|
|
||||||||
Pi
tek1
1 Department of Microbiology, Gda
sk University of Technology, ul. G. Narutowicza 11/12, 80-952 Gda
sk, Poland
2 Department of Obstetrics and Gynecology, The University of Texas Medical Branch, Galveston, TX, USA
3 Department of Clinical Microbiology, Public Hospital No. 1, Gda
sk, Poland
Correspondence
Józef Kur
kur{at}altis.chem.pg.gda.pl
| ABSTRACT |
|---|
|
|
|---|
The GenBank/EMBL/DDBJ accession number for the sequence reported in this paper is AF329316.
| INTRODUCTION |
|---|
|
|
|---|
The invasion of eukaryotic cells by uropathogenic Escherichia coli represents a complex biological phenomenon. The invasion process and gene products involved in it are poorly understood. Invasion of epithelial and endothelial cells may be important for the development of urosepsis. Invasiveness of some uropathogenic E. coli strains has been implicated in the pathogenesis of meningitis in the newborn (Meier et al., 1996
). Furthermore, experimental chronic pyelonephritis has been found to be associated with bacteria that persist in the kidney interstitial tissue. This may be advantageous for the bacteria, because they are protected against host defence mechanisms, such as complement, and certain antibiotics (Donnenberg et al., 1994
).
E. coli strains express various adhesins on the surface of the bacterial cells that mediate attachment to mammalian receptors. Among the most frequent adhesins in uropathogens are the Dr family of adhesins of E. coli. In particular, Dr fimbriae are associated with cystitis, pregnancy pyelonephritis and diarrhoeal diseases. The Dr family includes fimbrial adhesins, such as Dr haemagglutinin (DraE adhesin) and F1845, and afimbrial adhesins, such as AFA-I, -II, -III and -IV. Members of this family bind to the Dra blood-group antigen present on decay-accelerating factor (DAF, CD55), a complement-regulatory and signalling molecule (Nowicki et al., 1989
, 2001
; Garcia et al., 1994
; Van Loy et al., 2002a
, b
; Pettigrew et al., 2004
).
Dr fimbriae of uropathogenic E. coli are assembled via the highly conserved chaperoneusher pathway, which directs the synthesis of over 30 different adhesive organelles expressed by a multitude of pathogenic bacteria (Hung et al., 1996
; Soto & Hultgren, 1999
; Pi
tek et al., 2005
). Genes important for the biogenesis of Dr fimbriae are encoded by the dra gene cluster (draA, draB, draC, draD, draP and draE). Dr fimbriae have been considered to be homopolymeric structures composed of DraE subunits. The process of biogenesis of Dr fimbriae requires the action of chaperone DraB and usher DraC. In the periplasm, the DraB protein interacts with fimbrial DraE subunits and, based on steric information contained in their structure, these subunits fold to a native, functional form. The DraE subunits lack an antiparallel
-strand, which is provided by the chaperone DraB as a parallel G1
-strand in the donor-strand complementation process. Only DraE subunits in a complex with the DraB protein are able to polymerize on contact with usher DraC, which forms a pore in the outer membrane that allows the translocation of the fimbrial subunits to the cell surface. During polymerization, the incoming DraE subunit removes the chaperone from its complex with the last subunit of a growing polymer by donor-strand exchange (Pi
tek et al., 2005
).
The Dr fimbriae-coding region of uropathogenic E. coli is associated with unique invasive properties. Insertional mutants of draE (fimbrial structural gene), draC and draB (genes involved in fimbrial biogenesis) and draD (invasin gene) were unable to enter HeLa cells. Complementation of the dra mutations with plasmid pBJN406 containing the dra operon restored and increased invasion (Goluszko et al., 1997b
).
The aim of this study was to determine the role of the DraC usher protein, which forms the outer-membrane channel, in the translocation of DraD invasin at the E. coli cell surface. Firstly, the investigations showed that mutation of draC, encoding the channel, affected the translocation of DraE fimbrial subunits, but did not disrupt export of DraD to the surface of bacterial cells. Secondly, the biogenesis of Dr fimbriae did not require the presence of the DraD protein.
| METHODS |
|---|
|
|
|---|
Bacterial cells were grown in L broth (LB) without glucose or on Luria agar (LA) plates (LB containing 1·5 % agar) supplemented with the appropriate antibiotics (Sigma).
Plasmid pBJN406, carrying the whole dra operon, and its transposon mutants with a mutation in the draE gene (draE : : TnPhoA) (pBJN17), draD gene (draD : : TnPhoA) (pBJN16) or draC gene (draC : : Tn5) (pBJN417) were described previously (Nowicki et al., 1987
, 1989
) (Table 1
).
|
Plasmid pCC90DraDmut (the DraD-negative mutant), containing the dra gene cluster, was constructed by replacement of the draD gene by an amplification product (SacI-digested PCR product) in which a stop codon was created in the three reading frames (the resulting plasmid was sequenced) (Table 1
).
Plasmid pCC90DraCmut, containing the dra gene cluster with a deletion of the region upstream of draB and a mutated draE gene, was constructed by site-directed mutagenesis [DraC-K11stop mutant, where the AAA triplet of the draC gene encoding Lys-11 was replaced with a TGA stop codon by using a QuikChange site-directed mutagenesis kit (Stratagene)] (the resulting plasmid was sequenced) (Table 1
).
An insertional draC mutant, E. coli DR14, of the clinical E. coli isolate IH11128 bearing Dr fimbriae was described previously (Goluszko et al., 1997a
) (Table 1
). This strain has lost adherence functions of the Dr haemagglutinin.
Plasmid pET-30 Ek/LIC, an expression vector with a strong T7 promoter, a kanamycin-resistance gene and a pBR322 origin of replication, was from Novagen.
Plasmid DNAs were isolated from E. coli cultures by using a Mini-prep Plus kit (A&A Biotechnology). Restriction enzymes were purchased from New England Biolabs. The reagents for PCR were obtained from DNA-Gda
sk II s.c. IPTG, agarose and other reagents were purchased from Sigma.
PCR amplification and cloning of the draD gene forms.
The draD gene forms, encoding bacterial DraD invasin, were prepared by PCR amplification using the DNA of plasmid pBJN406 as a template. The primers used in the amplification were designed based on the sequencing data obtained (GenBank accession no. AF329316). For amplification of the draDsyg gene, the following primers were used: DraD-syg-1 forward primer, ATAGGTACCCATATGCGTGTCACCTGCGGG (the underlined sequence contains recognition sequences for KpnI and NdeI endonucleases and the bold part is complementary to the nucleotide sequence at the 5' end of the draD gene) and DraD2-C-His reverse primer, TGCAAGCTTTTCCTGTGGCACCACACA (the underlined sequence contains the recognition sequence for HindIII endonuclease and the bold part is complementary to the nucleotide sequence at the 3' end of the draD gene). For amplification of the draDsygstop gene, the following primers were used: DraD-syg-1 forward primer and DraDsygstop-2 reverse primer, TGCGGATCCTCATTCCTGTGGCACCACACA (the underlined sequence contains the recognition sequence for BamHI endonuclease, the italicized sequence encodes a stop codon and the bold part is complementary to the nucleotide sequence at the 3' end of the draD gene).
The genes were amplified by using 35 cycles of PCR (94 °C for 30 s, 52 °C for 30 s and 72 °C for 30 s, in a Perkin-Elmer 2400 thermocycler). The draDsyg (438 bp) and draDsygstop (441 bp) PCR products, purified from the agarose-gel bands by using a DNA Gel-Out kit (A&A Biotechnology), digested with KpnI and HindIII/BamHI restriction enzymes (BioLabs) and purified by using a DNA Clean Up kit (A&A Biotechnology), were cloned directionally into the KpnI and HindIII/BamHI sites of pET-30 Ek/LIC vector (the genes are out of frame in this construct). These plasmids were then digested with NdeI endonuclease and ligated in the presence of KpnI endonuclease to provide the genes in-frame. The resulting recombinant plasmids were designated pInvDsyg-C-His and pInvDsygstop, respectively.
PCR amplification and cloning of the dra DNA fragment used for replacement of the draD gene encoded by the pCC90 plasmid.
In order to obtain the pCC90DraDmut plasmid, the DNA fragment of the dra gene cluster (containing the DNA fragment of the draD gene with a stop codon in the three reading frames, the draP gene and a DNA fragment of the draE gene) was amplified by using pBJN406 as a template. Sequences of the primers used to amplify the selected dra DNA fragment were: DraD-SacKpn forward primer GAGCTCGGTACCTGATTGATTGACAGGTGGACGGCAGGGCGGAG (the underlined sequence contains recognition sequences for SacI and KpnI endonucleases, permitting cloning of the SacI PCR product into plasmid pCC90, the bold parts of the primer sequence indicate stop codons in the three reading frames and the italicized portion of the primer sequence is complementary to the nucleotide sequence of the draD gene) and DraD-SacEco reverse primer GTCGAATTCGAGCTCACGGCGAACACCATGC (the underlined sequence contains recognition sequences for EcoRI and SacI endonucleases, permitting cloning of the SacI PCR product into plasmid pCC90, and the italicized portion of the primer sequence is complementary to the nucleotide sequence of the draE gene). The primers enabled the introduction of a SacI-digested PCR product into plasmid pCC90.
The selected region of the dra operon was amplified by using 30 cycles of PCR (94 °C for 30 s, 70 °C for 30 s and 72 °C for 30 s, in a Perkin-Elmer 2400 thermocycler). The 1078 bp PCR product, purified from an agarose-gel band by using a DNA Gel-Out kit (A&A Biotechnology), digested with SacI restriction enzyme (BioLabs) and purified by using a DNA Clean Up kit (A&A Biotechnology), was cloned directionally into the SacI sites of plasmid pCC90. The resulting recombinant plasmid, pCC90DraDmut, was selected by electrophoretic-mobility analysis, confirmed by restriction analysis and sequenced by using an automatic sequencing system (ABI Prism 377; Applied Biosystems).
Site-directed mutagenesis and construction of the pCC90DraCmut plasmid.
The AAA triplet of the draC gene encoding Lys-11 was replaced with a stop codon (TGA) by using a QuikChange site-directed mutagenesis kit (Stratagene), following the manufacturer's instructions. Two primers containing the desired mutation (underlined), DraC1mut forward (GCGGCCATGCTGTGAGGTGGCGGGAAGG) and DraC2mut reverse (CCTTCCCGCCACCTCACAGCATGGCCGC), were designed based on the sequencing data obtained (GenBank accession no. AF329316). Plasmid pCC90 was used as the template to introduce the mutation into draE. Mutation was confirmed by DNA sequencing using an ABI Prism 377 system.
Antisera.
Rabbit anti-Dr adhesin antibodies raised against purified native Dr fimbriae (Pham et al., 1997
) and rabbit anti-DraD invasin antibodies raised against purified DraD-C-His6 protein (Zalewska et al., 2001
) were described previously. Anti-rabbit IgG (whole molecule) antibodies conjugated to horseradish peroxidase were purchased from Sigma. Anti-rabbit IgG (whole molecule)tetramethylrhodamine isothiocyanate (TRITC) conjugate and anti-rabbit IgG (whole molecule)fluorescein isothiocyanate (FITC) conjugate were purchased from Sigma.
Detection of free thiols and disulfide bonds.
To detect disulfide bonds, 2 nM mature DraD-C-His6 protein per reaction was used. Detection of disulfide bonds was performed as described previously (Pi
tek et al., 2005
).
Purification of Dr fimbriae.
The recombinant plasmid pCC90DraDmut, encoding the dra gene cluster with a deletion of the region upstream of draB with a mutated draD gene, was introduced into E. coli BL21(DE3) and grown on LA plates with the appropriate antibiotic (100 µg ampicillin µl1) at 37 °C for 24 h. Dr fimbrial protein was isolated by heat-shock treatment, ammonium sulfate precipitation and size-exclusion chromatography, as described previously (Goluszko et al., 1999
). Protein concentration was determined by densitometric analysis with an SDS-PAGE low-molecular-weight calibration kit (Amersham Biosciences) as a standard, using a VersaDoc system with Quantity One software (both from Bio-Rad).
The recombinant E. coli BL21(DE3)-pCC90 strain was used as a positive control for Dr fimbriae expression. The recombinant strains of E. coli BL21(DE3)-pCC90D54stop and E. coli BL21(DE3)-pCC90DraCmut (not expressing Dr fimbriae at the cell surface) were used as negative controls.
Western blot analysis.
The samples were mixed with sample buffer and run in 15 % (w/v) bis-acrylamide gels containing SDS. The proteins were electroblotted onto nitrocellulose membranes and incubated with rabbit anti-Dr adhesin serum at a 1 : 5000 dilution or rabbit anti-DraD serum at a 1 : 1000 dilution. Blots were visualized as described previously (Zalewska et al., 2003
).
Immunofluorescence microscopy (IFM).
Cells from cultures grown on LA plates at 37 °C for 24 h were harvested and washed gently in PBS. Bacterial suspensions (100 µl; 105106 cells ml1) were incubated with 50 µl of a 1 : 500 dilution (anti-fimbriae Dr) or 1 : 250 dilution (anti-DraD invasin) in PBS of the primary antibodies at room temperature for 1 h. The reaction mixtures were then washed three times with PBS containing 10 % (v/v) glycerol and incubated with 50 µl of a 1 : 25 dilution (anti-rabbit IgGTRITC conjugate for the DraD protein) or 1 : 50 dilution (anti-rabbit IgGFITC conjugate for the DraE protein) in PBS of secondary antibodies at room temperature for 1 h. The reaction mixtures were then washed again three times with PBS containing 10 % (v/v) glycerol. Bacterial suspensions (10 µl) were loaded on glass slides and observed with an immunofluorescence microscope (Olympus BX-60).
| RESULTS |
|---|
|
|
|---|
|
|
|
The obtained results suggest that expression of Dr fimbriae at the bacterial cell surface did not require DraD. These data also revealed that, in appropriate mutants, the expression of DraE fimbrial subunits was independent of DraD expression. Conversely, DraD expression was also independent of DraE expression. The lack of immuno-identification of DraD protein in the isolated Dr fimbrial fractions suggests that the majority of Dr fimbrial structures were probably composed of DraE fimbrial subunits only, and that the majority of the DraD protein may be independent components of the cell surface. Alternatively, in an intact dra operon, a small fraction of the DraD protein may be used to cap the fimbrial structures at the surface of bacterial cells, as proposed recently by Anderson et al. (2004)
. The concentration of tip DraD may be very low and difficult to detect in the presence of hundreds of DraE structural subunits forming fimbrial fibre.
Defining the role of DraC in the translocation mechanism of DraD
A summary of IFM results of DraD surface expression for E. coli strains harbouring the recombinant plasmids is described in Table 2
. By using site-directed mutagenesis, we constructed the recombinant plasmid pCC90DraCmut to determine the function of DraC (the outer-membrane channel) in the translocation of DraD invasin at the E. coli Dr+ cell surface. pCC90DraCmut encodes the dra gene cluster without a regulatory region and with a stop codon within the draC gene. IFM with rabbit anti-Dr (anti-Dr-anti-FITC) and anti-DraD (anti-DraD-anti-TRITC) antibodies detected the presence of only DraD on the surface of E. coli BL21(DE3) cells harbouring recombinant plasmid pCC90DraCmut (Figs 2i and 3i![]()
). We obtained the same result with E. coli BL21(DE3) cells transformed with pBJN417, encoding the entire dra gene cluster with a transposon-insertion mutation within the draC gene (draC : : Tn5) (Figs 2o and 3o![]()
). IFM analysis of the insertional draC mutant of the clinical E. coli isolate IH11128 (E. coli DR14) detected the presence of only DraD on the surface of cells (Figs 2t and 3t![]()
). The ability of E. coli DR14 strain to express DraE and DraD proteins was tested by immunoblotting analysis. The fimbria-specific rabbit anti-Dr antibodies recognized DraE fimbrial protein and the purified rabbit anti-DraD recognized DraD protein in the E. coli DR14 total lysate (results not shown). Based on these experiments, we concluded that the DraC protein was not required in the transport of the DraD to the bacterial surface. E. coli BL21(DE3)-pCC90, encoding the dra gene cluster without a regulatory region (Fig. 3c
), BL21(DE3)-pBJN406 strain, encoding the entire dra gene cluster (Fig. 3k
), and BL21(DE3)-pCC90D54stop (Fig. 3g
) and BL21(DE3)-pBJN17 with the inactivated draE gene (Fig. 3r
) were used as positive controls for DraD surface expression. For negative controls, we used E. coli BL21(DE3) not expressing the dra gene cluster (Fig. 3a
) and BL21(DE3)-pCC90DraDmut (Fig. 3e
) and BL21(DE3)-pBJN16 with the inactivated draD gene (Fig. 3m
). To our knowledge, this is the first report to identify the DraD protein on the bacterial surface by using draC and/or draE E. coli mutants.
|
| DISCUSSION |
|---|
|
|
|---|
tek et al., 2005
The obtained results revealed that the level of DraE surface expression from our constructs was similar to those from the pCC90 plasmid (Carnoy & Moseley et al., 1997
). The E. coli strain harbouring pCC90D54stop (Carnoy & Moseley et al., 1997
) with a mutated draE gene was used to characterize the expression of DraD invasin. These experiments showed that the surface expression of DraD in draE mutants was independent of DraE (fimbriae) expression. Conversely, the ability of E. coli BL21(DE3)-pCC90DraDmut (producing no DraD) to express native Dr fimbriae was not affected, as confirmed by Western blotting and IFM with purified rabbit anti-Dr antibodies recognizing DraE adhesin. The anti-DraD antibodies (recognizing epitopes of DraD invasin) did not react with the purified Dr fimbrial fractions isolated from the surface of the studied E. coli cells. The obtained results may indicate a few alternative scenarios. One option is that the DraD protein is not a component of Dr fimbriae and has independent, surface-located structures. An alternative explanation is that DraD is a tip subunit capping a homopolymeric fibre composed of DraE fimbrial subunits, as suggested by Anderson et al. (2004)
. Because the concentration of hundreds of DraE structural subunits forming the fimbrial fibre is disproportionally higher than the concentration of a tip subunit, the identification of DraD protein in the described samples was not possible, as its level was below the sensitivity of the method used. The analyses performed with DraD- or DraE-negative mutants also indicated that the expression of one protein at the surface of bacterial cells did not require production of the other. This does not, however, exclude the third possibility that DraD may be expressed in two forms (fimbriae-associated and not fimbriae-associated) and that cooperation between DraE and DraD may be beneficial for E. coli invasion, as confirmed by Goluszko et al. (1997b)
. The performed experiments revealed that insertional mutants of draE, draD, draC, draB and UV-inactivated pBJN406 lost their invasiveness and were unable to enter HeLa cells, suggesting a role for the draE gene and one or more dra genes in this process. Only the draD mutant retained weak haemagglutination and HeLa-adherence properties (about four or five bacteria per HeLa cell) (Goluszko et al., 1997b
).
The obtained data indicate that the export of DraD protein to the cell surface (in the draC mutant) does not involve the DraC outer-membrane usher protein. Our results demonstrated also for the first time that, in the absence of DraD, the DraE adhesin of uropathogenic E. coli was surface-exposed independently. Expression of the DraE fimbrial protein at the cell surface does not require expression of the DraD protein and, conversely, the surface expression of DraD does not require DraE adhesin expression. Identification of the specific protein forming a pore in the outer membrane, allowing the translocation of DraD subunits to the cell surface, will be the next step of our research. This will be very important for increasing our understanding of the invasion process and the role of independent expression of DraE and DraD proteins in the pathophysiology of infections caused by E. coli strains of the Dr family.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Braaten, B. A., Nou, X., Kaltenbach, L. S. & Low, D. A. (1994). Methylation patterns in pap regulatory DNA control pyelonephritis-associated pili phase variation in E. coli. Cell 76, 577588.[CrossRef][Medline]
Carnoy, C. & Moseley, S. L. (1997). Mutational analysis of receptor binding mediated by the Dr family of Escherichia coli adhesins. Mol Microbiol 23, 365379.[CrossRef][Medline]
Donnenberg, M. S., Newman, B., Utsalo, S. J., Trifillis, A. L., Hebel, J. R. & Warren, J. W. (1994). Internalization of Escherichia coli into human kidney epithelial cells: comparison of fecal and pyelonephritis-associated strains. J Infect Dis 169, 831838.[Medline]
Garcia, M.-I., Labigne, A. & Le Bouguenec, C. (1994). Nucleotide sequence of the afimbrial-adhesin-encoding afa-3 gene cluster and its translocation via flanking IS1 insertion sequences. J Bacteriol 176, 76017613.
Garcia, M.-I., Gounon, P., Courcoux, P., Labigne, A. & Le Bouguenec, C. (1996). The afimbrial adhesive sheath encoded by the afa-3 gene cluster of pathogenic Escherichia coli is composed of two adhesins. Mol Microbiol 19, 683693.[CrossRef][Medline]
Garcia, M.-I., Jouve, M., Nataro, J. P., Gounon, P. & Le Bouguénec, C. (2000). Characterization of the AfaD-like family of invasins encoded by pathogenic Escherichia coli associated with intestinal and extra-intestinal infections. FEBS Lett 479, 111117.[CrossRef][Medline]
Goluszko, P., Moseley, S. L., Truong, L. D., Kaul, A., Williford, J. R., Selvarangan, R., Nowicki, S. & Nowicki, B. (1997a). Development of experimental model of chronic pyelonephritis with Escherichia coli O75 : K5 : H-bearing Dr fimbriae. J Clin Invest 99, 16621672.[Medline]
Goluszko, P., Popov, V., Selvarangan, R., Nowicki, S., Pham, T. & Nowicki, B. J. (1997b). Dr fimbriae operon of uropathogenic Escherichia coli mediate microtubule-dependent invasion to the HeLa epithelial cell line. J Infect Dis 176, 158167.[Medline]
Goluszko, P., Selvarangan, R., Popov, V., Pham, T., Wen, J. W. & Singhal, J. (1999). Decay-accelerating factor and cytoskeleton redistribution pattern in HeLa cells infected with recombinant Escherichia coli strains expressing Dr family of adhesins. Infect Immun 67, 39893997.
Hung, D. L., Knight, S. D., Woods, R. M., Pinkner, J. S. & Hultgren, S. J. (1996). Molecular basis of two subfamilies of immunoglobulin-like chaperones. EMBO J 15, 37923805.[Medline]
Meier, C., Oelschlaeger, T. A., Merkert, H., Korhonen, T. K. & Hacker, J. (1996). Ability of Escherichia coli isolates that cause meningitis in newborns to invade epithelial and endothelial cells. Infect Immun 64, 23912399.[Abstract]
Niemann, H. H., Schubert, W.-D. & Heinz, D. W. (2004). Adhesins and invasins of pathogenic bacteria: a structural view. Microbes Infect 6, 101112.[CrossRef][Medline]
Nowicki, B., Barrish, J. P., Korhonen, T., Hull, R. A. & Hull, S. I. (1987). Molecular cloning of the Escherichia coli O75X adhesin. Infect Immun 55, 31683173.
Nowicki, B., Svanborg-Edén, C., Hull, R. & Hull, S. (1989). Molecular analysis and epidemiology of the Dr hemagglutinin of uropathogenic Escherichia coli. Infect Immun 57, 446451.
Nowicki, B., Selvarangan, R. & Nowicki, S. (2001). Family of Escherichia coli Dr adhesins: decay-accelerating factor receptor recognition and invasiveness. J Infect Dis 183, S24S27.
Pettigrew, D., Anderson, K. L., Billington, J. & 10 other authors (2004). High resolution studies of the Afa/Dr adhesin DraE and its interaction with chloramphenicol. J Biol Chem 279, 4685146857.
Pham, T. Q., Goluszko, P., Popov, V., Nowicki, S. & Nowicki, B. (1997). Molecular cloning and characterization of Dr-II, a nonfimbrial adhesin-I-like adhesin isolated from gestational pyelonephritis-associated Escherichia coli that binds to decay-accelerating factor. Infect Immun 65, 43094318.[Abstract]
Pi
tek, R., Zalewska, B., Kolaj, O., Ferens, M., Nowicki, B. & Kur, J. (2005). Molecular aspects of biogenesis of Escherichia coli Dr fimbriae: characterization of DraB-DraE complexes. Infect Immun 73, 135145.
Soto, G. E. & Hultgren, S. J. (1999). Bacterial adhesins: common themes and variations in architecture and assembly. J Bacteriol 181, 10591071.
van der Woude, M. W. & Low, D. A. (1994). Leucine-responsive regulatory protein and deoxyadenosine methylase control the phase variation and expression of the sfa and daa pili operons in Escherichia coli. Mol Microbiol 11, 605618.[Medline]
Van Loy, C. P., Sokurenko, E. V. & Moseley, S. L. (2002a). The major structural subunits of Dr and F1845 fimbriae are adhesins. Infect Immun 70, 16941702.
Van Loy, C. P., Sokurenko, E. V., Samudrala, R. & Moseley, S. L. (2002b). Identification of amino acids in the Dr adhesin required for binding to decay-accelerating factor. Mol Microbiol 45, 439452.[CrossRef][Medline]
Westerlund, B., Kuusela, P., Risteli, J., Risteli, L., Vartio, T., Rauvala, H., Virkola, R. & Korhonen, T. K. (1989). The O75X adhesin of uropathogenic Escherichia coli is a type IV collagen-binding protein. Mol Microbiol 3, 329337.[CrossRef][Medline]
Zalewska, B., Pi
tek, R., Cie
linski, H., Nowicki, B. & Kur, J. (2001). Cloning, expression, and purification of the uropathogenic Escherichia coli invasin DraD. Protein Expr Purif 23, 476482.[CrossRef][Medline]
Zalewska, B., Pi
tek, R., Konopa, G., Nowicki, B., Nowicki, S. & Kur, J. (2003). Chimeric Dr fimbriae with a herpes simplex virus type 1 epitope as a model for a recombinant vaccine. Infect Immun 71, 55055513.
Received 1 April 2005;
revised 15 April 2005;
accepted 17 April 2005.
This article has been cited by other articles:
![]() |
N. Korotkova, Y. Yarova-Yarovaya, V. Tchesnokova, N. Yazvenko, M. A. Carl, A. E. Stapleton, and S. L. Moseley Escherichia coli DraE Adhesin-Associated Bacterial Internalization by Epithelial Cells Is Promoted Independently by Decay-Accelerating Factor and Carcinoembryonic Antigen-Related Cell Adhesion Molecule Binding and Does Not Require the DraD Invasin Infect. Immun., September 1, 2008; 76(9): 3869 - 3880. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zalewska-Piatek, K. Bury, R. Piatek, P. Bruzdziak, and J. Kur Type II Secretory Pathway for Surface Secretion of DraD Invasin from the Uropathogenic Escherichia coli Dr+ Strain J. Bacteriol., July 15, 2008; 190(14): 5044 - 5056. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Jacobsen, D. J. Stickler, H. L. T. Mobley, and M. E. Shirtliff Complicated Catheter-Associated Urinary Tract Infections Due to Escherichia coli and Proteus mirabilis Clin. Microbiol. Rev., January 1, 2008; 21(1): 26 - 59. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-P. Nuccio and A. J. Baumler Evolution of the Chaperone/Usher Assembly Pathway: Fimbrial Classification Goes Greek Microbiol. Mol. Biol. Rev., December 1, 2007; 71(4): 551 - 575. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |