|
|
||||||||
Department of Biology, University of Nebraska at Omaha, Omaha, NE 68182, USA
Correspondence
D. W. Rowen
drowen{at}mail.unomaha.edu
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The most frequent cause of the conversion to the mucoid phenotype is mutations within mucA (Boucher et al., 1997b
). The mucA gene is located within the algU mucABCD gene cluster that appears to encode the most important regulators of alginate production in P. aeruginosa (Govan & Deretic, 1996
). The algU and mucB genes of this cluster have also been called algT and algN, respectively (DeVries & Ohman, 1994
; Goldberg et al., 1993
). The algU mucABCD gene cluster appears to encode factors that form a regulatory system found in many bacteria that senses and signals stressful extracytoplasmic conditions (Govan & Deretic, 1996
; Missiakas & Raina, 1998
). In P. aeruginosa, AlgU is an alternative sigma factor that directs the transcription of alginate biosynthetic genes at the algD promoter and of other genes that encode protective factors (Martin et al., 1993
, 1994
; Schurr et al., 1995
). MucA has been demonstrated to be an anti-sigma factor of AlgU by experiments that showed that MucA can bind to AlgU and inhibit its activity in vitro (Schurr et al., 1996
; Xie et al., 1996
). The MucA protein is located in the inner membrane via a single transmembrane domain with its N-terminus in the cytoplasm and its C-terminus in the periplasm (Mathee et al., 1997
). Interestingly, almost all the mutations in mucA found in mucoid isolates of P. aeruginosa cause a truncation or alteration of the C-terminal, periplasmic domain of MucA protein (Boucher et al., 1997b
). The MucB protein is located in the periplasm and appears to help MucA inhibit AlgU by interacting with the C-terminal, periplasmic domain of MucA (Rowen & Deretic, 2000
; Schurr et al., 1996
). MucC is predicted to be an inner-membrane protein that appears to play only a minor role in regulation, by an undefined mechanism (Boucher et al., 1997a
). MucD is a periplasmic protease homologous to HtrA or DegP of Escherichia coli that is thought to remove misfolded proteins in the periplasm (Boucher et al., 1996
, 1997a
).
Recent studies of the homologous
E extracytoplasmic stress response system in E. coli indicate that proteases play a critical role in regulating this system (Ades et al., 1999
; Alba et al., 2002
; Kanehara et al., 2002
; Walsh et al., 2003
). In these studies, it was observed that the key event in the activation of
E-dependent transcription was the sequential cleavage of RseA, a homologue of MucA, by DegS and then YeaL. DegS is a membrane-anchored, periplasmic serine protease (Ades et al., 1999
). The activity of DegS appears to be activated by its PDZ domain binding to proteins with a C-terminal sequence YQF that is found on several outer-membrane proteins (Walsh et al., 2003
). PDZ domains are a conserved domain motif found in many proteins and they appear to mediate interaction between proteins through the recognition of C-terminal sequences. After activation, DegS cleaves off the last 68 amino acids of the C-terminal, periplasmic domain of RseA (Walsh et al., 2003
). The cleavage of RseA by DegS then appears to make RseA a substrate for cleavage by the zinc metalloprotease YeaL (Alba et al., 2002
; Kanehara et al., 2002
). YeaL is located in the inner membrane via four transmembrane domains and contains a PDZ domain located in the periplasm and a zinc protease domain located in the cytoplasm (Kanehara et al., 2001
). YeaL is similar to the site-2 protease (S2P) of mammals. S2P acts to activate SREBP (sterol regulatory element binding protein) by cleavage of one of its transmembrane domains that span the endoplasmic reticulum membrane after another protease, site-1 protease (S1P), first cleaves a domain of SREBP located in the lumen (Brown et al., 2000
). By analogy, YeaL is thought to cleave the transmembrane domain of RseA, and this cleavage of RseA is thought to cause the remainder of RseA to be rapidly degraded by other proteases (Alba et al., 2002
; Kanehara et al., 2002
). However, the exact mechanism by which YeaL is activated to cleave RseA is not known. It has been recently observed that the presence of portions of the RseA periplasmic domain that contain a high number of glutamine residues appears to inhibit YeaL activity and the removal of these residues by deletion or proteolysis by DegS makes RseA a substrate for YeaL (Kanehara et al., 2003
). These observations also help to explain how extracytoplasmic stress response systems actually sense stress. It is now hypothesized that during stressful conditions, outer-membrane proteins with the C-terminal YQF sequence become misfolded, and their free C-termini become bound by the PDZ domains of DegS, thereby activating the protease to cleave RseA (Walsh et al., 2003
). The elimination of RseA frees
E molecules to activate transcription.
Several observations made in P. aeruginosa suggest that proteases could also play a role in activating alginate production in mucoid strains by affecting MucA levels. First, Boucher et al. (1997b)
observed that almost all of the mutations in mucA found in mucoid isolates from CF patients cause a truncation of the C-terminal, periplasmic domain of the MucA protein. Rowen & Deretic (2000)
later observed that the mutations in the periplasmic domain of MucA did not eliminate the ability of MucA to bind and inhibit AlgU, but instead affected the steady-state levels of MucA and its interaction with MucB. These results suggest that the truncation of MucA may make the protein more susceptible to proteolysis. In this study, we report that the predicted periplasmic protease encoded by PA3257 (prc) plays a role in regulating alginate production in mucoid mucA strains. We hypothesize that Prc promotes alginate production in mucoid CF isolates with mucA mutations by degrading the truncated forms of MucA produced in those strains.
| METHODS |
|---|
|
|
|---|
|
G440) strain PAO578 on LB agar plates for 48 days at room temperature. Cells were streaked to isolation from the maintained culture and their phenotype determined on LB and PIA media. For the complementation studies, cosmids from the minimal tiling path (MTP) library (Pseudomonas Genetic Stock Center, http://www.ecu.edu/pseudomonas/) or plasmids were introduced into the P. aeruginosa strains via triparental conjugation using previously described methods (Konyecsni & Deretic, 1988
DNA manipulations.
To test complementation by prc, the prc sequences from MTP194 were amplified with oligos oDR25 (CCTCTAGAGAACGCCTTGCACAATTGG) and oDR26 (GTGGATCCGCGTTGTCGGCAGAGTAGT), which creates XbaI and HindIII restriction sites on each end respectively (underlined). The resulting PCR fragment was ligated into pBluescript KS+ (Stratagene) after digestion with XbaI and BamHI to create pDR142. Plasmid pDR145 was then created by ligation of the prc-containing HindIIIXbaI fragment from pDR142 into pVDZ'2 (Deretic et al., 1987
). To insertionally inactivate prc, we deleted the portion of the prc coding region from nucleotide 218 to 1445 by digestion of pDR142 with BglII. To make the prc : : Tcr allele, we inserted a PCR product containing the Tcr gene from pALTER-1 (Promega) that was generated by amplification with oligos oDR67 ATAGATCTGCGAGCGGTATCAGCTCA and oDR68 ATAGATCTGTGCGGCTGCTGGAGATG) and digestion with BglII (the underlined bases show the BglII sites created). To make the prc : : Gmr allele, a BamHI fragment containing the Gmr cassette from pkI11G was inserted into BglII-digested pDR142. XhoI fragments containing the prc : : Tcr and prc : : Gmr alleles were then cloned into a SalI site within the suicide vector pCVD442 to create pDR184 and pDR147 respectively. To overexpress prc, we amplified the prc gene from 26 bp upstream of the predicted start codon to 97 bp downstream of the predicted stop codon from genomic DNA by using oligos oDR49 (TTGGATCCTTACTCCGCCATCAGTCGAA) and oDR50 (TTCTCGAGTGGAACGCTCTCGTGACAAT). The resulting PCR product was digested with BamHI and XhoI and ligated behind the tac promoter of BamHI/SalI-digested pVDtac24 to create ptac-prc.
Sequencing of prc from PAO578, PAO578-2, PAO578-21 and PAO578-23.
We amplified the prc sequence from each strain by using oligos oDR25 and oDR26 and ligated the resulting PCR products into pGEM-T Easy (Promega). The nucleotide sequence of the coding region of prc was determined on both strands of one PCR product for each strain. Any differences were confirmed by sequencing the altered region from three independent clones, two of which were derived from different PCR reactions.
Enzyme and alginate assays.
Catechol 2,3-dioxygenase activity was measured in sonic extracts as previously described (Yu et al., 1995
). Alginate assays were performed as described by Knutson & Jeanes (1976)
with slight modifications.
| RESULTS |
|---|
|
|
|---|
We first attempted to isolate strains with a suppressor mutation that produced a similar phenotype to the previously described type II, namely, non-mucoid on LB and mucoid on PIA. To obtain suppressor mutations, we simply checked the phenotype of cells obtained from a culture of mucA22 strain PAO578 that were being maintained on LB agar at room temperature for several days. After 4 days, we began to see the appearance of cells that were non-mucoid or only slightly mucoid when grown on LB medium. We then determined the phenotype of these cells on PIA. The vast majority of the suppressor mutants we tested were also non-mucoid to slightly mucoid on PIA medium, but occasionally we isolated a strain that was mucoid on PIA. We ultimately isolated eight strains that showed a phenotype similar to a strain (PAO578-2) with a type II phenotype (Fig. 1
). We referred to the suppressor mutation in all these strains as som (suppressor of mucoidy). Measurements of alginate levels in som strains indicated that these strains produced very little alginate while growing on LB, and produced high but still somewhat reduced levels of alginate when grown on PIA as compared to the original PAO578 strain (compare PAO578-21 and PAO578-23 to PAO578 in Table 2
). The alginate levels seen in the som mutants we isolated were similar to those of a strain with a type II suppressor mutation, PAO578-2 (Fig. 1
, Table 2
). Strain PAO578-2 has also been referred to as PAO578 type II or PAO578(II) (Boucher et al., 1996
; Schurr et al., 1994
).
|
|
|
|
0·20). In addition, inactivation of prc did not cause any noticeable growth defect in P. aeruginosa. In E. coli, prc was required for growth at elevated temperature (above 42 °C) on low-salt medium (LB without salt) (Hara et al., 1991
PAO578-21 and PAO578-23 have a mutation in prc
To confirm that prc is mutated in PAO578-21 and PAO578-23, we PCR-amplified and sequenced prc from PAO578-21, PAO578-23 and PAO578 by PCR. The prc genes from PAO578-21 and PAO578-23 both had a mutation within the coding region as compared to the PAO578 prc sequence, which was the same as that reported for prc by the Pseudomonas genome project (Stover et al., 2000
). PA3257 Prc is predicted to contain a novel type of serine protease domain (Clan SK, family S41A) and a single PDZ domain (Stover et al., 2000
; Beebe et al., 2000
; Rawlings et al., 2002
). In PAO578-21, we observed a change of A to G at position 433 and a deletion of a C at position 483 relative to the predicted start codon. These changes would result in change of Ile-145 to Val and a frameshift after codon 161. The frameshift is predicted to cause the protein to terminate after the addition of 15 aberrant amino acids and is unlikely to encode a functional product as the protein would not contain the predicted PDZ and protease domains of the protein (Fig. 3
). In PAO578-23, we detected a change of G nucleotide 877 to A. This would cause Ala-293 within the PDZ domain of Prc to be changed to Thr (Fig. 3
). Since the mutation in prc in PAO578-23 only changed one amino acid, we examined whether this allele produced a protein that retained partial activity. Overexpression of the prc from either PAO578-21 or PAO578-23 did not increase alginate production in the prc-disrupted strain PAO578-184, while overexpression of wild-type prc restored alginate production (data not shown). These results indicate that strains PAO578-21 and PAO578-23 have a mutation in prc that inactivates the protein.
|
Suppressor mutations in prc reduce algD transcription
The transcription of an alginate biosynthetic gene operon beginning with algD is elevated in mucoid mucA strains, due in part to the higher AlgU activity in these strains (Govan & Deretic, 1996
). AlgU is thought to be more active in mucoid mucA strains because the truncated forms of MucA produced in these strains are less stable and degraded more rapidly, and thus the levels of MucA are not high enough to inhibit AlgU (Rowen & Deretic, 2000
). One possible mechanism of action of Prc is that it promotes the elimination of mutant forms of MucA by cleaving off their C-terminus. Therefore we examined whether suppressor mutations in prc affected transcription from the algD promoter with an algD : : xylE reporter construct. We observed significantly less catechol 2,3-dioxygenase activity in the som mutant strains PAO578-21 and PAO578-23 [0·04±0·01 and 0·07±0·01 U (mg protein)1, respectively; means±SE] as compared to PAO578 [2·11±0·14 U (mg protein)1] when they were grown on LB medium. These results are consistent with AlgU activity being reduced in som strains and with the hypothesis that Prc acts to cleave MucA22, thereby promoting its degradation.
Prc appears to act against other mutant forms of MucA
As described, mutations in prc affected alginate production in a mucA22 strain. Since mucA22 is only one of the truncated forms of MucA observed in mucoid strains from CF patients, we examined whether the insertional inactivation of prc would also affect alginate production in two mucoid strains isolated from CF patients (CF20 and CF25) which have different mutations in mucA. CF20 is reported to have a C to T transition at nucleotide 436 relative to the start codon that creates a stop codon after 145 amino acids (Boucher et al., 1997b
). CF20 is predicted to produce a protein similar in length to MucA22 of PAO578 but with different C-terminal residues (Fig. 4
). CF25 is reported to have a C to T transition at position 352 that creates a stop codon which would cause the protein to terminate after only 117 amino acids (Fig. 4
) (Boucher et al., 1997b
). Insertional inactivation of prc in CF20 and CF25 caused a decrease in alginate production during growth on both LB and PIA (compare CF20 and CF25 to CF20-184 and CF25-184 in Fig. 4
). The reduction in alginate production in both of these strains was similar to that observed in the mucA22 strain PAO578 (Fig. 4
). These results indicate that prc plays a role in promoting alginate production in three different mucA mutants and is probably an important factor in contributing to high-level alginate production in most if not all mucA mutant strains.
|
| DISCUSSION |
|---|
|
|
|---|
Our results indicate that Prc plays a role in promoting alginate production in mucA mutants. Insertional inactivation of prc reduced alginate production in three strains with different mucA truncation mutations. Since Prc is predicted to encode a periplasmic protease and truncations of MucA have been shown to reduce the levels of MucA proteins (Rowen & Deretic, 2000
), the simplest explanation for the mechanism of action of Prc is that it acts to promote the degradation of the MucA protein by cleaving off the C-terminus of the truncated forms of MucA produced in mucA mutant strains (Fig. 5b
). A similar mechanism has been observed in the homologous
E system in E. coli. In that system, it was shown that the cleavage of a portion of the C-terminus of the MucA homologue RseA by a periplasmic protease called DegS promotes the elimination of the RseA protein by other proteases, and the elimination of RseA leads to the activation of the
E (Ades et al., 1999
; Walsh et al., 2003
). Our results would therefore suggest that Prc of P. aeruginosa is able to bind to and cleave the truncated MucA protein produced in all three mucA mutant strains examined. That suggestion is a little surprising because E. coli Prc has been shown to preferentially cleave proteins with nonpolar C-termni (Keiler & Sauer, 1996
; Keiler et al., 1995
) and the predicted C-terminal residues of the three truncated forms of MucA examined vary in their polarity. A study by Keiler & Sauer (1996)
indicated that the size and polarity of the last three C-terminal residues was a major factor in determining the rate of degradation of proteins by Prc. The MucA protein produced in mucA22 strain PAO578 is predicted to end with three acidic residues (RRR), while the C-termini of the MucA proteins produced in CF20 (GAP) and CF25 (MAQ) are predicted to contain at least one nonpolar residue (underlined) (Boucher et al., 1997b
). Therefore our results may indicate that the substrate specificity of P. aeruginosa Prc is somewhat broader than that of E. coli Prc, but further studies on P. aeruginosa Prc are needed to confirm this hypothesis. Another key factor in determining the ability of E. coli Prc to cleave a protein was the availability of the C-termini of the protein to be bound by Prc (Keiler et al., 1995
). It is likely that the truncation of MucA disrupts the folding of the remaining residues in the periplasmic domain of MucA, which makes the C-terminus readily available for binding by the PDZ domain of Prc. This model is supported by a couple of other observations. First, we observed no effect of the loss or overexpression of Prc in cells with wild-type MucA; this suggests that Prc does not act against wild-type MucA, in which the C-terminus is more likely to be folded into a stable configuration, making it unavailable for binding by Prc. Secondly, it has been observed that a missense mutation that only changed Pro-184 of MucA to Ser (10 residues from the C-terminus) caused a reduction in the levels of the MucA protein and an increase in alginate production (Rowen & Deretic, 2000
). This observation suggests that disruption of the folding of the C-terminus of full-length MucA can make the protein a better target for degradation. These results together suggest that the availability of the C-termini of MucA may be the biggest factor in determining whether Prc and possibly other proteases could act against MucA. Therefore the most likely mechanism by which Prc acts to regulate alginate production is that it cleaves the less stably folded C-termini of truncated MucA; however, this hypothesis remains to be proven experimentally.
|
E is activated by the cleavage of RseA by two different proteases (Alba et al., 2002
Our results also suggest that PA3257 prc is not essential for growth of P. aeruginosa. We did not observe any noticeable growth defects in our prc mutants under the conditions we checked. In E. coli, prc is required for growth on hypotonic (low-salt) media at temperatures above 40 °C. We tested the growth of PAO578-21, PAO578-184 and PAO1-184 on LB medium lacking salt at 42 and 45 °C and did not notice any growth defects (data not shown). P. aeruginosa cells may contain other proteases that have some overlapping activity with Prc. In E. coli, other proteases have been identified which can partially replace Prc activity (Bass et al., 1996
). Therefore it seems plausible that P. aeruginosa has one or more proteases with overlapping activity to Prc and one of these proteases could also act to degrade truncated MucA during growth on PIA.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
E-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13, 24492461.
Alba, B. M., Leeds, J. A., Onufryk, C., Lu, C. Z. & Gross, C. A. (2002). DegS and YaeL participate sequentially in the cleavage of RseA to activate the
E-dependent extracytoplasmic stress response. Genes Dev 16, 21562168.
Bass, S., Gu, Q. & Christen, A. (1996). Multicopy suppressors of Prc mutant Escherichia coli include two HtrA (DegP) protease homologs (HhoAB) DksA and a truncated RlpA. J Bacteriol 178, 11541161.
Beebe, K. D., Shin, J., Peng, J., Chaudhury, C., Khera, J. & Pei, D. (2000). Substrate recognition through a PDZ domain in tail-specific protease. Biochemistry 39, 31493155.[CrossRef][Medline]
Boucher, J. C., Martinez-Salazar, J., Schurr, M. J., Mudd, M. H., Yu, H. & Deretic, V. (1996). Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease HtrA. J Bacteriol 178, 511523.
Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W. & Deretic, V. (1997a). Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity. Microbiology 143, 34733480.
Boucher, J. C., Yu, H., Mudd, M. H. & Deretic, V. (1997b). Mucoid Pseudomonas aeruginosa in cystic fibrosis: characterization of muc mutations in clinical isolates and analysis of clearance in a mouse model of respiratory infection. Infect Immun 65, 38383846.
Boucher, J. C., Schurr, M. J. & Deretic, V. (2000). Dual regulation of mucoidy in Pseudomonas aeruginosa and sigma factor antagonism. Mol Microbiol 36, 341351.[CrossRef][Medline]
Brown, M. S., Ye, J., Rawson, R. B. & Goldstein, J. L. (2000). Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans. Cell 100, 391398.[CrossRef][Medline]
Deretic, V., Chandrasekharappa, S., Gill, J. F., Chatterjee, D. K. & Chakrabarty, A. M. (1987). A set of cassettes and improved vectors for genetic and biochemical characterization of Pseudomonas genes. Gene 57, 6172.[CrossRef][Medline]
DeVries, C. A. & Ohman, D. E. (1994). Mucoid-to-nonmucoid conversion in alginate-producing Pseudomonas aeruginosa often results from spontaneous mutations in algT, encoding a putative alternate sigma factor, and shows evidence for autoregulation. J Bacteriol 176, 66776687.
Donnesberg, M. S. & Kaper, J. B. (1991). Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect Immun 59, 43104317.
Fyfe, J. A. M. & Govan, J. R. W. (1980). Alginate synthesis in mucoid Pseudomonas aeruginosa: a chromosomal locus involved in control. J Gen Microbiol 119, 443450.[Medline]
Goldberg, J. B., Gorman, W. L., Flynn, J. L. & Ohman, D. E. (1993). A mutation in algN permits trans activation of alginate production by algT in Pseudomonas species. J Bacteriol 175, 13031308.
Govan, J. R. & Deretic, V. (1996). Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 60, 539574.
Hara, H., Yamamoto, Y., Higashitani, A., Suzuki, H. & Nishimura, Y. (1991). Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in C-terminal processing of penicillin-binding protein 3. J Bacteriol 173, 47994813.
Kanehara, K., Akiyama, Y. & Ito, K. (2001). Characterization of the yaeL gene product and its S2P-protease motifs in Escherichia coli. Gene 281, 7179.[CrossRef][Medline]
Kanehara, K., Ito, K. & Akiyama, Y. (2002). YaeL (EcfE) activates the
E pathway of stress response through a site-2 cleavage of anti-
E, RseA. Genes Dev 16, 21472155.
Kanehara, K., Ito, K. & Akiyama, Y. (2003). YaeL proteolysis of RseA is controlled by the PDZ domain of YaeL and a Gln-rich region of RseA. EMBO J 22, 63896398.[CrossRef][Medline]
Keiler, K. C. & Sauer, R. T. (1996). Sequence determinants of C-terminal substrate recognition by the Tsp protease. J Biol Chem 271, 25892593.
Keiler, K. C., Silber, K. R., Downard, K. M., Papayannopoulos, I. A., Biemann, K. & Sauer, R. T. (1995). C-terminal specific protein degradation: activity and substrate specificity of the Tsp protease. Protein Sci 4, 15071515.[Medline]
Knutson, C. A. & Jeanes, A. (1976). A new modification of the carbazole reaction: application to heteropolysaccharides. Anal Biochem 24, 470481.
Konyecsni, W. M. & Deretic, V. (1988). Broad-host-range plasmid and M13 bacteriophage-derived vectors for promoter analysis in Escherichia coli and Pseudomonas aeruginosa. Gene 74, 375386.[CrossRef][Medline]
Martin, D. W., Holloway, B. W. & Deretic, V. (1993). Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor. J Bacteriol 175, 11531164.
Martin, D. W., Schurr, M. J., Yu, H. & Deretic, V. (1994). Analysis of promoters controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to
E and stress response. J Bacteriol 176, 66886696.
Mathee, K., McPherson, C. J. & Ohman, D. E. (1997). Posttranslational control of the algT (algU)-encoded
22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J Bacteriol 179, 37113720.
Missiakas, D. & Raina, S. (1998). The extracytoplasmic function sigma factors: role and regulation. Mol Microbiol 28, 10591066.[CrossRef][Medline]
Ratnaningsih, E. S., Dharmsthiti, S., Krishnapillai, V., Morgan, A., Sinclair, M. & Holloway, B. W. (1990). A combined physical and genetic map of Pseudomonas aeruginosa PAO. J Gen Microbiol 136, 23512357.
Rawlings, N. D., O'Brien, E. & Barrett, A. J. (2002). MEROPS: the protease database. Nucleic Acids Res 30, 343346.
Rowen, D. W. & Deretic, V. (2000). Membrane-to-cytosol redistribution of ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Mol Microbiol 36, 314327.[CrossRef][Medline]
Schurr, M. J., Martin, D. W., Mudd, M. H. & Deretic, V. (1994). Gene cluster controlling conversion to alginate-overproducing phenotype in Pseudomonas aeruginosa: functional analysis in a heterologous host and role in the instability of mucoidy. J Bacteriol 176, 33753382.
Schurr, M. J., Yu, H., Martinez-Salazar, J. M., Hibler, N. S. & Deretic, V. (1995). Biochemical characterization and posttranslational modification of AlgU, a regulator of stress response in Pseudomonas aeruginosa. Biochem Biophys Res Commun 216, 874880.[CrossRef][Medline]
Schurr, M. J., Yu, H., Martinez-Salazar, J. M., Boucher, J. C. & Deretic, V. (1996). Control of AlgU, a member of the
E -like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis. J Bacteriol 178, 49975004.
Stover, C. K., Pham, X. Q., Erwin, A. L. & 23 other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959964.[CrossRef][Medline]
Walsh, N. P., Alba, B. M., Bose, B., Gross, C. A. & Sauer, R. T. (2003). OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain. Cell 113, 6171.[CrossRef][Medline]
Wyckoff, T. J. O., Thomas, B., Hassett, D. J. & Wozniak, D. J. (2002). Static growth of mucoid Pseudomonas aeruginosa selects for non-mucoid variants that have acquired flagellum-dependent motility. Microbiology 148, 34233430.
Xie, Z.-D., Hershberger, C. D., Shankar, S., Ye, R. W. & Chakrabarty, A. M. (1996). Sigma factor-anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA. J Bacteriol 178, 49904996.
Yu, H., Schurr, M. J. & Deretic, V. (1995). Functional equivalence of Escherichia coli
E and Pseudomonas aeruginosa AlgU: E. coli rpoE restores mucoidy and reduces sensitivity to reactive oxygen intermediates in algU mutants of P. aeruginosa. J Bacteriol 177, 32593268.
Received 17 November 2004;
revised 21 March 2005;
accepted 23 March 2005.
This article has been cited by other articles:
![]() |
D. Qiu, V. M. Eisinger, D. W. Rowen, and H. D. Yu Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa PNAS, May 8, 2007; 104(19): 8107 - 8112. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chaba, I. L. Grigorova, J. M. Flynn, T. A. Baker, and C. A. Gross Design principles of the proteolytic cascade governing the {sigma}E-mediated envelope stress response in Escherichia coli: keys to graded, buffered, and rapid signal transduction Genes & Dev., January 1, 2007; 21(1): 124 - 136. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |