| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Gut Health Division, Rowett Research Institute, Greenburn Road, Bucksburn, Aberdeen AB21 9SB, UK
2 Scientific Support Division, Rowett Research Institute, Greenburn Road, Bucksburn, Aberdeen AB21 9SB, UK
Correspondence
Petra Louis
p.louis{at}rowett.ac.uk
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are: Roseburia sp. A2-183 CoA-transferase, AY796317; Eu. hallii L2-7 CoA-transferase, DQ072258; F. prausnitzii A2-165 CoA-transferase, DQ072259; A. caccae L1-92 CoA-transferase I, DQ151450; A. caccae L1-92 4-hydroxybutyrate dehydrogenase and CoA-transferase II, DQ151451.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
). The fermentation acid butyrate is of special interest, as it has been shown to serve as the preferred energy source for the gut wall and also influences cell differentiation and apoptosis in the colon, and this seems to aid in protection against colon cancer and inflammatory bowel disease (Pryde et al., 2002; Wächtershäuser & Stein, 2000). A number of butyrate-producing bacteria belonging to the low-G+C-content Gram-positives have been isolated from the human colon (Barcenilla et al., 2000; Louis et al., 2004). Recent advances in molecular techniques have revealed that they are among the predominant bacterial groups within the human large intestine (Blaut et al., 2002).
The biosynthetic pathway for butyrate formation, including the respective genes, has been described for clostridia that are mainly found outside the gut environment, such as the solventogenic bacterium Clostridium acetobutylicum. Here, a central pathway leads from acetyl-CoA to butyryl-CoA (Bennett & Rudolph, 1995; Boynton et al., 1996), and a CoA-transferase that acts on acetoacetyl-CoA with either acetate or butyrate as second substrate is involved in the switch from acetogenic to solventogenic fermentation (Wiesenborn et al., 1989). Butyryl-CoA is converted to butyrate in a two-step reaction with the intermediate formation of butyryl-phosphate (Walter et al., 1993). Until recently, it was generally believed that these two enzymes were also responsible for butyrate formation in gut bacteria (Macfarlane & Gibson, 1997; Miller & Wolin, 1979). However, studies on isolates from the rumen and the human large intestine have indicated that, instead, a CoA-transferase is utilized by some of these bacteria for the formation of butyrate (Diez-Gonzalez et al., 1999; Asanuma et al., 2003; Duncan et al., 2002). We have shown recently that this reaction is the only available route for butyrate synthesis in the majority of human gut isolates (Louis et al., 2004). However, the characteristics of this enzyme have never been reported, and the corresponding gene remains elusive to date.
Several CoA-transferases have been characterized in a range of bacteria (Barker et al., 1978; Buckel et al., 1981; Scherf & Buckel, 1991; Schweiger & Buckel, 1984; Sramek & Frerman, 1975; Tung & Wood, 1975; Wiesenborn et al., 1989). These enzymes tend to have a relatively broad substrate specificity, and butyrate and acetate, or their respective CoA-esters, are often among the substrates utilized in vitro. The corresponding genes for some of the enzymes have been identified (Fischer et al., 1993; Gerhardt et al., 2000; Selmer et al., 2002). A comparison of the gene sequences as well as the subunit structure of CoA-transferases shows a surprising diversity, despite the shared reaction mechanism of these enzymes and their overlapping substrate specificities. Here, we describe the identification of a butyryl-CoA CoA-transferase gene from the human colon bacterium Roseburia sp. A2-183 (Barcenilla et al., 2000) and the biochemical characterization of the corresponding enzyme.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Accession numbers of the National Collection of Industrial and Marine Bacteria (NCIMB) are as follows: Roseburia sp. A2-183, NCIMB 14029; R. intestinalis L1-82, NCIMB 13810; Roseburia sp. A2-194, NCIMB 14030; Roseburia sp. M72/1, NCIMB 14031; Anaerostipes caccae L1-92, NCIMB 13811. C. acetobutylicum DSM 792 and Clostridium propionicum DSM 1682 were obtained from the German Collection of Micro-organisms and Cell Cultures (DSMZ). Escherichia coli XL-1 Blue MRF was purchased from Stratagene. To study growth on alternative carbon sources, YCFA medium (Duncan et al., 2002) containing either 10 g 
-aminobutyrate l–1 or 100 mM succinate and 300 mM ethanol as sole carbon source was inoculated with cultures grown in YCFA medium containing 2 g l–1 glucose, cellobiose and soluble starch, and the optical density was followed on a Novaspec II photometer (Pharmacia Biotech) at 650 nm. Growth experiments were performed in triplicate. E. coli XL-1 Blue MRF was grown on LB agar plates (10 g tryptone l–1, 5 g yeast extract l–1, 5 g NaCl l–1, 15 g agar l–1), containing 100 µg ampicillin ml–1, after transformation of recombinant plasmids.
DNA cloning, sequencing and sequence analysis.
A random genomic library of Roseburia sp. A2-183 was generated with a pSMART-LCAmp blunt cloning kit (Lucigen). Inserts were amplified with SL1up (TGAAGGTGAGCCAGTGAGTTG) and SR2down (CTTTCTGCTATGGAGGTCAGG) primers and sequencing was performed with nested primers SL1mod (TTACGCTGGAGTCTGAGGCT) and SR2 (GGTCAGGTATGATTTAAATGGTCA) on a Beckman capillary sequencer. Sequences were assembled using the Phred, Phrap and Consed programs (Ewing & Green, 1998; Ewing et al., 1998; Gordon, 2004) and putative genes were identified by BLAST search against database entries in GenBank (Altschul et al., 1990). Sequence alignments were performed using CLUSTALW through the BCM Search launcher (Smith et al., 1996). Phylogenetic analysis was performed using the UK Human Genome Mapping Project Computing Services at www.hgmp.mrc.ac.uk (this service is no longer available online). Amino acid sequences were aligned with CLUSTALW through the interface MAGI, and a phylogenetic tree was constructed with PROTDIST through the interface PIE (distance matrix program neighbour, distance model Kimura, 100 times bootstrap resampling).
CoA-transferase genes were cloned according to standard protocols (Ausubel et al., 1994) into restriction sites NcoI and SmaI of vector pIVEX2.3d (Roche) after amplification from bacterial cells. Primers and restriction sites (underlined) used were: pIVEXCoATF (GACTGACCATGGATTTTCGTGAAGAATAC, NcoI) and pIVEXCoATR3 (GACTGACCCGGGGCGGTTGCTTCTTCTCCAG, SmaI) for Roseburia sp. A2-183; L192CoATIoeF (GATTACACATGTCATTTAAGGAAGAATACC, BspLU11I) and L192CoATIoe3R (ATCGATCCCGGGTTTGTTGGATCTTCTCCAGATTTG, SmaI) for A. caccae CoA-transferase I; L192CoATIIoeF (GAGATATCATGAGAGATAAGAAGGACAAGC, RcaI) and L192CoATIIoe3aR (ATCGATAGTACTTTCGTCATCACTCCAGGCTTC, ScaI) for A. caccae CoA-transferase II. The sequence of the recombinant genes was confirmed by sequencing the inserts on a Beckman capillary sequencer with T7 vector primers and internal primers.
Degenerate PCR and genome walking.
The following protein sequences related to CoA-transferase sequences were selected for alignments to determine conserved regions suitable for degenerate primer design. Roseburia sp. A2-183 CoA-transferase (AY796317): Desulfitobacterium hafniense (ZP_00098805, ZP_00099788), Clostridium kluyveri (P38942), Clostridium tetani (NP_781174), Archaeoglobus fulgidus (NP_069974) and Yersinia pestis (NP_405485). C. acetobutylicum CtfB (P23673): Clostridium beijerinckii (AF157306_3), Streptococcus pyogenes (NP_268527, NP_269686), Streptomyces coelicolor (T35020), Streptomyces sp. (T47110), E. coli (NP_416726) and Haemophilus influenzae (NP_438932). C. propionicum propionate CoA-transferase (CAB77207): Clostridium perfringens (NP_561012), C. tetani (NP_781170, NP_781374), Bradyrhizobium japonicum (NP_767528), Listeria innocua (NP_471607) and Fusobacterium nucleatum (NP_603711). Degenerate primers were designed by visual inspection and contained a non-degenerate clamp region at the 5' end, based on the sequence from Roseburia sp. A2-183 [AY796317, primers CoATDF1 (AAGGATCTCGGIRTICAYWSIGARATG) and CoATDR2 (GAGGTCGTCICKRAAITYIGGRTGNGC)], C. acetobutylicum [P23673, primers CTFBfor1 (GTAAACTTIGGIRTIGGIYTNCCNAC) and CTFBrev4 (AACAGTAACATCIAYRTGICCNCCNC)] or C. perfringens [NP_561012, primers PCTfor1 (GTAGGATTARRIACITWYRTIGAYCC) and PCTrev2 (TCCACCACCATCRTARSARTCRAAYTG)]. Amplification with whole bacterial cells, as described previously (Louis et al., 2004), was performed with a ramped annealing approach (Skantar & Carta, 2000). The following conditions were used: initial denaturation (2 min at 94 °C), then 35 cycles of denaturation (30 s at 94 °C), annealing (20 s at 55 °C, 5 s at 50 °C, 5 s at 45 °C, 5 s at 40 °C), elongation (1 min at 72 °C), and a final extension (10 min at 72 °C). Degenerate PCR products were cloned into pGEM-T Easy (Promega) and sequenced as described previously (Louis et al., 2004).
Genome walking to obtain full-length ORFs from degenerate PCR products was performed by inverse PCR (Ochman et al., 1988). Briefly, genomic DNA was digested with various restriction enzymes and religated. The ligation mixes were amplified with primers reading outward from known sequences to obtain genomic regions flanking the CoA-transferase gene, and the full-length genes were amplified and sequenced in both directions.
Protein overexpression and purification.
Recombinant proteins were overexpressed with an RTS-500 kit (Roche) according to the manufacturer's instructions. Overexpressed proteins were dialysed in a Slide-A-Lyser cassette (Pierce) with a 10 kDa cut-off membrane against 500 ml of 200 mM potassium phosphate buffer (pH 7·2) for 2 h, and then overnight. The enzymes were purified with a Ni-NTA Spin kit (Qiagen) and eluted with 50 mM sodium phosphate (pH 8·0) containing 300 mM NaCl, 250 mM imidazole and 100 mM EDTA.
The endogenous CoA-transferase from Roseburia A2-183 was partially purified from cells grown at 37 °C under anaerobic conditions on the synthetic medium YCFAGSC (Duncan et al., 2002). Bacterial cells were collected by centrifugation (6000 g, 15 min, 4 °C), and cell pellets were resuspended in potassium phosphate buffer (50 mM, pH 7) and disrupted by sonication (MSE Soniprep, setting 150 for 5 min). The cell lysate was passed over a weak anion exchange column (DEAE Sepharose Fast Flow, Amersham BioSciences) that was equilibrated with phosphate buffer at a flow rate of 0·5 ml min–1. Elution of proteins with a linear gradient of ammonium sulphate (0–120 mM) in phosphate buffer was monitored with a UV spectrophotometer (LKB Bromma 2238 uvicord II). Fractions containing enzyme activity as determined below were pooled.
CoA-transferase assays.
CoA-transferase activity was determined using the citrate synthase assay (Scherf & Buckel, 1991) at 410 nm wavelength, 25 °C and pH 7, and adapted for microtitre plates, with butyryl-CoA (100 µM) and acetate (50 mM) as substrates, unless stated otherwise. For the determination of the pH optimum of the enzyme, the potassium phosphate buffer was replaced by 100 mM Bis-Tris propane. Protein concentrations were determined with a bicinchoninic acid kit (Pierce). All data are the mean and standard deviation of at least three replicates.
Proteomic techniques.
One-dimensional gel electrophoresis was performed according to standard techniques (Ausubel et al., 1994). Two-dimensional gel electrophoresis and trypsinization of excised spots was performed as described previously (Rincon et al., 2004), using a Bio-Rad Ready Strip IPG pH gradient 4–7 for the first dimension. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF) was performed with an Applied Biosystems Voyager DE PRO MALDI-TOF in reflectance mode calibrated with a peptide standard from LaserBio Labs. Theoretical peptide fingerprint profiles were determined using the Peptide Mass tool on the ExPASy server (Wilkins et al., 1997), and database searches (confidence value >60) were performed with Mascot (Perkins et al., 1999) (tolerance limit 0·2 Da). Separation of peptides was achieved on a nano LC system (LC Packings) with a C18 PepMap 100 nanocolumn using a water/acetonitrile gradient (5–50 % acetonitrile over 30 min) at a 0·3 µl min–1 flow rate. Mass spectrometry was performed using a Q-Trap (Applied Biosystems/MDS Sciex) triple quadrupole mass spectrometer fitted with a nanospray ion source, where Q3 was operated as a linear ion trap.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
In parallel, an endogenous CoA-transferase that is able to use butyryl-CoA and acetate was partially purified from Roseburia sp. A2-183. A 13-fold purification was obtained by passing a crude cell extract over a DEAE Sepharose anion exchange column. The enzyme activity eluted in a single peak. The partially purified enzyme preparation was subjected to two-dimensional gel electrophoresis, and all major spots (24) were analysed by mass spectrometry after tryptic digest (not shown). Analysis of peptide fingerprints revealed no matches to sequences in Mascot, which was not unexpected, as the genome of this strain and its close relatives has not been published. However, a comparison of the peptide fingerprints to the theoretical fingerprint for the recombinant putative CoA-transferase sequence identified in this strain revealed five spots of a mass of approximately 50 kDa and pI values of between approximately 5·5 (spot 1) and 5·9 (spot 5) with matching peptide masses (Fig. 1). To confirm these results, electrospray ionization mass spectrometry was employed to obtain amino acid sequence information. The complete sequence of one peptide and partial sequence of two other peptides could be confirmed for all five spots. For the stronger spots, 2–4, between 12 and 22 % of the total amino acid sequence could be identified with this approach (Fig. 1). These results provide strong evidence that the partially purified endogenous enzyme corresponds to the cloned and overexpressed putative CoA-transferase gene product from Roseburia sp. A2-183.
|
). Despite a comparable level of inhibition observed for butyrate and propionate, a comparison of the respective CoA-ester substrates revealed a higher enzyme activity with butyryl-CoA for both enzyme preparations. The observed enzyme activities in the presence of propionyl-CoA compared to butyryl-CoA were 73·4±1·6 % (P<0·001) and 60·8±7·6 % (P<0·01) for the endogenous partially purified CoA-transferase and the recombinant purified enzyme, respectively. None of the other CoA-ester substrates tested, caproyl-, crotonyl- and acetoacetyl-CoA, served as substrates for either enzyme preparation (enzyme activities <2 % of values with butyryl-CoA).
|
). The pattern observed at high substrate concentrations of acetate is indicative of competitive substrate inhibition of a ping-pong mechanism (Cleland, 1970). Km values for butyryl-CoA and acetate, as determined from replots of the intercepts versus the reciprocal of the concentration of the fixed substrate, were 0·098 and 6·4 mM, respectively. Vmax values determined from these plots were both 112 µmol min–1 (mg protein)–1. Km and Vmax values for propionyl-CoA (determined at 25, 50, 100, 150 and 200 µM propionyl-CoA in the presence of 50 mM acetate) were 0·099 mM and 51 µmol min–1 (mg protein)–1, respectively. Therefore the enzyme displays a similar affinity for both CoA-ester substrates, but displays a higher velocity with butyryl-CoA than with propionyl-CoA.
|
).
|
-aminobutyrate by Clostridium aminobutyricum (Gerhardt et al., 2000; Scherf & Buckel, 1991; Söhling & Gottschalk, 1996). We examined growth of Roseburia sp. A2-183, Eu. hallii L2-7, A. caccae L1-92 and F. prausnitzii A2-165 in the presence of these substrates. The increase in OD650 was below 0·1 for all strains and growth substrates tested, with the exception of A. caccae L1-92 on -aminobutyrate, which showed an increase of 0·169±0·002 OD650 units over 46 h. The next gene immediately upstream of the CoA-transferase II in A. caccae L1-92 exhibited 50 % identity to the 4-hydroxybutyrate dehydrogenase of C. kluyveri (4HBD_CLOKL), which catalyses the reaction directly upstream of the CoA-transferase in both C. aminobutyricum and C. kluyveri. Both CoA-transferase genes from A. caccae L1-92 were cloned and overexpressed and their substrate specificity was examined. The CoA-transferase I showed very similar substrate specificities to those of the enzyme from Roseburia sp. A2-183 (not shown). The second enzyme, however, displayed only very low enzyme activity [less than 1 µmol min–1 mg–1 (not shown)], so that the substrate specificity could not be determined.
Screening for other CoA-transferase genes by degenerate PCR
Two other types of CoA-transferase from clostridia that have been described elsewhere might also be able to convert butyryl-CoA and acetate to butyrate and acetyl-CoA. An enzyme from C. acetobutylicum utilizes acetoacetyl-CoA together with either acetate or butyrate as acid substrate (Wiesenborn et al., 1989), while a propionate CoA-transferase from C. propionicum shows strong inhibition by butyrate as second acid substrate in vitro (Schweiger & Buckel, 1984). Two pairs of degenerate PCR primers were designed here against conserved regions within the coding regions of these two CoA-transferases. The primer pairs designed to recognize the C. propionicum and C. acetobutylicum CoA-transferase genes gave products of the expected size with C. propionicum DSM 1682 and C. acetobutylicum DSM 792, respectively. Weaker bands of the expected size were also obtained with E. coli XL-1 Blue MRF, which possesses homologues of both genes. Neither pair, however, gave a product of the correct size with Roseburia sp. A2-183 (not shown), and there was no indication therefore that homologues of these two CoA-transferase genes are present in this bacterium.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
), based on its ping-pong reaction mechanism as well as its sequence relationship with other CoA-transferases. The deduced protein sequence showed the highest similarity to a presumptive acetyl-CoA hydrolase sequence from D. hafniense. Acetyl-CoA hydrolases and CoA-transferases are related at the sequence level, and a single amino acid substitution has been shown to convert a CoA-transferase to a CoA-hydrolase (Mack & Buckel, 1997). 4-Hydroxybutyrate CoA-transferases also exhibited sequence similarity with the new sequence. However, the enzyme from Roseburia sp. A2-183 showed marked differences to the 4-hydroxybutyrate CoA-transferase from C. aminobutyricum, which has been examined enzymologically (Scherf & Buckel, 1991). A broad pH optimum close to neutral pH was found for the enzyme from Roseburia sp. A2-183, in accordance with that reported for other CoA-transferases (Barker et al., 1978; Tung & Wood, 1975; Wiesenborn et al., 1989). The 4-hydroxybutyrate CoA-transferase from C. aminobutyricum, on the other hand, exhibits a pH optimum at around 9·5, with only half the activity at pH 7 (Scherf & Buckel, 1991). Another characteristic that the novel CoA-transferase has in common with other CoA-transferases is its broad substrate specificity. The preferred substrates were butyrate and propionate; however, the enzyme showed no strong inhibition in the presence of 4-hydroxybutyrate, the preferred substrate of the 4-hydroxybutyrate CoA-transferase of C. aminobutyricum (Scherf & Buckel, 1991). These results strongly suggest that the enzyme identified from Roseburia sp. A2-183 represents a novel type of CoA-transferase distinct from the most closely related 4-hydroxybutyrate CoA-transferases. This is in accordance with a phylogenetic analysis of CoA-transferase sequences identified in other human gut bacteria. Sequences closely related to the Roseburia sp. A2-183 sequence formed a tight cluster, whereas a second sequence found in A. caccae L1-92 formed a distinct cluster with 4-hydroxybutyrate CoA-transferases. This second enzyme might indeed be involved in the conversion of 4-hydroxybutyrate, as A. caccae L1-92 shows some growth on one of the substrates of the corresponding fermentation pathway, -aminobutyrate (Gerhardt et al., 2000), and the adjacent gene upstream shows similarity to another enzyme of that pathway. Attempts to analyse the substrate specificity of this enzyme after overexpression in E. coli and purification failed due to the fact that only very low enzyme activity could be recovered. It has been reported elsewhere that the overexpression of the corresponding gene from C. kluyveri yields only low enzyme activity in E. coli (Valentin et al., 2000).
In conclusion, this work establishes for the first time the substrate specificity and primary sequence of a CoA-transferase from Roseburia sp. A2-183 that preferentially uses butyryl-CoA as substrate. The corresponding gene could be identified in several butyrate-producing human gut bacteria, while genes for other CoA-transferases that are known to utilize butyryl-CoA seemed to be absent, based on degenerate PCR experiments. This gene is therefore a strong candidate for the CoA-transferase involved in butyrate formation in human gut bacteria. The assignment of this enzyme as a butyryl-CoA CoA-transferase is supported by the fact that Roseburia sp. A2-183 produces high amounts of butyrate but no propionate in vitro (Barcenilla et al., 2000). The identification of this gene and its product will help in understanding the regulation of butyrate formation within the human gut.
|
ACKNOWLEDGEMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Asanuma, N., Kawato, M., Ohkawara, S. & Hino, T. (2003). Characterization and transcription of the genes encoding enzymes involved in butyrate production in Butyrivibrio fibrisolvens. Curr Microbiol 47, 203–207.[CrossRef][Medline]
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1994). Current Protocols in Molecular Biology. New York: Wiley.
Barcenilla, A., Pryde, S. E., Martin, J. C., Duncan, S. H., Stewart, C. S., Henderson, C. & Flint, H. J. (2000). Phylogenetic relationships of butyrate-producing bacteria from the human gut. Appl Environ Microbiol 66, 1654–1661.
Barker, H. A., Jeng, I.-M., Neff, N., Robertson, J. M., Tam, F. K. & Hosaka, S. (1978). Butyryl-CoA : acetoacetate CoA-transferase from a lysine-fermenting Clostridium. J Biol Chem 253, 1219–1225.
Bennett, G. N. & Rudolph, F. B. (1995). The central metabolic pathway from acetyl-CoA to butyryl-CoA in Clostridium acetobutylicum. FEMS Microbiol Rev 17, 241–249.[CrossRef]
Blaut, M., Collins, M. D., Welling, G. W., Doré, J., van Loo, J. & de Vos, W. (2002). Molecular biological methods for studying the gut microbiota: the EU human gut flora project. Br J Nutr 87, S203–S211.[Medline]
Boynton, Z. L., Bennett, G. N. & Rudolph, F. B. (1996). Cloning, sequencing, and expression of clustered genes encoding 
-hydroxybutyryl-coenzyme A (CoA) dehydrogenase, crotonase, and butyryl-CoA dehydrogenase from Clostridium acetobutylicum ATCC 824. J Bacteriol 178, 3015–3024.
Buckel, W., Dorn, U. & Semmler, R. (1981). Glutaconate CoA-transferase from Acidaminococcus fermentans. Eur J Biochem 118, 315–321.[Medline]
Cleland, W. W. (1970). Steady state kinetics. In The Enzymes, 3rd edn, Vol. 2, pp. 1–65. Edited by P. D. Boyer. New York: Academic Press.
Diez-Gonzalez, F., Bond, D. R., Jennings, E. & Russell, J. B. (1999). Alternative schemes of butyrate production in Butyrivibrio fibrisolvens and their relationship to acetate utilization, lactate production, and phylogeny. Arch Microbiol 171, 324–330.[CrossRef][Medline]
Duncan, S. H., Barcenilla, A., Stewart, C. S., Pryde, S. E. & Flint, H. J. (2002). Acetate utilization and butyryl coenzyme A (CoA):acetate-CoA transferase in butyrate-producing bacteria from the human large intestine. Appl Environ Microbiol 68, 5186–5190.
Ewing, B. & Green, P. (1998). Basecalling of automated sequencer traces using phred. II. Error probabilities. Genome Res 8, 186–194.
Ewing, B., Hillier, L., Wendl, M. & Green, P. (1998). Basecalling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res 8, 175–185.
Fischer, R. J., Helms, J. & Dürre, P. (1993). Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol 175, 6959–6969.
Gerhardt, A., Cinkaya, I., Linder, D., Huisman, G. & Buckel, W. (2000). Fermentation of 4-aminobutyrate by Clostridium aminobutyricum: cloning of two genes involved in the formation and dehydration of 4-hydroxybutyryl-CoA. Arch Microbiol 174, 189–199.[CrossRef][Medline]
Gordon, D. (2004). Viewing and editing assembled sequences using Consed. In Current Protocols in Bioinformatics, pp. 11.2.1–11.2.43. Edited by A. D. Baxevanis & D. B. Davison. New York: Wiley.
Heider, J. (2001). A new family of CoA-transferases. FEBS Lett 509, 345–349.[CrossRef][Medline]
Louis, P., Duncan, S. H., McCrae, S. I., Millar, J., Jackson, M. S. & Flint, H. J. (2004). Restricted distribution of the butyrate kinase pathway among butyrate-producing bacteria from the human colon. J Bacteriol 186, 2099–2106.
Macfarlane, G. T. & Gibson, G. R. (1997). Carbohydrate fermentation, energy transduction and gas metabolism in the human large intestine. In Gastrointestinal Microbiology, vol. 1, pp. 269–318. Edited by R. I. Mackie & B. A. White. London: Chapman and Hall.
Mack, M. & Buckel, W. (1997). Conversion of glutaconate CoA-transferase from Acidaminococcus fermentans into an acyl-CoA hydrolase by site-directed mutagenesis. FEBS Lett 405, 209–212.[CrossRef][Medline]
Miller, T. L. & Wolin, M. J. (1979). Fermentations by saccharolytic intestinal bacteria. Am J Clin Nutr 32, 164–172.
Ochman, H., Gerber, A. S. & Hartl, D. L. (1988). Genetic applications of an inverse polymerase chain reaction. Genetics 120, 621–623.
Perkins, D. N., Pappin, D. J., Creasy, D. M. & Cottrell, J. S. (1999). Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20, 3551–3567.[CrossRef][Medline]
Pryde, S. E., Duncan, S. H., Hold, G. L., Stewart, C. S. & Flint, H. J. (2002). The microbiology of butyrate formation in the human colon. FEMS Microbiol Lett 217, 133–139.[CrossRef][Medline]
Rincon, M. T., Martin, J. C., Aurilia, V., McCrae, S. I., Rucklidge, G. J., Reid, M. D., Bayer, E. A., Lamed, R. & Flint, H. J. (2004). ScaC, an adaptor protein carrying a novel cohesin that expands the dockerin-binding repertoire of the Ruminococcus flavefaciens 17 cellulosome. J Bacteriol 186, 2576–2585.
Scherf, U. & Buckel, W. (1991). Purification and properties of 4-hydroxybutyrate coenzyme A transferase from Clostridium aminobutyricum. Appl Environ Microbiol 57, 2699–2702.
Schweiger, G. & Buckel, W. (1984). On the dehydration of (R)-lactate in the fermentation of alanine to propionate by Clostridium propionicum. FEBS Lett 171, 79–84.[CrossRef][Medline]
Selmer, T., Willanzheimer, A. & Hetzel, M. (2002). Propionate CoA-transferase from Clostridium propionicum. Eur J Biochem 269, 372–380.[Medline]
Skantar, A. M. & Carta, L. K. (2000). Amplification of Hsp90 homologs from plant-parasitic nematodes using degenerate primers and ramped annealing PCR. BioTechniques 29, 1182–1185.[Medline]
Smith, R. F., Wiese, B. A., Wojzynski, M. K., Davison, D. B. & Worley, K. C. (1996). BCM Search Launcher – an integrated interface to molecular biology data base search and analysis services available on the World Wide Web. Genome Res 6, 454–462.
Söhling, B. & Gottschalk, G. (1996). Molecular analysis of the anaerobic succinate degradation pathway in Clostridium kluyveri. J Bacteriol 178, 871–880.
Sramek, S. J. & Frerman, F. E. (1975). Purification and properties of Escherichia coli coenzyme A-transferase. Arch Biochem Biophys 171, 14–26.[CrossRef][Medline]
Tung, K. K. & Wood, W. A. (1975). Purification, new assay, and properties of coenzyme A transferase from Peptostreptococcus elsdenii. J Bacteriol 124, 1462–1474.
Valentin, H. E., Reiser, S. & Gruys, K. J. (2000). Poly(3-hydroxybutyrate-co-4-hydroxybutyrate) formation from -aminobutyrate and glutamate. Biotechnol Bioeng 67, 291–299.[CrossRef][Medline]
Wächtershäuser, A. & Stein, J. (2000). Rationale for the luminal provision of butyrate in intestinal diseases. Eur J Nutr 39, 164–171.[CrossRef][Medline]
Walter, K. A., Nair, R. V., Cary, J. W. & Bennett, G. N. (1993). Sequence and arrangement of two genes of the butyrate-synthesis pathway of Clostridium acetobutylicum ATCC 824. Gene 134, 107–111.[CrossRef][Medline]
Wiesenborn, D. P., Rudolph, F. B. & Papoutsakis, E. T. (1989). Coenzyme A transferase from Clostridium acetobutylicum ATCC 824 and its role in the uptake of acids. Appl Environ Microbiol 55, 323–329.
Wilkins, M. R., Lindskog, I., Gasteiger, E., Bairoch, A., Sanchez, J.-C., Hochstrasser, D. F. & Appel, R. D. (1997). Detailed peptide characterisation using PEPTIDEMASS – a World-Wide Web accessible tool. Electrophoresis 18, 403–408.[CrossRef][Medline]
Received 5 August 2005;
revised 3 October 2005;
accepted 4 October 2005.
This article has been cited by other articles:
|
|
 |
|
  P. Louis and H. J. Flint Development of a Semiquantitative Degenerate Real-Time PCR-Based Assay for Estimation of Numbers of Butyryl-Coenzyme A (CoA) CoA Transferase Genes in Complex Bacterial Samples Appl. Envir. Microbiol., March 15, 2007; 73(6): 2009 - 2012. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D. Scanlan, F. Shanahan, C. O'Mahony, and J. R. Marchesi Culture-Independent Analyses of Temporal Variation of the Dominant Fecal Microbiota and Targeted Bacterial Subgroups in Crohn's Disease J. Clin. Microbiol., November 1, 2006; 44(11): 3980 - 3988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. P. Scott, J. C. Martin, G. Campbell, C.-D. Mayer, and H. J. Flint Whole-Genome Transcription Profiling Reveals Genes Up-Regulated by Growth on Fucose in the Human Gut Bacterium "Roseburia inulinivorans". J. Bacteriol., June 1, 2006; 188(12): 4340 - 4349. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
, spots 1–5; 
, spots 1–4; 
, spots 2–5; 
, spots 2–4; 
, spots 3–5; °, spots 1, 2 and 4; 
, spots 1, 3 and 4; +, spots 2 and 4; x, spots 3 and 4. Numbers correspond to the respective spot only.
, 50; 
, 100 (dashed line); 
, 200 (dashed line); 