|
|
||||||||
1 Dipartimento di Malattie Infettive, Parassitarie e Immunomediate, Istituto Superiore di Sanità, Rome, Italy
2 Laboratorio di Microbiologia Molecolare e Biotecnologia, Azienda Ospedaliera Universitaria Senese, Siena, Italy
3 Dipartimento di Biologia Molecolare, Università di Siena, and UOC Batteriologia, Azienda Ospedaliera Universitaria Senese, Siena, Italy
Correspondence
Marco R. Oggioni
oggioni{at}unisi.it
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
From the published genome sequences, it can be inferred that S. pneumoniae possesses two (strain R6, rough derivative of serotype 2; Hoskins et al., 2001
), three (strain TIGR4, serotype 4; Tettelin et al., 2001
) or even four (strain G54, serotype 19F; Dopazo et al., 2001
) zinc metalloproteinase genes, depending on the strain. All the above-mentioned strains possess iga and zmpB, encoding the IgA protease and ZmpB, respectively. In addition, strains TIGR4 and G54 possess the metalloproteinase gene zmpC. In G54 only, a duplicate gene is present in the iga locus that is predicted to code for another zinc metalloproteinase, and that we suggest should be designated ZmpD. The most studied enzyme is the IgA protease, which cleaves human IgA1 in the hinge region (Kilian et al., 1996
; Poulsen et al., 1996
; Wani et al., 1996
). The importance of the IgA protease in pneumococcal virulence is evidenced by assays of bacterial adherence to respiratory epithelial cells in culture (Weiser et al., 2003
). Recently, the target of pneumococcal zinc metalloproteinase ZmpC has been identified as human matrix metalloproteinase 9 (MMP-9), a gelatinase which participates in the protease cascade responsible for remodelling the extracellular matrix (Oggioni et al., 2003
). Pathogenic processes in which MMP-9 has been implicated include the opening of the bloodbrain barrier during inflammation, tissue destruction in periodontal disease and tissue invasion by tumour cells (McCawley & Matrisian, 2000
). The pneumococcal enzyme ZmpC could play a role in favouring S. pneumoniae invasion and the crossing of tissue barriers through the cleavage and activation of human MMP-9 (Oggioni et al., 2003
). Knock-out TIGR4 mutants that have been deleted for iga, zmpB or zmpC have been shown to be attenuated in murine models of infection (Chiavolini et al., 2003
; Blue et al., 2003
).
The great majority of pneumococcal genes share from 97 to 99 % nucleotide identity among isolates (Oggioni & Pozzi, 2001
; Tettelin & Hollingshead, 2004
). However, the pneumococcal zinc metalloproteinases fall within a restricted group of hypervariable surface proteins that includes other important antigens, such as PspA and PspC. The hypervariability of these antigens has been recognized to be due to frequent horizontal gene transfer in these regions, enabling antigenic escape (Iannelli et al., 2002
). The purpose of this work was to investigate the presence of the zinc metalloproteinase genes iga, zmpB, zmpC and zmpD in a collection of S. pneumoniae isolates belonging to a variety of different serotypes.
| METHODS |
|---|
|
|
|---|
65 years). Forty-three strains, isolated from the nasopharynx of healthy children in different day-care centres in Rome in 1999 (Petrosillo et al., 2002
PCR assays for metalloprotease genes (locus-specific PCR).
Detection of the locus for each of the four zinc metalloproteinase genes (iga, zmpB, zmpC and zmpD) was accomplished by PCR, using the Roche Expand Long Template PCR system, following the recommended procedure. Frozen pneumococcal stock culture (2 µl) was used as template. The primer pairs were designed for conserved sequences of each locus, on the basis of the published pneumococcal genomes (Table 1
). The primers used to amplify zmpB and zmpC annealed upstream and downstream of the respective ORFs, thus amplifying the whole genes, if present (Fig. 1
), and yielding amplicons of approximately 5800 and 8000 bp, respectively. If gene zmpC was missing, the predicted amplicon of the zmpC locus was of approximately 600 bp. Two different PCR reactions were designed to detect the presence of iga and zmpD, both of which are contained in the iga locus. In both assays, the forward primer (GM192) annealed to the conserved sequence upstream of iga; the reverse primer annealed to the sequence immediately downstream of iga (GM9) or inside zmpD (GM191), for the two reactions, respectively (Fig. 1
). The presence of iga alone was detected by an amplification product of approximately 6500 bp in the first PCR assay and by no amplification in the second assay. If iga was associated with zmpD, the first PCR assay would give no amplification, while the second assay would amplify a segment of approximately 7000 bp spanning iga and a portion of zmpD. The PCR products were examined in UV light after electrophoresis in a 0·8 % agarose gel.
|
|
Quantitative real-time RT-PCR.
Quantitative RT-PCR was performed essentially as described previously (Oggioni et al., 2004
). In brief, RNA extraction was performed using the SV Total RNA isolation system (Promega) according to the manufacturer's instructions. Retrotranscription was performed with random octamer primers (10 pmol µl1), using RNAsin (40 U µl1 RNAsin Plus RNase inhibitor, Promega) and ImProm II reverse transcriptase (Promega). Retrotranscribed samples were stored frozen. Quantitative real-time PCR was performed essentially as previously described (Oggioni et al., 2004
), in a LightCycler (Roche) using LightCycler DNA-Master SYBR Green I for detection. The relative gene expression was analysed using the 2
CT method (Livak & Schmittgen, 2001
). The reference gene was the housekeeping gene gyrB (Oggioni et al., 2004
). The efficiency of all primer pairs was controlled by doing PCRs on serially diluted samples of cDNA. Only primer sets with a comparable efficiency were used for quantification. The primer pairs used for gene expression analysis were designed from the sequences of strain TIGR4 and were for iga (SP1154) TGGCAGATTCAGAGCTATCATC and GCCTCTCATTCTTGCTTCC (159 bp amplicon), for zmpB (SP0664) AATGAGCGCTAGAAATGTTGT and ATTAAATAATGGATGTTCCAAT (124 bp amplicon), and for zmpC (SP0071) GATGAGTCAAGGGATTCAATCG and AAGGGCCTCTACCAGCAAG (118 bp amplicon). All data were obtained from quadruplicate biological replicates.
Western blot.
The production of zinc metalloproteinases was analysed by Western blot using standard conditions. The antiserum for the IgA protease was kindly provided by Mogens Kilian (Poulsen et al., 1996
), and the antiserum for ZmpB of D39 by Tim Mitchell and Gavin Paterson (Blue et al., 2003
). The serum for ZmpC was obtained from mice challenged with a DNA vaccine vector expressing the zmpC gene of TIGR4 lacking the sequence encoding the hydrophobic N terminus (results not shown).
PFGE and multilocus sequence typing (MLST).
Molecular typing was performed by PFGE, following a method previously described (Pantosti et al., 2000
). Isolates differing by one to six bands were considered genetically related and were assigned to the same PFGE type, but to different subtypes (Tenover et al., 1995
). A computer-assisted dendrogram of fragment patterns was constructed using Diversity Database Fingerprinting software, version 2 (Bio-Rad Laboratories). Clustering was obtained by the unweighted pair group method with arithmetic averages (UPGAMA) with the Dice similarity coefficient. MLST (Enright & Spratt, 1998
) was performed on representative isolates as recommended at the MLST web site (http://spneumoniae.mlst.net/).
| RESULTS |
|---|
|
|
|---|
Expression of zmp genes and characterization of gene products
In order to characterize the zmp genes and their gene products, we monitored the gene expression, protein production and enzymic activity of the proteases. The detection of gene expression requires the use of probes or primers internal to the genes of interest. Especially in the case of genes under high selective pressure and which show extensive allelic variation, this restricts the analysis to a single strain. We designed real-time RT-PCR primers for the three zmp genes of the TIGR4 strain. The expression of the zmp genes was assayed by real-time RT-PCR in liquid culture, after induction of competence and during growth on agar plates. In liquid exponentially growing culture, all three zmp genes were expressed at a level similar to that of the control gene gyrB. We have reported in previous work the effect of competence-stimulating peptide (CSP)1 and CSP2 on the induction of gene expression of some selected competence genes in TIGR4 (Oggioni et al., 2004
). By reusing the same frozen cDNA samples collected at 5 and 10 min after the addition of CSP to pneumococcal cells, no change in the expression of any zmp gene was detected in response to competence induction. When assaying zmp expression in non-confluent colonies on agar plates after 12 h incubation, a threefold relative decrease of expression (iga, 3·6±0·3; zmpB, 3·5±0·2; and zmpC, 3·0±0·6-fold decrease) was observed.
Protein production was evaluated by Western blotting of supernatants of late-exponential-phase broth cultures of both D39 and TIGR4 (Fig. 2
). IgA protease was detected in the supernatant of both strains; this was expected, since the gene is present in both strains, and the identity at the protein level is 87 %. A band reactive to ZmpB was identified only in D39. When overstaining a comparable blot, ZmpB-specific reactivity could also be seen in supernatants of TIGR4, revealing a single protein band of similar size to that of D39 (data not shown). Since the anti-ZmpB serum was generated against a protein fragment derived from D39, the absence of reactivity in TIGR4 is consistent with the low identity of the two allelic forms of ZmpB (below 50 %). ZmpC was detected only in TIGR4, as expected, since D39 is one of the strains which does not contain the zmpC gene.
|
|
All pneumococcal strains yielded amplification products for the three loci examined, confirming that high sequence conservation exists between the pneumococcal genomes. No large variation in the apparent size was observed between the amplicons obtained for the isolates under investigation and the amplicons obtained with the control strains. The few variations consisted of an increase in the apparent size of zmpB amplicons: 14 isolates yielded a zmpB amplicon of approximately 65007500 bp, instead of the 5800 bp of the control. In six isolates, an insertion sequence, IS1167, located downstream from the coding sequence of ZmpB, was found to account for the larger amplicons. No further investigation was carried out of the other isolates.
The analysis of the three metalloproteinase loci in 218 pneumococcal isolates yielded four different combinations, as described in Table 2
. The zinc metalloproteinase gene zmpB and iga were present in all the strains analysed, while zmpC was found in 40 isolates only (18·4 %) and zmpD in approximately half of the isolates examined (48·6 %). Interestingly, zmpC was more frequently found in isolates carrying zmpD also, and therefore positive for all four metalloproteinase genes (Table 2
).
|
|
Association of the metalloprotease genes with particular clones
In order to verify the nature of the association of zmpC and zmpD with certain sts, all isolates belonging to st 8 and st 11A were examined by PFGE to determine their genetic relatedness. Isolates with >80 % genetic relatedness on the PFGE-based dendrogram (Fig. 4
) were considered to belong to the same clone. Twenty-eight out of 32 isolates belonging to st 8 and st 11A showed PFGE type 1, which included nine different subtypes (1·11·9). All these isolates, with the exception of a single strain (AP200), were both zmpC and zmpD positive. Divergent PFGE profiles were shown by three st 8 isolates (PFGE type 2) and one st 11A isolate (PFGE type 3) that were negative for both zmpC and zmpD (Fig. 4
).
|
|
| DISCUSSION |
|---|
|
|
|---|
The genes for the zinc metalloproteinases in S. pneumoniae have been recognized to fall within a streptococcal gene family with a high allelic variability (Chiavolini et al., 2003
; Oggioni et al., 2003
; Poulsen et al., 1998
). The extremely high nucleotide variability, resulting in a mosaic structure of the zmp genes, hinders epidemiological approaches using nucleotide probes or primers directed to the coding sequences (Hakenbeck et al., 2001
). We therefore decided to trace the zmp genes by employing primers for conserved sequences outside the genes. In order to link this locus-specific PCR approach to the proteinase genes, we performed BLAST genome screens, gene expression analysis, the determination of protein production, and enzymic activity assays. In silico genome screens confirmed that the four zmp genes are always associated to the respective chromosomal loci. Gene expression analysis showed that the three zmp genes of strain TIGR4 are expressed in comparable amounts during growth. These in vitro results are in accordance with data from whole-genome screens for virulence determinants in vivo that have identified zmp genes by signature-tagged mutagenesis (Hava & Camilli, 2002
; Polissi et al., 1998
). In order to control for whether zmp gene transcription yields mature proteins, we performed Western blots for IgA1 protease, ZmpB and ZmpC, and activity assays for ZmpC. Both types of assays confirmed that mature and active proteases are produced, and that the phenotypes correlate with the data obtained by our locus-PCR approach, although the variability of Zmp proteins and the specificity of antisera limit the possibility of a large screening by Western blotting. Our data add to a series of reports on the pneumococcal IgA protease which show that all pneumococci produce IgA1 protease and have IgA1 protease activity (Poulsen et al., 1996
), and that patients' sera recognize IgA1 protease (Romanello et al., 2006
). To summarize, data obtained by others and by us indicate that the pneumococcal zmp genes are (1) always linked to a certain chromosomal locus and are (2) transcribed in vitro and in vivo, and that (3) they yield mature and active proteins, which are (4) antigenic in humans and (5) linked to virulence. These observations prompted us to use our locus-specific PCR approach to evaluate the molecular epidemiology of these genes in a large number of pneumococcal isolates.
As a consequence of primer design based on conserved sequences outside the zmp genes, we were able to amplify the three metalloproteinase loci in all the isolates examined by using primers designed towards conserved sequences from the published pneumococcal genomes. With few exceptions (involving zmpB), we found that the size of the metalloproteinase genes did not appear to differ from that of the control strains. In some isolates, in which the zmpB amplicon was larger than expected, an insertion sequence (IS), IS1167, was found inserted immediately downstream from the zmpB coding sequence. This IS element is commonly found in multiple copies in the pneumococcal genome, and has also been found to cluster, in some isolates, downstream from the pspC locus (Iannelli et al., 2002
).
Our results confirmed that, as in the strains for which the genome has been published, the genes for two of the metalloproteinases, IgA protease and ZmpB, were consistently present in all the strains examined. Both IgA protease and ZmpB have been demonstrated to play a role in virulence. The IgA1 protease is a well-known virulence factor that cleaves human IgA1 in the hinge region (Kilian et al., 1996
; Poulsen et al., 1996
; Wani et al., 1996
). Previous studies have shown that all pneumococcal isolates exhibit this activity (Kilian et al., 1996
; Oggioni et al., 2003
). The substrate of ZmpB has not been identified; however, the protein has been demonstrated to be a mediator of inflammation in the lung (Bergé et al., 2001
; Blue et al., 2003
).
The other two zinc metalloproteinase genes, zmpC and zmpD, were found in some of the strains only: 18 and 49 % of the isolates, respectively. zmpC was more frequently present in isolates that also harboured zmpD, and were therefore endowed with the complete array of the four metalloproteinase genes. ZmpC has been demonstrated to cleave MMP9 (Oggioni et al., 2003
). Cleavage of MMP9 by isolates carrying zmpC has been shown previously, and has also been confirmed in 10 randomly selected zmpC-positive isolates from this study. To date, no target has been found for ZmpD. Although a previous study indicated an association between the presence of zmpC and strains isolated from cases of pneumonia (Oggioni et al., 2003
), in this study, no link was observed between the presence of zmpC or zmpD and the site of pneumococcal infection. In addition, the occurrence of zmpC or zmpD did not differ in isolates from healthy carriers, confirming that carriage and invasive isolates do not have peculiar characteristics, since invasive isolates originate from carriage ones (Bogaert et al. 2004
). However, the presence of zmpC and zmpD did not appear to be random, but was associated with certain serotypes. Previously, among a small number of clinical isolates, zmpC has been found associated with serogroup 9 strains (Oggioni et al., 2003
). In this study, zmpC and zmpD were found mainly associated with isolates belonging to st 8 and st 11A. Molecular typing by PFGE revealed that isolates within st 8 and st 11A that carried the whole array of the four metalloproteinase genes were clonally related. MLST analysis confirmed this finding. The zmpC/zmpD-positive st 8 and st 11A isolates belonged to STs (ST53 and ST62) that were specific for the respective sts, according to the MLST database and to recently published reports from Scotland (Jefferies et al., 2004
) and the USA (Gertz et al., 2003
). Interestingly, ST53 and ST62 differ for two alleles out of seven (http://spneumoniae.mlst.net/) and therefore they can be considered to enclose clonally related isolates. On the basis of genotyping analysis, the presence of zmpC/zmpD in isolates of sts other than st 8 or st 11A cannot be explained by the occurrence of a capsular switch. In fact, the presence of zmpC/zmpD in unrelated isolates belonging to different sts could be due to the horizontal transfer of metalloproteinase genes.
Although only pneumococci isolated in Italy were examined in this study, the ST data for st 8 and st 11A strains from other countries suggest that the clonal cluster 8/11A is not a peculiarity of our geographical area. Sts 8 and 11A are not the most prominent sts causing invasive disease; however, they are fairly common and are incorporated in the 23-valent pneumococcal vaccine. These sts are more commonly found in adults than in young children (Hausdorff et al., 2000
). In an Italian study of invasive disease, st 8 and st 11A ranked, respectively, twelfth and seventeenth in the general population and sixth and fourteenth in elderly subjects (Pantosti et al., 2003
). It could be speculated that the presence of the whole array of the four metalloproteinases, which are putative virulence factors, has contributed to the stability and success of the clonal cluster 8/11A among clinical isolates.
In conclusion, our study shows the molecular epidemiology of the pneumococcal zinc metalloproteinases, an important family of surface-exposed antigenic virulence determinants. These data are of prime importance when studying the virulence of pneumococcal isolates or screening genomes for novel vaccine candidates, as only extensive molecular epidemiology of variable genes, which are the part of the genome under selective pressure, permits their products to be linked to specific disease situations and their usefulness as vaccine antigens to be predicted.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Blue, C. E., Paterson, G. K., Kerr, A., Bergé, M., Claverys, J. P. & Mitchell, T. J. (2003). ZmpB, a novel virulence factor of Streptococcus pneumoniae that induces tumor necrosis factor alpha production in the respiratory tract. Infect Immun 71, 49254935.
Bogaert, D., de Groot, R. & Hermans, P. W. M. (2004). Streptococcus pneumoniae colonization: the key to pneumococcal disease. Lancet Infect Dis 4, 144154.[CrossRef][Medline]
Chapuy-Regaud, S., Ogunniyi, A. D., Diallo, N., Huet, Y., Desnottes, J. F., Paton, J. C., Escaich, S. & Trombe, M. C. (2003). RegR, a global LacI/GalR family regulator, modulates virulence and competence in Streptococcus pneumoniae. Infect Immun 71, 26152625.
Chiavolini, D., Memmi, G., Maggi, T., Iannelli, F., Pozzi, G. & Oggioni, M. R. (2003). The three extra-cellular zinc metalloproteinases of Streptococcus pneumoniae have a different impact on virulence in mice. BMC Microbiol 3, 14.[CrossRef][Medline]
Dicuonzo, G., Gherardi, G., Gertz, R. E., D'Ambrosio, F., Goglio, A., Lorino, G., Recchia, S., Pantosti, A. & Beall, B. (2002). Genotypes of invasive pneumococcal isolates recently recovered from Italian patients. J Clin Microbiol 40, 36603665.
Dopazo, J., Mendoza, A., Herrero, J. & 13 other authors (2001). Annotated draft genomic sequence from Streptococcus pneumoniae type 19F clinical isolate. Microb Drug Resist 7, 99125.[CrossRef][Medline]
Enright, M. & Spratt, B. (1998). A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144, 30493060.
Gertz, R. E., McEllistrem, C., Boxrud, D. J. & 8 other authors (2003). Clonal distribution of invasive pneumococcal isolates from children and selected adults in the United States prior to 7-valent conjugate vaccine introduction. J Clin Microbiol 41, 41944216.
Gillespie, S. H. (1989). Aspects of pneumococcal infection including bacterial virulence, host response and vaccination. J Med Microbiol 28, 237248.
Hakenbeck, R., Balmelle, N., Weber, B., Gardes, C., Keck, W. & de Saizieu, A. (2001). Mosaic genes and mosaic chromosomes: intra- and interspecies genomic variation of Streptococcus pneumoniae. Infect Immun 69, 24772486.
Hausdorff, W. P., Bryant, J., Paradiso, P. R. & Siber, G. R. (2000). Which pneumococcal serogroups cause the most invasive disease: implications for conjugate vaccine formulation and use, part I. Clin Infect Dis 30, 100121.[CrossRef][Medline]
Hava, D. L. & Camilli, A. (2002). Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol Microbiol 45, 13891406.[Medline]
Hoskins, J., Alborn, W. E., Arnold, J. & 36 other authors (2001). Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183, 57095717.
Iannelli, F., Oggioni, M. R. & Pozzi, G. (2002). Allelic variation in the highly polymorphic locus pspC of Streptococcus pneumoniae. Gene 284, 6371.[CrossRef][Medline]
Iannelli, F., Chiavolini, D., Ricci, S., Oggioni, M. R. & Pozzi, G. (2004). Pneumococcal surface protein C (PspC) contributes to sepsis caused by Streptococcus pneumoniae. Infect Immun 72, 30773080.
Jefferies, J. M. C., Smith, A., Clarke, S. C., Dowson, C. & Mitchell, T. J. (2004). Genetic analysis of diverse disease-causing pneumococci indicates high level of diversity within serotypes and capsule switching. J Clin Microbiol 42, 56815688.
Kilian, M., Mestecky, J., Kulhavy, R., Tomana, M. & Butler, W. T. (1980). IgA1 proteases from Haemophilus influenzae, Streptococcus pneumoniae, Neisseria meningitidis and Streptococcus sanguis: comparative immunochemical studies. J Immunol 124, 25962600.[Abstract]
Kilian, M., Reinholdt, J., Lomholt, H., Poulsen, K. & Frandsen, E. V. G. (1996). Biological significance of IgA1 proteases in bacterial colonization and pathogenesis: critical evaluation of experimental evidence. APMIS 104, 321338.[Medline]
Livak, K. J. & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2
CT method. Methods 25, 402408.[CrossRef][Medline]
McCawley, L. J. & Matrisian, L. M. (2000). Matrix metalloproteinases: multifunctional contributors to tumor progression. Mol Med Today 6, 149156.[CrossRef][Medline]
Mitchell, T. J. (2000). Virulence factors and the pathogenesis of disease caused by Streptococcus pneumoniae. Res Microbiol 151, 413419.[Medline]
Oggioni, M. R. & Pozzi, G. (2001). Comparative genomics for identification of clone-specific sequence blocks in Streptococcus pneumoniae. FEMS Microbiol Rev 200, 137143.[CrossRef]
Oggioni, M. R., Memmi, G., Maggi, T., Chiavolini, D., Iannelli, F. & Pozzi, G. (2003). Pneumococcal zinc metalloproteinase ZmpC cleaves human matrix metalloproteinase 9 and is a virulence factor in experimental pneumonia. Mol Microbiol 49, 795805.[CrossRef][Medline]
Oggioni, M. R., Iannelli, F., Ricci, S., Chiavolini, D., Parigi, R., Trappetti, C., Claverys, J.-P. & Pozzi, G. (2004). Antibacterial activity of a competence stimulating peptide in experimental sepsis caused by Streptococcus pneumoniae. Antimicrob Agents Chemother 48, 47254732.
Pantosti, A., D'Ambrosio, F., Tarasi, A., Recchia, S., Orefici, G. & Mastrantonio, P. (2000). Antibiotic susceptibility and serotype distribution of Streptococcus pneumoniae causing meningitis in Italy, 19971999. Clin Infect Dis 31, 13731379.[CrossRef][Medline]
Pantosti, A., Boccia, D., D'Ambrosio, F., Recchia, S., Orefici, G. & Moro, M. L. (2003). Inferring the potential success of pneumococcal vaccination in Italy: serotypes and antibiotic resistance of Streptococcus pneumoniae isolates from invasive diseases. Microb Drug Resist 9, 6168.[Medline]
Paton, J. C., Andrew, P. W., Boulnois, G. J. & Mitchell, T. J. (1993). Molecular analysis of the pathogenicity of Streptococcus pneumoniae: the role of pneumococcal proteins. Annu Rev Microbiol 47, 89115.[Medline]
Petrosillo, N., Pantosti, A., Bordi, E., Spanò, A., Del Grosso, M., Tallarida, B. & Ippolito, G. (2002). Prevalence, determinants, and molecular epidemiology of Streptococcus pneumoniae isolates colonizing the nasopharynx of healthy children in Rome. Eur J Clin Microbiol Infect Dis 21, 181188.[CrossRef][Medline]
Polissi, A., Pontiggia, A., Feger, G., Altieri, M., Mottl, H., Ferrari, L. & Simon, D. (1998). Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect Immun 66, 56205629.
Poulsen, K., Reinholdt, J. & Kilian, M. (1996). Characterization of the Streptococcus pneumoniae immunoglobulin A1 protease gene (iga) and its translation product. Infect Immun 64, 39573966.[Abstract]
Poulsen, K., Reinholdt, J., Jespersgaard, C., Boye, K., Brown, T. A., Hauge, M. & Kilian, M. (1998). A comprehensive genetic study of streptococcal immunoglobulin A1 proteases: evidence for recombination within and between species. Infect Immun 66, 181190.
Romanello, V., Marcacci, M., Molin, F. D., Maschioni, M., Censini, S., Covacci, A., Baritussio, A. G., Montecucco, C. & Tonello, F. (2006). Cloning, expression, purification, and characterization of Streptococcus pneumoniae IgA1 protease. Protein Expr Purif 45, 142149.[CrossRef][Medline]
Tenover, F. C., Arbeit, R. D., Goering, R. V., Mickelsen, P. A., Murray, B. E., Persing, D. H. & Swaminathan, B. (1995). Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33, 22332239.[Medline]
Tettelin, H. & Hollingshead, S. K. (2004). Comparative genomics of S. pneumoniae: intra-strain diversity and genome plasticity. In The Pneumococcus, pp 1529. Edited by E. I. Tuomanen. Washington, DC: American Society for Microbiology.
Tettelin, H., Nelson, K. E., Paulsen, I. T. & 36 other authors (2001). Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293, 498506.
Wani, J. H., Gilbert, J. V., Plaut, A. G. & Weiser, J. N. (1996). Identification, cloning, and sequencing of the immunoglobulin A1 protease gene of Streptococcus pneumoniae. Infect Immun 64, 39673974.[Abstract]
Weiser, J. N., Bae, D., Fasching, C., Scamurra, R. W., Ratner, A. J. & Janoff, E. N. (2003). Antibody-enhanced pneumococcal adherence requires IgA1 protease. Proc Natl Acad Sci U S A 100, 42154220.
Received 9 August 2005;
revised 23 September 2005;
accepted 7 October 2005.
This article has been cited by other articles:
![]() |
N. J. Croucher, D. Walker, P. Romero, N. Lennard, G. K. Paterson, N. C. Bason, A. M. Mitchell, M. A. Quail, P. W. Andrew, J. Parkhill, et al. Role of Conjugative Elements in the Evolution of the Multidrug-Resistant Pandemic Clone Streptococcus pneumoniaeSpain23F ST81 J. Bacteriol., March 1, 2009; 191(5): 1480 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Camilli, M. Del Grosso, F. Iannelli, and A. Pantosti New Genetic Element Carrying the Erythromycin Resistance Determinant erm(TR) in Streptococcus pneumoniae Antimicrob. Agents Chemother., February 1, 2008; 52(2): 619 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gherardi, L. Fallico, M. Del Grosso, F. Bonanni, F. D'Ambrosio, R. Manganelli, G. Palu, G. Dicuonzo, and A. Pantosti Antibiotic-Resistant Invasive Pneumococcal Clones in Italy J. Clin. Microbiol., February 1, 2007; 45(2): 306 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Obert, J. Sublett, D. Kaushal, E. Hinojosa, T. Barton, E. I. Tuomanen, and C. J. Orihuela Identification of a Candidate Streptococcus pneumoniae Core Genome and Regions of Diversity Correlated with Invasive Pneumococcal Disease. Infect. Immun., August 1, 2006; 74(8): 4766 - 4777. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Takenouchi-Ohkubo, L. M. Mortensen, K. R. Drasbek, M. Kilian, and K. Poulsen Horizontal transfer of the immunoglobulin A1 protease gene (iga) from Streptococcus to Gemella haemolysans Microbiology, July 1, 2006; 152(7): 2171 - 2180. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |