Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 151 (2005), 2805-2814; DOI  10.1099/mic.0.28063-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Rij, E. T.
Right arrow Articles by Bloemberg, G. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Rij, E. T.
Right arrow Articles by Bloemberg, G. V.
Agricola
Right arrow Articles by van Rij, E. T.
Right arrow Articles by Bloemberg, G. V.
Microbiology 151 (2005), 2805-2814; DOI  10.1099/mic.0.28063-0
© 2005 Society for General Microbiology

Influence of fusaric acid on phenazine-1-carboxamide synthesis and gene expression of Pseudomonas chlororaphis strain PCL1391

E. Tjeerd van Rij{dagger}, Geneviève Girard{dagger}, Ben J. J. Lugtenberg and Guido V. Bloemberg

Leiden University, Institute of Biology, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands

Correspondence
Guido V. Bloemberg
bloemberg{at}rulbim.leidenuniv.nl


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Production of the antifungal metabolite phenazine-1-carboxamide (PCN) by Pseudomonas chlororaphis strain PCL1391 is essential for the suppression of tomato foot and root rot caused by the soil-borne fungus F. oxysporum f. sp. radicis-lycopersici. The authors have shown previously that fusaric acid (FA), a phytotoxin produced by Fusarium oxysporum, represses the production of PCN and of the quorum-sensing signal N-hexanoyl-L-homoserine lactone (C6-HSL). Here they report that PCN repression by FA is maintained even during PCN-stimulating environmental conditions such as additional phenylalanine, additional ferric iron and a low Mg2+ concentration. Constitutive expression of phzI or phzR increases the production of C6-HSL and abolishes the repression of PCN production by FA. Transcriptome analysis using P. chlororaphis PCL1391 microarrays showed that FA represses expression of the phenazine biosynthetic operon (phzABCDEFGH) and of the quorum-sensing regulatory genes phzI and phzR. FA does not alter expression of the PCN regulators gacS, rpoS and psrA. In conclusion, reduction of PCN levels by FA is due to direct or indirect repression of phzR and phzI. Microarray analyses identified genes of which the expression is strongly influenced by FA. Genes highly upregulated by FA are also upregulated by iron starvation in Pseudomonas aeruginosa. This remarkable overlap in the expression profile suggests an overlapping stress response to FA and iron starvation.


Abbreviations: HSL, homoserine lactone; C6-HSL, N-hexanoyl-L-homoserine lactone; FA, fusaric acid; PCN, phenazine-1-carboxamide

Supplementary microarray data are available with the online version of this paper.

{dagger}These authors contributed equally to this paper.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pseudomonas chlororaphis strain PCL1391 gives excellent biocontrol of tomato foot and root rot, a disease caused by the fungus Fusarium oxysporum f. sp. radicis-lycopersici (Chin-A-Woeng et al., 1998Down). In the tomato rhizosphere PCL1391 colonizes the same niche as occupied by F. oxysporum hyphae, and closely interacts with F. oxysporum by attaching to, and forming micro-colonies on, hyphae (Bolwerk et al., 2003Down). Secretion of toxic and growth-inhibiting compounds by both the fungus and the bacterial biocontrol strain is part of the complex interaction between fungi and bacteria.

PCL1391 produces the antifungal metabolite phenazine-1-carboxamide (PCN), which inhibits hyphal growth (Chin-A-Woeng et al., 1998Down). Using a PCN biosynthetic mutant it was shown that PCN is essential for the biocontrol ability of PCL1391 (Chin-A-Woeng et al., 1998Down). PCN production is regulated by the quorum-sensing regulatory genes phzI and phzR, which are homologous to luxI and luxR (Chin-A-Woeng et al., 2001bDown). In addition, biosynthesis of PCN is dependent on the two-component regulatory system formed by GacS and GacA and is regulated by PsrA and the stationary-phase sigma factor encoded by rpoS (Chin-A-Woeng et al., 2005Down; G. Girard, unpublished).

Plant-pathogenic and non-pathogenic Fusarium spp. produce fusaric acid (FA; 5-butylpicolinic acid) (Bacon et al., 1996Down; Notz et al., 2002Down; Schouten et al., 2004Down). FA is toxic for eukaryotes and prokaryotes (Bochner et al., 1980Down; Wang & Ng, 1999Down). In addition, FA was shown to be involved in fungal defence against Pseudomonas spp. biocontrol strains by repressing the production of antifungal metabolites. FA represses the production of 2,4-diacetylphloroglucinol in Pseudomonas fluorescens CHA0 (Duffy & Défago, 1997Down) and the synthesis of PCN in P. chlororaphis PCL1391 (van Rij et al., 2004Down). The latter repression is correlated with a reduction of the level of the auto-inducer N-hexanoyl-L-homoserine lactone (C6-HSL) (van Rij et al., 2004Down).

In this study we investigated the repression of PCN biosynthesis by FA in more detail with the aim of (i) analysing the molecular mechanisms and environmental conditions which influence PCN production in the presence of FA and (ii) identifying new genes of which the expression is affected by the presence of FA.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Micro-organisms and culture conditions.
The microbial strains and plasmids used are listed in Table 1Down. Luria–Bertani (LB) medium (Sambrook & Russell, 2001Down) was used as standard medium for culturing Escherichia coli and Chromobacterium violaceum. A modified Vogel–Bonner medium (van Rij et al., 2004Down; Vogel & Bonner, 1956Down) was used to culture Pseudomonas cells. Modified Vogel–Bonner salts #1 (MVB1) contained final concentrations of 30 mM glucose, 0·05 % (w/v) Casamino acids, 57 mM K2HPO4, 16 mM Na(NH4)HPO4, 81 mM MgSO4, 78 µM NaFe(III)EDTA, 6·8 µM MnSO4, 0·35 µM CuSO4, 4·1 µM Na2MoO4, 0·85 µM ZnSO4, 51 µM H3BO3; the pH was adjusted to 6·6 using HCl (van Rij et al., 2004Down). If indicated, phenylalanine or fusaric acid (Acros) was added to MVB1 at a final concentration of 1·0 mM. The magnesium concentration was modified by replacing MgSO4 by 0·8 mM K2SO4 and 0·08 mM MgCl2. Solidified growth media contained 1·8 % (w/v) agar (Difco). If appropriate, media were supplemented with the antibiotics kanamycin or gentamicin at final concentrations of 50 and 30 µg ml–1, respectively. Cultures were shaken at 195 r.p.m. on a Janke und Kunkel shaker KS501D (Staufen) at 28 °C and growth was monitored by measuring OD620. Growth analyses and RNA isolation were conducted in 100 ml flasks with 10 ml medium after inoculation from an appropriate 5 ml overnight culture to an OD620 of 0·1.


View this table:
[in this window]
[in a new window]
 
Table 1. Micro-organisms and plasmids used in this study

 
Analyses of bioluminescent Tn5luxAB reporter strains.
Expression of Tn5luxAB-tagged genes was determined by quantification of luxAB activity during culturing. Samples of 100 µl were taken in duplicate and 100 µl substrate solution, containing 0·2 % (v/v) n-decyl aldehyde (Sigma) and 2·0 % (w/v) bovine serum albumin, was added. Bioluminescence was determined using a luminescence counter (MicroBeta 1450 TriLux, Wallac).

DNA manipulation.
PCRs were carried out with Super Taq enzyme (Enzyme Technologies). The primers were synthesized by Isogen Life Science. Restriction enzymes were purchased from New England BioLabs and ligase from Promega. To PCR the phzI gene under the Plac promoter, primers oMP812 (5'-ATATATGAATTCAATTGTGAGCGGATAACAATTTCACACAGGAAACAGGATCCTAAAATGATGCACATGGAAGAGCACACACTGAACGG-3') and oMP813 (5'-ATATATGAATTCCGGCGTGATCATGGGGGTGTGCACCG-3') were used. The resulting PCR fragment was digested with EcoRI and ligated into EcoRI-digested pBBR1-MCS5 to obtain pMP7450. A PCR fragment with the phzR gene under control of the Ptac promoter was constructed (G. Girard, unpublished) by using primers oMP777 (5'-ATATATCTCGAGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTTCACACAGGAAACAGCTAAATGGAGTTAGGGCAGCAGTTGGGATGGG-3') and oMP778 (5'-ATATATGAATTCCCCCTCAGATATAGCCCATCGCAACTGCG-3'). The resulting PCR fragment was digested with XhoI and EcoRI and ligated into XhoI- and EcoRI-digested pBBR-MCS5 to obtain pMP7447.

Analysis of PCN production.
For monitoring PCN production in time, PCN was extracted according to Chin-A-Woeng et al. (1998)Down with minor modifications. Culture samples (250 µl) were centrifuged and the culture supernatants were acidified to pH 2 using 6 M HCl. They were subsequently extracted with an equal volume of toluene by shaking on an Eppendorf mixer 5432 for 5 min. After centrifugation, the toluene phase was collected and dried in a rotary evaporator. The dry residue was dissolved in 100 µl acetonitrile and the solution obtained was mixed with 400 µl water.

PCN concentrations were determined by HPLC (DIONEX, Chromeleon software version 6.20) using a calibration curve. HPLC was performed using an Econosphere C18 5u, 259 mmx4·6 mm column (Alltech Associates) at 30 °C with a linear gradient of 20–80 % (v/v) acetonitrile acidified with 0·1 % (v/v) trifluoroacetic acid in water and a flow rate of 1 ml min–1.

Analysis of N-acylhomoserine lactone production.
Culture supernatants were adjusted to pH 9·0 with NaOH. The supernatants were extracted with 0·5 vol. ethyl acetate, shaken for 30 min and the solvent phase was collected. Subsequently the solvent phase was dried by rotary evaporation. The dried residue was dissolved in 25 µl acetonitrile and analysed by TLC. Samples spotted on C18 TLC plates (Merck) were developed in methanol/water (60 : 40, v/v). After development, the TLC was overlaid with LB 0·8 % (w/v) agar containing a 10-fold diluted overnight culture of the C. violaceum indicator strain CV026 (McClean et al., 1997Down) and kanamycin (50 µg ml–1). After incubation for 48 h at 28 °C, chromatograms were analysed for appearance of violet spots.

Construction of a chromosomal microarray of P. chlororaphis PCL1391.
Microarray construction, RNA isolation, and data analyses were developed by G. Girard. Microarray analyses were performed according to the MIAME standards (Brazma et al., 2001Down). The chromosomal microarray consists of approximately 12 000 random chromosomal SauIIIA DNA fragments from PCL1391 between 0·4 and 2 kb in size. After an initial cloning of the chromosomal fragments into pBluescript, each insert was amplified with amino-labelled primers annealing to the multicloning site flanking the insert. PCR products were spotted on poly-L-lysine-coated glass slides with a Genemachines Omnigrid 100 spotter (Genomic Solutions). The microarrays were designed to contain the following controls: empty spots (neither DNA, nor buffer), spots with only 50 % (v/v) DMSO, a negative control with {lambda} phage DNA (Westburg), and PCR products of several known genes of PCL1391: phzB, phzH, phzR, phzI, sss, gacS and psrA (Chin-A-Woeng et al., 2000Down, 2001aDown, bDown, 2005Down).

RNA preparation and microarray processing.
RNA was extracted from cultures at an OD620 of 2·0 with an adapted protocol developed by Jon Bernstein (http://bugarrays.stanford.edu/protocols/rna/Total_RNA_from_Ecoli.pdf). After phenol/chlorophorm extraction, the supernatant was applied to columns from the RNeasy Midi kit (Qiagen), and the RNA was extracted following the protocol supplied by the manufacturer, including the DNase step. RNA purity was verified on 1·2 % (w/v) agarose gel following the protocol of the RNeasy Midi kit. RNA was immediately used for cDNA probe generation using the CyScribe post-labelling kit (Amersham Biosciences). Each reaction was performed with 30 µg of total RNA and random nanomers. After purification, the efficiency of Cy label incorporation into the cDNA and the quality and amounts of labelled cDNA were verified with a Ultrospec 2100 Pro spectrophotometer (Amersham Biosciences). The amounts of Cy-labelled cDNA were calculated using http://www.pseudomics.com/percent_inc.html. Equal amounts of cDNA for both Cy3 and Cy5 labels, with a minimum of 40 pM of each dye, were hybridized. Before hybridization, the microarrays were rehydrated by H2O steam at 50 °C and snap-cooled on a hot plate. Then they were UV-cross-linked at 250 mJ cm–2 (Amersham Life Sciences UV cross-linker). They were subsequently prehybridized with 100 µl prehybridization buffer [0·4 µg µl–1 herring sperm DNA (Gibco, Invitrogen), 0·4 µg µl–1 yeast tRNA (Gibco, Invitrogen), 5x Denhardt's (Denhardt, 1966Down), 3·2x SSC (sodium chloride/sodium citrate buffer, 3 M NaCl/0·3 M trisodium citrate), 0·4 %, w/v, SDS] for 2 min at 80 °C and 30 min at 65 °C. Finally, the slides were washed at room temperature in 2x SSC, twice in 70 % (v/v) ethanol, once in 90 % (v/v) and 100 % (v/v) ethanol (5 min per wash step) and air-dried. The Cy-labelled cDNA was hybridized overnight at 65 °C in a GeneTAC Hybstation (Genomic Solutions). After hybridization, the slides were washed in 2x SSC, 0·1 % (w/v) SDS for 5 min at 30 °C, in 0·5x SSC for 5 min at 25 °C and in 0·2x SSC for 5 min at 25 °C. The slides were dehydrated by washing in 70 %, 90 % and 100 % (v/v) ethanol (1 min per wash step), dried by compressed air and scanned in a G2565AA microarray scanner (Agilent). The experiment was repeated at least four times, including dye swaps.

Microarray data analysis.
After scanning, the microarrays were analysed in GenePix Pro version 5.0 (Molecular Devices). The following criteria were implemented to select spots corresponding to genes assumed to be affected significantly in their expression by FA: spots were considered as interesting if the mean of the ratio of red and green laser intensities was higher than 2 [ratio of medians (650/550)>2] or lower than 0·5, but positive [ratio of medians (650/550)<0·5 and ratio of medians (650/550)>0]. In both cases, the spots were selected only if they had at least 80 % of their feature pixels more than two standard deviations above background in both the green and red channel [(%>B550+2SD)>80 and (%>b650+2SD)>80]. Results of four identical microarray experiments were compared and spots were categorized into three groups: (i) expression unaltered by FA; (ii) more than twofold upregulated by FA; (iii) more than twofold downregulated by FA. The values were normalized assuming that most genes of the array are not differentially expressed. Results of four microarray experiments were used in our analyses. Raw microarray data, microarray image, and sequences of clones are available as supplementary data with the online version of this paper.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
FA represses PCN production under different environmental conditions
The effect of 1 mM FA on PCN production was evaluated under environmental conditions that stimulate PCN production (van Rij et al., 2004Down). The latter conditions included 1 mM phenylalanine, a 10-fold reduction of Mg2+ to a final concentration of 0·08 mM Mg2+, and a 23-fold increase of ferric ions (Fe3+) with a final concentration of 2 mM FeCl3 (Table 2Down). A combination of FA and phenylalanine increased PCN production compared to FA alone but decreased PCN production compared to phenylalanine alone. FA suppressed the positive effect of a low Mg2+ or high ferric ion concentration on PCN production. FA has divalent cation chelating characteristics which include iron (Bochner et al., 1980Down), and iron limitation is known to repress PCN production (van Rij et al., 2004Down); this suggests iron chelation by FA as a possible mechanism by which FA represses PCN production. To test that hypothesis, the effect of adding 0·1 mM and 1·0 mM of the strong iron chelator ethylenediamine-di(o-hydroxyphenylacetic acid) (EDDHA) to the growth medium was studied. A concentration of 1·0 mM EDDHA did not alter the production of PCN compared to that in the control. A tenfold lower concentration of EDDHA almost doubled PCN production compared to the control.


View this table:
[in this window]
[in a new window]
 
Table 2. Cumulative effect of FA and other conditions on PCN production by P. chlororaphis strain PCL1391

Cells grown at 28 °C in MVB1 served as a control. The PCN concentration in the supernatant fluid was measured by HPLC when cells reached stationary phase. Means and standard deviations of at least three experiments are shown. Values followed by different letters are significantly different at P=0·05 according to Fisher's least significant difference test. ND, Not determined.

 
Another divalent cation which is a possible candidate for FA chelation is zinc. Reduced zinc levels caused by FA chelation could cause PCN repression since zinc is structurally important in the ferric uptake regulator (Fur) protein (Pohl et al., 2003Down). The effect of different zinc concentrations in combination with FA was investigated (Table 3Down). Zinc concentrations of 10 µM, 100 µM and 2 mM ZnSO4 did not increase PCN production with or without FA. To rule out interference of {mic1512805E001}, the effect of ZnCl2 was investigated in an identical experiment, which gave similar results (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 3. Cumulative effect of FA and zinc on PCN production by P. chlororaphis strain PCL1391

Cells grown at 28 °C in MVB1 served as a control. The PCN concentration in the supernatant fluid was measured by HPLC when cells reached stationary phase. Means and standard deviations of at least three experiments are shown. Values followed by different letters are significantly different at P=0·05 according to Fisher's least significant difference test.

 
Expression of phzI and phzR is repressed by FA under different environmental conditions
The quorum-sensing regulators phzI and phzR regulate PCN production (Chin-A-Woeng et al., 2001bDown). Transcription of these regulators was monitored during growth in standard MVB1 medium. Transcription of phzI in the phzI : : Tn5luxAB mutant (PCL1103) remained at basal level with and without FA. Because PCL1103 does not contain a functional phzI there is no production of C6-HSL and the auto-induction of phzI can not take place (Fig. 1Down). Additional synthetic C6-HSL (5 µM) induced phzI transcription. Adding both C6-HSL and FA resulted in the repression of phzI transcription. Transcription of phzR in PCL1104 (phzR : : Tn5luxAB) was also repressed by FA (Fig. 1Down). Transcription of phzI and phzR was reduced by FA during growth under PCN-stimulating conditions which included additional phenylalanine, a low Mg2+ concentration, and additional ferric iron (Fig. 2Down). MVB1 with phenylalanine resulted in phzI and phzR transcription reaching a maximum between OD620 2 and OD620 3 and decreasing when cells reach OD620 4. Additional phenylalanine and FA advances the peak of phzI and phzR transcription towards OD620 1 (Fig. 2aDown). Additional ferric iron or a low Mg2+ concentration shows the largest repression of phzI and phzR transcription by FA (Fig. 2b, cDown).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1. Expression of phzI (PCL1103) with and without 5 µM synthetic C6-HSL (HHL) and phzR (PCL1104) in P. chlororaphis PCL1391. Cells were grown in MVB1 in the absence (black symbols) and in the presence (white symbols) of FA. Luminescence values were measured in counts per second (c.p.s.) per optical density unit during growth. Means±SD of two samples are shown.

 


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. Expression of phzI (PCL1103) with 5 µM synthetic C6-HSL (HHL) and phzR (PCL1104) grown in MVB1 with (a) additional 1 mM phenylalanine, (b) reduced Mg2+ concentration, or (c) additional 2 mM FeCl3. Cells were grown in the absence (black symbols) and in the presence (white symbols) of 1 mM FA. Luminescence values were measured in counts per second (c.p.s.) per optical density unit during growth. Means±SD of two samples are shown.

 
Constitutive expression of phzI or phzR restores PCN production in the presence of FA
It can be predicted that PhzI is responsible for the synthesis of the autoinducer C6-HSL (Chin-A-Woeng et al., 2001bDown), the production of which is reduced by the presence of FA (van Rij et al., 2004Down). The phzI gene is constitutively expressed in PCL1999, which is a PCL1391 derivative containing plasmid pMP7450 with phzI under the control of the constitutive lac promoter. This strain overproduces C6-HSL more then tenfold in comparison with PCL1391 (Fig. 3Down). It appeared that PCN production by PCL1999 was not affected by the presence of FA (Fig. 4Down).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 3. Influence of FA on the production of HSL by P. chlororaphis strain PCL1391. Lanes 1 and 2, PCL1391; lanes 3 and 4: PCL1999 (PCL1391 containing a constitutive phzI gene in trans); lanes 5 and 6, PCL1993 (PCL1391 containing a constitutive phzR gene in trans); lane 7, synthetic C6-HSL standard (2·5x10–7 mol); lane 8, synthetic C4-HSL (3x10–6 mol) and C6-HSL (2·5x10–8 mol). Samples in lanes 2, 4 and 6 were grown in the presence of 1 mM FA. Samples were separated by C18 reverse-phase TLC and visualized using C. violaceum strain CV026. Extracts were isolated at OD620 3·0. The experiment was performed three times with similar results.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Influence of constitutive expression of phzR and phzI on the inhibition of PCN production by FA. Cells of P. chlororaphis PCL1391 were grown on MVB1 and the PCN concentrations of the supernatant fluids were quantified by HPLC when cells reached stationary phase. Strains PCL1391 (wild-type), PCL1960 (PCL1391 with empty vector), PCL1993 (PCL1391 containing a constitutive phzR gene in trans) and PCL1999 (PCL1391 containing a constitutive phzI gene in trans) were grown in the absence and presence of 1 mM FA. Means and standard deviations of at least three experiments are shown. Bars with different letters are significantly different at P=0·05 according to Fisher's least significant difference test.

 
Constitutive expression of the second quorum-sensing regulator, phzR, was achieved by introducing pMP7447 into PCL1391. This plasmid contains phzR under constitutive expression of Ptac. Introduction of pMP7447 into the wild-type strain PCL1391 resulted in PCL1993. FA did not reduce PCN production in PCL1993 whereas it did in strain PCL1960, which contains the empty cloning vector (Fig. 4Up). PCL1993 produced increased amounts of C6-HSL compared to PCL1391 and FA did not detectably reduce these high levels of C6-HSL (Fig. 3Up). PCL1960 increased PCN production compared to the wild-type strain PCL1391 for unknown reasons but served as the correct control for the phzI and phzR overexpressing strains as it contains the empty vector.

Effect of FA on the expression of the PCN biosynthetic and regulatory genes
Microarray analysis allowed the identification of changes in gene transcription of the phz operon and the regulatory PCN genes phzI, phzR, gacS, rpoS and psrA after the addition of FA. RNA was isolated from a PCL1391 culture at OD620 2·0, at which density the start of PCN production is detected in the medium, and was used for cDNA synthesis and fluorescent labelling. The labelled cDNA was hybridized with PCL1391 microarrays. Expression profiling showed that the expression of PCN biosynthetic genes and the quorum-sensing regulatory genes phzI and phzR was severely reduced in the presence of 1 mM FA (Table 4Down). The highest reduction (sixfold) was observed for the PCN biosynthetic genes phzB, phzC and phzH. The expression of phzI was reduced fourfold and the expression of the transcription factor phzR was reduced twofold (Table 4Down). Expression of the PCN regulators rpoS, gacS and psrA was not affected by FA (Table 4Down). Transcription of the PCN regulators psrA and gacS, and the biosynthetic gene phzB, was followed during growth with the use of Tn5luxAB reporter mutants (Fig. 5Down). Transcription of psrA in PCL1111 (psrA : : Tn5luxAB) and transcription of gacS in PCL1969 (gacS : : Tn5luxAB) were not influenced by FA. Transcription of the biosynthetic operon (phzB : : Tn5luxAB) in PCL1119 increased with increasing optical density whereas it did not increase in the presence of FA (Fig. 5Down).


View this table:
[in this window]
[in a new window]
 
Table 4. Identified genes of P. chlororaphis PCL1391 with altered expression caused by the presence of FA

 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Expression of psrA (PCL1111, right y-axis), gacS (PCL1969, left y-axis) and phzB (PCL1119, left y-axis) in P. chlororaphis PCL1391. Cells were grown in MVB1 in the absence (black symbols) and in the presence (white symbols) of FA. Luminescence values were measured in counts per second (c.p.s.) per optical density unit during growth. Means±SD of two samples are shown.

 
Effects of FA on the transcriptome of P. chlororaphis PCL1391
Microarrays containing genomic fragments of PCL1391 were used to reveal the effect of FA on its transcriptome. Expression of 17 % (2115 clones) of the 12 000 clones spotted was detected. Clones with twofold difference in expression after the addition of FA were selected, resulting in 98 clones (4·6 %) that were upregulated and 112 clones (5·3 %) that were downregulated. The raw microarray data are available as supplementary data with the online version of this paper. A total of 32 clones with altered expression ratios was sequenced; ORFs were identified and analysed using BLAST (Altschul et al., 1990Down). Genes with the highest similarity to the sequenced clones, gene accession numbers and corresponding organisms are shown in Table 4Up. Column 3 includes the most similar gene and annotation in P. aeruginosa after the name of the gene with highest similarity in order to compare our results with microarray studies of P. aeruginosa. Clones that were up- or downregulated by FA can be divided into seven main classes. Class one has the highest similarity to a putative outer-membrane ferripyoverdin receptor from Pseudomonas putida KT2440 and is also similar to the main ferripyoverdin receptor fpvA of P. aeruginosa. Clone 60_D12 was also included in this subgroup as it is highly homologous to the second outer-membrane ferripyoverdin receptor fpvB in P. aeruginosa (Ghysels et al., 2004Down). The second class contains genes that show homology to non-ribosomal peptide synthetase (NRPS) and pyoverdin synthetase genes. Clones 21_C4 and 127_A3 belong to the same ORF, which has the highest similarity to an NRPS of Azotobacter vinelandii and to a lesser extent with the NRPS for pyoverdin biosynthesis pvdD from P. aeruginosa. Clones 3_C9, 68_C11, 89_H9, 116_G10 and 118_C10 have the highest similarity to an NRPS of P. fluorescens and lower similarity to the NRPS for pyoverdin pvdI from P. aeruginosa. Clone 65_C5 is similar to an L-ornithine N5-hydroxylase gene which is involved in the modification of the peptide chain of pyoverdin. The outer-membrane ferripyoverdin receptor and the pyoverdin synthetases are upregulated by FA and involved in production or uptake of pyoverdin in P. aeruginosa (Ravel & Cornelis, 2003Down). Class three contains ORFs with similarity to cytochrome c genes, which are all downregulated by FA. Class four consists of two clones which have similarity to fumarase genes. The two clones with similarity to valyl- and alanyl-tRNA synthetase were grouped in class five. Upregulated clones that occurred once were gathered in class six, which contains ORFs with similarity to two hypothetical proteins on clone 75_B12 and a polyferredoxin on clone 77_C5. Class seven contains the remaining downregulated clones. Genes on these clones are similar to a cation ABC transporter, a periplasmic cation-binding protein, an oxygen-independent coproporphyrinogen III dehydrogenase, a putative membrane protein, a methyl-accepting chemotaxis protein, and three hypothetical proteins, respectively (Table 4Up).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the rhizophere, biocontrol strains are constantly interacting with their environment, which includes other microbes. In this study we focused on the effect of the fungal toxin fusaric acid (FA) on P. chlororaphis PCL1391. One of our questions was whether FA could repress PCN biosynthesis under environmental conditions that favour PCN production. Under all three PCN-stimulating conditions studied, 1 mM phenylalanine, 2 mM FeCl3 and low Mg2+, FA reduced PCN levels. The PCN production in the presence of FA was not elevated by an additional 2 mM FeCl3 or a low Mg2+ concentration. Combining both phenylalanine and FA resulted in intermediate PCN levels compared to only FA or phenylalanine (Table 2Up). This shows that FA represses PCN production under different environmental conditions and can be influenced by some environmental changes. Transcriptional analyses of phzI and phzR under these different environmental conditions demonstrated that FA repressed their transcription in all conditions (Fig. 2Up) and confirmed that phzI and phzR expression is necessary for optimal PCN production. Repression of phzI and phzR by FA was highest in MVB1 with a low Mg2+ concentration or additional iron. These two conditions also resulted in the largest repression of PCN production by FA (Table 2Up).

When the C6-HSL concentration was increased by constitutive expression of phzI (strain PCL1999), PCN levels were no longer reduced by the addition of FA (Figs 3 and 4UpUp). Constitutive expression of phzR also led to an increased production of HSLs (Fig. 3Up). Increasing concentrations of the transcriptional regulator PhzR stimulate expression of phzI and therefore increase C6-HSL production. Transcription studies with Tn5luxAB reporter mutants and microarray analyses showed that the expression levels of the phenazine biosynthesis operon and of the quorum-sensing regulators phzI and phzR are reduced by FA (Table 4Up, Figs 1 and 5UpUp). This reduction in gene expression explains the reduced levels of PCN in the presence of FA and suggests that repression of PCN production occurs upstream of the biosynthetic phz operon and of phzI. FA could directly or indirectly repress phzR expression and thereby reduce the expression of phzI and biosynthesis of C6-HSL. Expression of the PCN regulators gacS, rpoS and psrA was not altered by FA (Table 4Up, Fig. 5Up), which suggests that FA acts in parallel to or downstream of these genes.

The microarray allowed identification of genes differentially expressed by FA. Because the genome of PCL1391 has not been sequenced, a microarray containing only random fragments of genomic DNA and control genes was available (see Methods). Sequencing revealed that the same genes were present in different selected clones spotted several times on the microarray, thereby internally validating the analyses (Table 4Up).

Comparison of our data with those of the literature suggests a correlation between treatments with FA and iron limitation. Genes upregulated by FA in P. chlororaphis were induced by iron limitation in P. aeruginosa. Clones of class one are homologous to outer-membrane ferripyoverdin receptors fpvA (PA2398) and fpvB (PA4168) (Ghysels et al., 2004Down) of P. aeruginosa and are upregulated by iron limitation (Ochsner et al., 2002Down; Palma et al., 2003Down). These outer-membrane ferripyoverdin receptors have similarity with the TonB system that was shown to be involved in tolerance to solvents and drugs and thought to play a role in drug exclusion (Godoy et al., 2001Down). This could explain the upregulation of the clones in this class in response to FA. The pyoverdin synthetase genes found to be upregulated by FA are homologous to the non-ribosomal peptide synthetases pvdI (PA2402) pvdJ (PA2400) and pvdD (PA2399) and the pyoverdin modification gene pvdA (PA2386) (Ochsner et al., 2002Down; Palma et al., 2003Down). All of these genes are induced by iron limitation in P. aeruginosa. Upregulation of these genes involved in the biosynthesis and uptake of pyoverdin can be explained in relation to iron starvation but is less obvious in relation to FA stress. Iron limitation increased fumC1 (PA4470) and decreased hemN (PA1546) expression in P. aeruginosa (Ochsner et al., 2002Down; Palma et al., 2003Down) and FA treatment also increased fumarase (fumC1) and decreased oxygen-independent coproporphyrinogen III dehydrogenase (hemN) expression in P. chlororaphis. Remarkably, clone 14_C10 is repressed by FA but has similarity with PA2406 and PA2407, which are also part of the pyoverdin cluster of P. aeruginosa and are upregulated by iron limitation (Ochsner et al., 2002Down). This is the only sequenced clone that is regulated oppositely when comparing the expression profile of FA stress and iron limitation. Interestingly, FA does not seem to stimulate the transcription of all the genes induced by iron limitation, but appears to stimulate the pyoverdin system more specifically.

Although FA induces many genes involved in the uptake of iron, an increased production of siderophores was detected only during iron limitation and not during FA stress of P. chlororaphis PCL1391 (data not shown). This suggests that FA stress does not result in a complete iron starvation response. FA has ferric ion chelating characteristics (Bochner et al., 1980Down) which could explain the repression of PCN by FA since iron limitation represses PCN production. However, an excess of ferric ions (2 mM FeCl3) did not restore PCN production. A second experiment also contradicts this hypothesis, since the high-affinity iron chelator EDDHA (0·1 and 1·0 mM) did not mimic FA stress and did not repress PCN biosynthesis (Table 2Up). FA also chelates other divalent cations including zinc and this could cause PCN repression by FA. However, an excess of 2mM ZnSO4 or ZnCl2 does not restore PCN production in the presence of FA (Table 3Up), refuting this possibility.

FA and iron limitation reduce PCN production in P. chlororaphis PCL1391 (van Rij et al., 2004Down) and have partially overlapping expression profiles, but FA is not causing or mimicking iron limitation. This suggests that the two stress conditions FA and iron limitation trigger partially overlapping regulatory cascades that result in the repression of PCN biosynthesis.


    ACKNOWLEDGEMENTS
 
This work was supported by grant 811.35.003 from the Dutch Earth and Life Science Council NOW and the European Union BIOTECH FW5 project QLRT-2001-00914.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol 215, 403–410.[CrossRef][Medline]

Bacon, C. W., Porter, J. K., Norred, W. P. & Leslie, J. F. (1996). Production of fusaric acid by Fusarium species. Appl Environ Microbiol 62, 4039–4043.[Abstract/Free Full Text]

Bochner, B. R., Huang, H. C., Schieven, G. L. & Ames, B. N. (1980). Positive selection for loss of tetracycline resistance. J Bacteriol 143, 926–933.[Abstract/Free Full Text]

Bolwerk, A., Lagopodi, A. L., Wijfjes, A. H., Lamers, G. E., Chin, A. W. T., Lugtenberg, B. J. J. & Bloemberg, G. V. (2003). Interactions in the tomato rhizosphere of two Pseudomonas biocontrol strains with the phytopathogenic fungus Fusarium oxysporum f. sp. radicis-lycopersici. Mol Plant Microbe Interact 16, 983–993.[Medline]

Boyer, H. W. & Roulland-Dussoix, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41, 459–472.[CrossRef][Medline]

Brazma, A., Hingamp, P., Quackenbush, J. & 21 other authors (2001). Minimum information about a microarray experiment (MIAME) – toward standards for microarray data. Nat Genet 29, 365–371.[CrossRef][Medline]

Chin-A-Woeng, T. F. C., Bloemberg, G. V., van der Bij, A. J. & 10 other authors (1998). Biocontrol by phenazine-1-carboxamide-producing Pseudomonas chlororaphis PCL1391 of tomato root rot caused by Fusarium oxysporum f. sp. radicis-lycopersici. Mol Plant Microbe Interact 11, 1069–1077.[CrossRef]

Chin-A-Woeng, T. F. C., Bloemberg, G. V., Mulders, I. H. M., Dekkers, L. C. & Lugtenberg, B. J. J. (2000). Root colonization by phenazine-1-carboxamide-producing bacterium Pseudomonas chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot. Mol Plant Microbe Interact 13, 1340–1345.[Medline]

Chin-A-Woeng, T. F. C., Thomas-Oates, J. E., Lugtenberg, B. J. J. & Bloemberg, G. V. (2001a). Introduction of the phzH gene of Pseudomonas chlororaphis PCL1391 extends the range of biocontrol ability of phenazine-1-carboxylic acid-producing Pseudomonas spp. strains. Mol Plant Microbe Interact 14, 1006–1015.[Medline]

Chin-A-Woeng, T. F. C., van den Broek, D., de Voer, G., van der Drift, K. M. G. M., Tuinman, S., Thomas-Oates, J. E., Lugtenberg, B. J. J. & Bloemberg, G. V. (2001b). Phenazine-1-carboxamide production in the biocontrol strain Pseudomonas chlororaphis PCL1391 is regulated by multiple factors secreted into the growth medium. Mol Plant Microbe Interact 14, 969–979.[Medline]

Chin-A-Woeng, T. F. C., van den Broek, D., Lugtenberg, B. J. J. & Bloemberg, G. V. (2005). The Pseudomonas chlororaphis PCL1391 sigma regulator psrA represses the production of the antifungal metabolite phenazine-1-carboxamide. Mol Plant Microbe Interact 18, 244–253.[Medline]

Denhardt, D. T. (1966). A membrane-filter technique for the detection of complementary DNA. Biochem Biophys Res Commun 23, 641–646.[CrossRef][Medline]

Ditta, G., Stanfield, S., Corbin, D. & Helinski, D. R. (1980). Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci U S A 77, 7347–7351.[Abstract/Free Full Text]

Duffy, B. K. & Défago, G. (1997). Zinc improves biocontrol of fusarium crown and root rot of tomato by Pseudomonas fluorescens and represses the production of pathogen metabolites inhibitory to bacterial antibiotic biosynthesis. Phytopathology 87, 1250–1257.[CrossRef][Medline]

Ghysels, B., Dieu, B. T., Beatson, S. A., Pirnay, J. P., Ochsner, U. A., Vasil, M. L. & Cornelis, P. (2004). FpvB, an alternative type I ferripyoverdine receptor of Pseudomonas aeruginosa. Microbiology 150, 1671–1680.[Abstract/Free Full Text]

Godoy, P., Ramos-Gonzalez, M. I. & Ramos, J. L. (2001). Involvement of the TonB system in tolerance to solvents and drugs in Pseudomonas putida DOT-T1E. J Bacteriol 183, 5285–5292.[Abstract/Free Full Text]

Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M., II & Peterson, K. M. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175–176.[CrossRef][Medline]

McClean, K. H., Winson, M. K., Fish, L. & 9 other authors (1997). Quorum sensing and Chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143, 3703–3711.[Abstract/Free Full Text]

Notz, R., Maurhofer, M., Dubach, H., Haas, D. & Défago, G. (2002). Fusaric acid-producing strains of Fusarium oxysporum alter 2,4-diacetylphloroglucinol biosynthetic gene expression in Pseudomonas fluorescens CHA0 in vitro and in the rhizosphere of wheat. Appl Environ Microbiol 68, 2229–2235.[Abstract/Free Full Text]

Ochsner, U. A., Wilderman, P. J., Vasil, A. I. & Vasil, M. L. (2002). GeneChip expression analysis of the iron starvation response in Pseudomonas aeruginosa: identification of novel pyoverdine biosynthesis genes. Mol Microbiol 45, 1277–1287.[CrossRef][Medline]

Palma, M., Worgall, S. & Quadri, L. E. (2003). Transcriptome analysis of the Pseudomonas aeruginosa response to iron. Arch Microbiol 180, 374–379.[CrossRef][Medline]

Pohl, E., Haller, J. C., Mijovilovich, A., Meyer-Klaucke, W., Garman, E. & Vasil, M. L. (2003). Architecture of a protein central to iron homeostasis: crystal structure and spectroscopic analysis of the ferric uptake regulator. Mol Microbiol 47, 903–915.[CrossRef][Medline]

Ravel, J. & Cornelis, P. (2003). Genomics of pyoverdine-mediated iron uptake in pseudomonads. Trends Microbiol 11, 195–200.[Medline]

Sambrook, J. & Russell, D. (2001). Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schouten, A., van den Berg, G., Edel-Hermann, V., Steinberg, C., Gautheron, N., Alabouvette, C., de Vos, C. H. & Raaijmakers, J. M. (2004). Defense responses of Fusarium oxysporum to 2,4-diacetylphloroglucinol, a broad-spectrum antibiotic produced by Pseudomonas fluorescens. Mol Plant Microbe Interact 17, 1201–1211.[Medline]

van Rij, E. T., Wesselink, M., Chin-A.-Woeng, T. F. C., Bloemberg, G. V. & Lugtenberg, B. J. J. (2004). Influence of environmental conditions on the production of phenazine-1-carboxamide by Pseudomonas chlororaphis PCL1391. Mol Plant Microbe Interact 17, 557–566.[Medline]

Vogel, H. J. & Bonner, D. M. (1956). Acetylornithinase of Escherichia coli: partial purification and some properties. J Biol Chem 218, 97–106.[Free Full Text]

Wang, H. & Ng, T. B. (1999). Pharmacological activities of fusaric acid (5-butylpicolinic acid). Life Sci 65, 849–856.[CrossRef][Medline]

Received 23 March 2005; revised 27 May 2005; accepted 6 June 2005.


This article has been cited by other articles:


Home page
Phil Trans R Soc BHome page
M. Sanchez-Contreras, W. D Bauer, M. Gao, J. B Robinson, and J Allan Downie
Quorum-sensing regulation in rhizobia and its role in symbiotic interactions with legumes
Phil Trans R Soc B, July 29, 2007; 362(1483): 1149 - 1163.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
G. Girard, E. T. van Rij, B. J. J. Lugtenberg, and G. V. Bloemberg
Regulatory roles of psrA and rpoS in phenazine-1-carboxamide synthesis by Pseudomonas chlororaphis PCL1391
Microbiology, January 1, 2006; 152(1): 43 - 58.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Rij, E. T.
Right arrow Articles by Bloemberg, G. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Rij, E. T.
Right arrow Articles by Bloemberg, G. V.
Agricola
Right arrow Articles by van Rij, E. T.
Right arrow Articles by Bloemberg, G. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2005 Society for General Microbiology.