel genes that upregulate the Proteus mirabilis flhDC master operon controlling flagellar biogenesis and swarming. Mol Microbiol 29, 741751.[CrossRef][Medline]
Fernandez de Henestrosa, A. R., Ogi, T., Aoyagi, S., Chafin, D., Hayes, J. J., Ohmori, H. & Woodgate, R. (2000). Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol 35, 15601572.[CrossRef][Medline]
Francez-Charlot, A., Laugel, B., Van Gemert, A., Dubarry, N., Wiorowski, F., Castanie-Cornet, M. P., Gutierrez, C. & Cam, K. (2003). RcsCDB His-Asp phosphorelay system negatively regulates the flhDC operon in Escherichia coli. Mol Microbiol 49, 823832.[CrossRef][Medline]
Fraser, G. M., Claret, L., Furness, R., Gupta, S. & Hughes, C. (2002). Swarming-coupled expression of the Proteus mirabilis hpmBA haemolysin operon. Microbiology 148, 21912201.
Furness, R. B., Fraser, G. M., Hay, N. A. & Hughes, C. (1997). Negative feedback from a Proteus class II flagellum export defect to the flhDC master operon controlling cell division and flagellum assembly. J Bacteriol 179, 55855588.
Givaudan, A. & Lanois, A. (2000). flhDC, the flagellar master operon of Xenorhabdus nematophilus, requirement for motility, lipolysis, extracellular hemolysis, and full virulence in insects. J Bacteriol 182, 107115.
Givskov, M., Eberl, L., Christiansen, G., Benedik, M. J. & Molin, S. (1995). Induction of phospholipase and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD. Mol Microbiol 15, 445454.[Medline]
Gygi, D., Rahman, M. M., Lai, H. C., Carlson, R., Guard-Petter, J. & Hughes, C. (1995). A cell-surface polysaccharide that facilitates rapid population migration by differentiated swarm cells of Proteus mirabilis. Mol Microbiol 17, 11671175.[CrossRef][Medline]
Ide, N., Ikebe, T. & Kutsukake, K. (1999). Reevaluation of the promoter structure of the class 3 flagellar operons of Escherichia coli and Salmonella. Genes Genet Syst 74, 113116.[CrossRef][Medline]
Kalir, S. & Alon, U. (2004). Using a quantitative blueprint to reprogram the dynamics of the flagella gene network. Cell 117, 713720.[CrossRef][Medline]
Kalir, S., McClure, J., Pabbaraju, K., Southward, C., Ronen, M., Leibler, S., Surette, M. G. & Alon, U. (2001). Ordering genes in a flagella pathway by analysis of expression kinetics from living bacteria. Science 292, 20802083.
Kang, Y., Durfee, T., Glasner, J. D., Qiu, Y., Frisch, D., Winterberg, K. M. & Blattner, F. R. (2004). Systematic mutagenesis of the Escherichia coli genome. J Bacteriol 186, 49214930.
Kapatral, V., Campbell, J. W., Minnich, S. A., Thomson, N. R., Matsumura, P. & Pruss, B. M. (2004). Gene array analysis of Yersinia enterocolitica FlhD and FlhC: regulation of enzymes affecting synthesis and degradation of carbamoylphosphate. Microbiology 150, 22892300.
Karlinsey, J. E., Tanaka, S., Bettenworth, V., Yamaguchi, S., Boos, W., Aizawa, S. I. & Hughes, K. T. (2000). Completion of the hook-basal body complex of the Salmonella typhimurium flagellum is coupled to FlgM secretion and fliC transcription. Mol Microbiol 37, 12201231.[CrossRef][Medline]
Kim, D. J., Boylan, B., George, N. & Forst, S. (2003). Inactivation of ompR promotes precocious swarming and flhDC expression in Xenorhabdus nematophila. J Bacteriol 185, 52905294.
Kutsukake, K. & Ide, N. (1995). Transcriptional analysis of the flgK and fliD operons of Salmonella typhimurium which encode flagellar hook-associated proteins. Mol Gen Genet 247, 275281.[CrossRef][Medline]
Kutsukake, K., Ohya, Y. & Iino, T. (1990). Transcriptional analysis of the flagellar regulon of Salmonella typhimurium. J Bacteriol 172, 741747.
Lewis, L. K., Harlow, G. R., Gregg-Jolly, L. A. & Mount, D. W. (1994). Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J Mol Biol 241, 507523.[CrossRef][Medline]
Liu, X. & Matsumura, P. (1994). The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons. J Bacteriol 176, 73457351.
Liu, X. & Matsumura, P. (1996). Differential regulation of multiple overlapping promoters in flagellar class II operons in Escherichia coli. Mol Microbiol 21, 613620.[CrossRef][Medline]
Liu, X., Fujita, N., Ishihama, A. & Matsumura, P. (1995). The C-terminal region of the alpha subunit of Escherichia coli RNA polymerase is required for transcriptional activation of the flagellar level II operons by the FlhD/FlhC complex. J Bacteriol 177, 51865188.
Macnab, R. M. (1996). Flagella and Motility. In Escherichia coli and Salmonella typhimurium, Cellular and Molecular Biology, pp. 123145. Edited by F. C. Neidhardt. Washington, DC: American Society for Microbiology.
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbour, NY: Cold Spring Harbor Laboratory.
Mizushima, T., Tomura, A., Shinpuku, T., Miki, T. & Sekimizu, K. (1994). Loss of flagellation in dnaA mutants of Escherichia coli. J Bacteriol 176, 55445546.
Murray, G. L., Attridge, S. R. & Morona, R. (2003). Regulation of Salmonella typhimurium lipopolysaccharide O antigen chain length is required for virulence; identification of FepE as a second Wzz. Mol Microbiol 47, 13951406.[CrossRef][Medline]
Ozenberger, B. A., Nahlik, M. S. & McIntosh, M. A. (1987). Genetic organization of multiple fep genes encoding ferric enterobactin transport functions in Escherichia coli. J Bacteriol 169, 36383646.
Park, K., Choi, S., Ko, M. & Park, C. (2001). Novel
F-dependent genes of Escherichia coli found using a specified promoter consensus. FEMS Microbiol Lett 202, 243250.[Medline]
Powell, B. S., Rivas, M. P., Court, D. L., Nakamura, Y. & Turnbough, C. L., Jr (1994). Rapid confirmation of single copy lambda prophage integration by PCR. Nucleic Acids Res 22, 57655766.
Prüss, B. M., Liu, X., Hendrickson, W. & Matsumura, P. (2001). FlhD/FlhC-regulated promoters analyzed by gene array and lacZ gene fusions. FEMS Microbiol Lett 197, 9197.[Medline]
Prüss, B. M., Campbell, J. W., Van Dyk, T. K., Zhu, C., Kogan, Y. & Matsumura, P. (2003). FlhD/FlhC is a regulator of anaerobic respiration and the EntnerDoudoroff pathway through induction of the methyl-accepting chemotaxis protein Aer. J Bacteriol 185, 534543.
Simons, R. W., Houman, F. & Kleckner, N. (1987). Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53, 8596.[CrossRef][Medline]
Soutourina, O. A. & Bertin, P. N. (2003). Regulation cascade of flagellar expression in Gram-negative bacteria. FEMS Microbiol Rev 27, 505523.[CrossRef][Medline]
Soutourina, O., Kolb, A., Krin, E., Laurent-Winter, C., Rimsky, S., Danchin, A. & Bertin, P. (1999). Multiple control of flagellum biosynthesis in Escherichia coli, role of H-NS protein and the cyclic AMP-catabolite activator protein complex in transcription of the flhDC master operon. J Bacteriol 181, 75007508.
Toguchi, A., Siano, M., Burkart, M. & Harshey, R. M. (2000). Genetics of swarming motility in Salmonella enterica serovar typhimurium: critical role for lipopolysaccharide. J Bacteriol 182, 63086321.
Tomoyasu, T., Takaya, A., Isogai, E. & Yamamoto, T. (2003). Turnover of FlhD and FlhC, master regulator proteins for Salmonella flagellum biogenesis, by the ATP-dependent ClpXP protease. Mol Microbiol 48, 443452.[CrossRef][Medline]
Urbanowski, M. L., Stauffer, L. T. & Stauffer, G. V. (2000). The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli. Mol Microbiol 37, 856868.[CrossRef][Medline]
Wang, Q., Frye, J. G., McClelland, M. & Harshey, R. M. (2004). Gene expression patterns during swarming in Salmonella typhimurium: genes specific to surface growth and putative new motility and pathogenicity genes. Mol Microbiol 52, 169187.[CrossRef][Medline]
Young, G. M., Smith, M. J., Minnich, S. A. & Miller, V. L. (1999). The Yersinia enterocolitica motility master regulatory operon, flhDC, is required for flagellin production, swimming motility, and swarming motility. J Bacteriol 181, 28232833.
Received 10 January 2005;
revised 3 March 2005;
accepted 7 March 2005.
This article has been cited by other articles:
![]() |
S. Sinha, A. D. S. Cameron, and R. J. Redfield Sxy Induces a CRP-S Regulon in Escherichia coli J. Bacteriol., August 15, 2009; 191(16): 5180 - 5195. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bravo, C. Silva, J. A. Carter, A. Hoare, S. A. Alvarez, C. J. Blondel, M. Zaldivar, M. A. Valvano, and I. Contreras Growth-phase regulation of lipopolysaccharide O-antigen chain length influences serum resistance in serovars of Salmonella J. Med. Microbiol., August 1, 2008; 57(8): 938 - 946. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Carter, C. J. Blondel, M. Zaldivar, S. A. Alvarez, C. L. Marolda, M. A. Valvano, and I. Contreras O-antigen modal chain length in Shigella flexneri 2a is growth-regulated through RfaH-mediated transcriptional control of the wzy gene Microbiology, October 1, 2007; 153(10): 3499 - 3507. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zhao, M. Liu, and R. R. Burgess Adaptation in bacterial flagellar and motility systems: from regulon members to 'foraging'-like behavior in E. coli Nucleic Acids Res., July 26, 2007; 35(13): 4441 - 4452. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Stafford and C. Hughes Salmonella typhimurium flhE, a conserved flagellar regulon gene required for swarming Microbiology, February 1, 2007; 153(2): 541 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Stevenson and P. N. Rather A Novel Gene Involved in Regulating the Flagellar Gene Cascade in Proteus mirabilis J. Bacteriol., November 15, 2006; 188(22): 7830 - 7839. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamamoto and K. Kutsukake FliT Acts as an Anti-FlhD2C2 Factor in the Transcriptional Control of the Flagellar Regulon in Salmonella enterica Serovar Typhimurium. J. Bacteriol., September 1, 2006; 188(18): 6703 - 6708. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Pruss, C. Besemann, A. Denton, and A. J. Wolfe A Complex Transcription Network Controls the Early Stages of Biofilm Development by Escherichia coli J. Bacteriol., June 1, 2006; 188(11): 3731 - 3739. [Full Text] [PDF] |
||||
![]() |
R. Belas and R. Suvanasuthi The Ability of Proteus mirabilis To Sense Surfaces and Regulate Virulence Gene Expression Involves FliL, a Flagellar Basal Body Protein J. Bacteriol., October 1, 2005; 187(19): 6789 - 6803. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |