Microbiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Microbiology 152 (2006), 2611-2618; DOI  10.1099/mic.0.28698-0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cortes-Perez, N. G.
Right arrow Articles by Bermúdez-Humarán, L. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cortes-Perez, N. G.
Right arrow Articles by Bermúdez-Humarán, L. G.
Agricola
Right arrow Articles by Cortes-Perez, N. G.
Right arrow Articles by Bermúdez-Humarán, L. G.
Microbiology 152 (2006), 2611-2618; DOI  10.1099/mic.0.28698-0
© 2006 Society for General Microbiology

Construction and characterization of a Lactococcus lactis strain deficient in intracellular ClpP and extracellular HtrA proteases

N. G. Cortes-Perez1, I. Poquet2, M. Oliveira1,3, J. J. Gratadoux1, S. M. Madsen4, A. Miyoshi3, G. Corthier1, V. Azevedo3, P. Langella1 and L. G. Bermúdez-Humarán1

1 Unité d'Ecologie et de Physiologie du Système Digestif, INRA, Domaine de Vilvert, 78352 Jouy en Josas cedex, France
2 Unité des Bactéries Lactiques et Pathogènes Opportunistes, INRA, Domaine de Vilvert, 78352 Jouy en Josas cedex, France
3 Institute of Biological Sciences, Federal University of Minas Gerais (UFMG-ICB), Belo Horizonte, Minas Gerais, Brazil
4 Bioneer A/S, Hørsholm, Denmark

Correspondence
Philippe Langella
philippe.langella{at}jouy.inra.fr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
A Lactococcus lactis strain deficient in both its major proteases, intracellular (ClpP) and extracellular (HtrA), was constructed and characterized. This strain, hereafter called clpP-htrA, could be obtained only by conjugation between a clpP donor strain and an htrA recipient strain in the NZ9000 context, allowing heterologous gene expression under the control of the NICE (nisin-controlled expression) system. The clpP-htrA double mutant showed both higher stress tolerance (e.g. high temperature and ethanol resistance) and higher viability than single clpP or htrA mutant strains. In addition, the secretion rate of two heterologous proteins (staphylococcal nuclease Nuc and Nuc-E7) was also higher in clpP-htrA than in the wild-type strain. This strain should be a useful host for high-level production and quality of stable heterologous proteins.


Abbreviations: NICE, nisin-controlled expression


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Lactic acid bacteria, as food-grade Gram-positive bacteria, are good or attractive host candidates for the production of heterologous proteins of medical and/or technological interest. Lactococcus lactis, the most extensively characterized lactic acid bacterium, has successfully been used for heterologous protein production and secretion (Le Loir et al., 2005Down). As only a single secreted protein, Usp45 (van Asseldonk et al., 1990Down), can be detected by Coomassie blue staining, purification of heterologous secreted proteins could be simplified compared to other Gram-positive bacteria such as Bacillus subtilis. Nevertheless, degradation by host proteases remains a recurrent problem.

Up to now, only two major proteases, ClpP and HtrA, have been identified in plasmid-free strains of L. lactis. ClpP is an ATP-dependent enzyme reported as the major intracellular housekeeping protease in L. lactis (Frees & Ingmer, 1999Down) whereas HtrA is a trypsin-like serine protease essential for growth at high temperatures (39 °C for L. lactis) and which degrades misfolded proteins at the cell surface (Poquet et al., 2000Down; Foucaud-Scheunemann & Poquet, 2003Down). In this study, we constructed a L. lactis NZ9000 strain deficient in its both major proteases, ClpP and HtrA (hereafter called clpP-htrA), and evaluated its physiology and heterologous protein production potential under the control of the NICE (nisin-controlled expression) system (Kuipers et al., 1998Down). Comparison between the clpP-htrA double mutant and the wild-type control strain revealed, as expected, reduced proteolytic activities and increased stability of two heterologous proteins. However, growth thermosensitivity and lethality were found to be partly alleviated compared to either clpP or htrA single mutants, suggesting the occurrence of a secondary suppressive mutation event.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Bacterial strains, plasmids and culture conditions.
The bacterial strains and plasmids used in this work are listed in Table 1Down. As controls for growth studies, we used three strains where the erythromycin resistance gene (erm) is inserted by single crossover at various loci (resulting in an EmR phenotype): the previously described clpP (Bermúdez-Humarán et al., 2002Down) and htrA (Miyoshi et al., 2002Down) single mutant strains, hereafter called clpP- and htrA-NZ9000, respectively, as well as a his strain which was constructed by insertion of the erm gene into the non-essential histidine (his) locus (Delorme et al., 1993Down). The his strain has the same growth and viability behaviour as the wild-type (wt) (native EmS NZ9000) strain (data not shown) and it is hereafter called in this study L. lactis wt.


View this table:
[in this window]
[in a new window]
 
Table 1. Bacterial strains used in this study

 
L. lactis was grown in M17 medium supplemented with 1 % glucose (GM17) at 30 °C without agitation. Plasmid constructions were established in L. lactis by electrotransformation (Langella et al., 1993Down). Antibiotics were added when required as follows: erythromycin (2.5 µg ml–1) and chloramphenicol (5 µg ml–1).

Construction of L. lactis clpP-htrA.
The L. lactis strain deficient in both its major proteases, ClpP and HtrA, was obtained by conjugation between the erythromycin-resistant (Emr) clpP-NZ9000 (clpP gene inactivated by insertion of the erm gene; Fig. 1Down(a); Bermúdez-Humarán et al., 2002Down) as donor strain and a chloramphenicol-resistant (CmR) derivative of the marker-free L. lactis NZ9000 htrA as recipient strain (Fig. 1cDown; Rigoulay et al., 2004Down). This latter strain was obtained by the introduction of pGhost3 plasmid (kindly provided by E. Maguin, INRA, Jouy en Josas) in the marker-free NZ9000 htrA strain: pGhost3 is a thermosensitive (Ts) plasmid (isolated after mutagenesis of pGK12; Maguin et al., 1992Down) that replicates in L. lactis at 28 °C but is lost above 37 °C. For conjugation, solid surface mating was carried out as described previously (Langella & Chopin, 1989Down) with the following modifications: 1 ml of saturated culture of the donor strain was mixed with 1 ml saturated culture of the recipient strain and cells were harvested, suspended in 200 µl and spread on non-selective GM17 medium. After 5 h of mating at 30 °C, cells were collected and plated at appropriate dilutions on GM17 medium containing antibiotics. Transconjugants were selected as double EmR/CmR clones and pGhost3 plasmid was then cured by a temperature shift, as follows. One transconjugant was grown in GM17 medium containing antibiotics at 30 °C until saturation. The culture was then diluted and plated without CmR at 35 °C: this temperature was chosen to allow loss of the plasmid and to limit thermal stress, as both ClpP and HtrA are heat-shock proteins (Frees & Ingmer, 1999Down; Poquet et al., 2000Down; Foucaud-Scheunemann & Poquet, 2003Down). After 48 h incubation, some colonies were screened on selective and non-selective GM17 media incubated for 24 h. Colonies of the clpP-htrA double mutant strain which had lost pGhost3 were Cm sensitive (CmS), but they were EmR, and Em addition was needed to maintain the clpP mutation (Fig. 1aDown). These candidates were also sensitive to both streptomycin (Str) and rifampicin (Rif), confirming that they were not transconjugants derived from the StrR/RifR donor strain. One of these plasmid-cured CmS transconjugants was chosen as the clpP-htrA strain.


Figure 1
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Confirmation of clpP disruption in the clpP-htrA strain. (a) Scheme showing the construction of the single-crossover L. lactis clpP-NZ9000 (for more details about the construction see Frees & Ingmer, 1999Down). (b, c) PCR identification of the clpP-NZ9000 and clpP-htrA strains using primers 5C and 3C for identification of clpP disruption (b) and 5E and 3B for confirmation of integrated plasmid (c).

 
Confirmation of clpP and htrA inactivation in the clpP-htrA strain.
In the clpP-htrA double mutant, inactivation of chromosomal clpP and htrA genes was confirmed by PCR analyses. Primers used were 5C (CCAATGCATCAGGTTATTTAGTACCTACCG) and 3C (GGACTAGTCCTTATTTTAATGAATTATTTTCC) for clpP and 5H (GGATGGCAAAAGCTAATATAGGAAAATTGC) and 3H (GGTTAATTAGAAGAAGATGAACTATTTGTTTC) for htrA. For Western blot analysis, we used antibodies raised against Staphylococcus aureus HtrA1 protease (its highly conserved catalytic site), which specifically recognize L. lactis HtrA (Rigoulay et al., 2004Down). Protein extracts were prepared from either exponential-phase (OD600 0.4-0.6) or stationary-phase (OD600 2–3) cultures.

Production of heterologous proteins in the clpP-htrA strain.
Production and secretion of two heterologous proteins, the staphylococcal nuclease (Nuc) and the human papillomavirus E7 protein fused to Nuc (Nuc-E7), were analysed in the clpP-htrA strain. For this, pSEC:Nuc or pSEC:Nuc-E7 plasmids, encoding Nuc and Nuc-E7, respectively (Bermúdez-Humarán et al., 2002Down, 2003aDown), were established in the four following L. lactis strains: wt, clpP-NZ9000, htrA-NZ9000 and clpP-htrA. Nuc and Nuc-E7 production was then examined in these strains by Western blotting essentially as described previously (Le Loir et al., 1998Down), using anti-Nuc or anti-E7 antibodies. Briefly, for cell fractionation, 2 ml of induced L. lactis cultures at a given OD600 was harvested by centrifugation at 4 °C and 10 000 r.p.m. The supernatant and cells were processed separately. To compare the amounts of secreted and cell-associated proteins, both cell and supernatant fractions were concentrated. Sample concentration was calculated as follows. The equivalent of 1 ml of 1 OD600 unit of culture (cell or supernatant) was concentrated in a 100 µl final volume as described below, and 10 µl was loaded for SDS-PAGE. Supernatants were precipitated by the addition of 10 % trichloroacetic acid, harvesting by centrifugation at 4 °C and 13 000 r.p.m. The precipitate was dissolved in 1 : 20 volume of 50 mM sodium hydroxide. Cell pellets were resuspended in 70 µl TES containing lysozyme (10 mg ml–1). After 30 min of incubation at 37 °C, cells were lysed with 30 µl 20 % SDS. Equal volumes of 2x loading buffer were added to all samples.

Determination of nuclease activity yields.
Nuclease (Nuc) activity in the supernatants of induced cultures was determined spectrophotometrically, essentially as described previously (Heins et al., 1967Down). Briefly, DNA added as substrate is degraded by Nuc to mono- and oligonucleotides, which are non-precipitable by perchloric acid. The products of the degradation are then quantified by measuring DNA as A260. Nuc concentration is estimated by comparison to a Nuc standard of known concentration.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Characterization of the clpP-htrA strain
Despite several preliminary efforts, we could not obtain a L. lactis strain deficient in both ClpP and HtrA proteases by single- or double-crossover inactivation. We therefore performed a conjugation between a clpP donor strain and an htrA recipient strain. clpP inactivation in the clpP-htrA strain was confirmed by PCR analysis with primers 5C and 3C, designed to hybridize with upstream and downstream regions of the clpP gene, respectively (Fig. 1aUp). The presence of a 618 bp PCR product (containing the intact clpP gene: 600 bp) from genomic DNA of the wt (his) and htrA-NZ9000 strains but not in strains clpP-NZ9000 (used as positive control) and clpP-htrA indicates the disruption of the clpP gene in our mutant strain (Fig. 1bUp). This genotype was confirmed by a second PCR analysis with primers 5E (CATGCCATGGCATGCAAAAGAAAAACGAAATGATACACC) and 3B (GAGCGATTAGAATTATCAGCAAGG). These primers were designed to hybridize with the integrated plasmid (erm gene, primer 5E) and with the target clpP gene (primer 3B) (Fig. 1aUp). As shown in Fig. 1(c)Up, the presence of a ~1500 bp amplified band from the clpP-NZ9000 (used as positive control) and clpP-htrA strains again confirms the disruption of the clpP gene of our mutant strain.

htrA inactivation was then confirmed in the clpP-htrA strain by PCR analysis with primers 5H and 3H, designed to hybridize with upstream and downstream regions, respectively, of the htrA gene (Fig. 2aDown). The presence of a 902 bp PCR product (containing a fragment of the htrA gene with a 322 bp internal deletion) from genomic DNA of strains htrA-NZ9000 (used as positive control) and clpP-htrA indicates the disruption of the htrA gene in our mutant strain (Fig. 2bDown). PCR amplification from genomic DNA of wt and clpP-NZ9000 strains results in a 1228 bp product (containing an intact htrA gene: 1224 bp) (Fig. 2bDown). In addition, we confirmed the absence of HtrA protein in strain clpP-NZ9000 by Western blot analysis using antibodies raised against S. aureus HtrA1 protease (its highly conserved catalytic site) and found to specifically recognize L. lactis HtrA (Rigoulay et al., 2004Down). As shown in Fig. 2(c)Down, protein extracts prepared from exponential-phase wt cultures revealed a band corresponding to the lactococcal HtrA protein (42 kDa; Rigoulay et al., 2004Down). Interestingly, no HtrA signal was detected in extracts prepared from stationary-phase cultures, suggesting that HtrA is mainly produced in the exponential phase (data not shown). htrA inactivation either by single crossover in htrA-NZ9000 (Miyoshi et al., 2002Down) or by double crossover in clpP-htrA (Fig. 2aDown) leads to the absence of HtrA (Fig. 2cDown) in exponential-phase protein extracts.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Confirmation of htrA mutation in the clpP-htrA strain. (a) Scheme showing the construction of the double-crossover L. lactis NZ9000 htrA (for details of the construction see Rigoulay et al., 2004Down). A fragment of the htrA gene from L. lactis MG1363 with a 322 bp internal deletion was PCR amplified and cloned into pSMA500 vector (Madsen et al., 1996Down), resulting in pAMJ411. L. lactis NZ9000 was then transformed with this plasmid and selection with Em allows single-crossover inactivation by insertion of the erm gene into the htrA gene (htrA-NZ9000 EmR strain). The second crossover event was performed by cloning an ectopic non-identical htrA copy from L. lactis IL1403 downstream of the nisin-inducible promoter in pNZ8048 (Kuipers et al., 1998Down), resulting in pAMJ167. This vector, in which IL-1403-htrA gene expression is controlled by the nisin promoter, was introduced into the htrA-NZ9000 EmR strain and recombinant clones were selected as EmR/CmR and by the addition of nisin. To obtain the second crossover event, one recombinant colony was grown in the presence of Cm and nisin. The EmS strain, containing the expected htrA disruption, was isolated and grown in non-selective medium to induce the loss of pAMJ167. Finally, one CmS strain clone (htrA double crossover) was isolated and htrA deletion was confirmed by PCR. The resulting HtrA product is truncated at position 155. (b) PCR identification of htrA-NZ9000 and clpP-htrA strains using primers 5H and 3H for identification of htrA disruption. (c) Confirmation of the absence of HtrA in htrA-NZ9000 and clpP-htrA strains by Western blotting using anti-HtrA antibodies in protein extracts prepared from exponential-phase (OD600 0.4–0.6) cultures.

 
Influence of clpP and htrA inactivation on L. lactis physiology
We first determined the impact of both clpP and htrA inactivations on the growth and viability of the clpP-htrA strain under optimal culture conditions, on rich medium and at 30 °C. Strains were cultured on GM17 liquid medium plus antibiotic (Em 2.5 µg ml–1) and growth was monitored by OD600 measurements for 10 h. At 30 °C, growth of both the htrA- and clpP-NZ9000 strains was somewhat slower than that of the wt. This phenotype has not been studied previously, and the original clpP mutant strain was only described to grow at similar rates on plates at 30 °C (colonies of equal size and frequency; Frees & Ingmer, 1999Down). Surprisingly, the growth of the clpP-htrA double mutant strain was improved compared to the clpP-NZ9000 single mutant (Fig. 3aDown). All strains reached the same growth levels at 10 h (Fig. 3aDown). Viability was then analysed by monitoring strains at 30 °C for 3 days (72 h). Bacterial populations were estimated every 24 h using a spiral plater (Spiral System DS, Interscience) on GM17 agar (Em 2.5 µg ml–1) and viability was measured as c.f.u. ml–1. At 30 °C, viability of all the strains was comparable (Fig. 3bDown).


Figure 3
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 3. Influence of clpP and htrA inactivation on growth (a) and survival (b) of L. lactis. Growth of the clpP-htrA strain (bullet) was monitored by OD600 measurements for 10 h at 30 °C and compared to that of the wt ({blacklozenge}), clpP-NZ9000 ({blacksquare}) and htrA-NZ9000 ({blacktriangleup}) strains. Viability was measured for all strains by estimating bacterial populations every 24 h for 3 days.

 
Stress resistance of the clpP-htrA strain
It was previously demonstrated that the clpP- and htrA-NZ9000 strains are thermosensitive: the original clpP mutant strain was found to be unable to form colonies at 37 °C (Frees & Ingmer, 1999Down), whereas the htrA mutant was severely affected at 37 °C in liquid culture medium but completely stopped growing at 39 °C (Poquet et al., 2000Down). We thus checked the growth phenotype of clpP-htrA at 37 °C.

At 37 °C, clpP-NZ9000 was unexpectedly found to grow almost normally in liquid culture medium. A significant improvement in growth of the clpP-htrA strain was observed when compared to both single clpP- and htrA-NZ9000 mutant strains (Fig. 4aDown). Furthermore, the clpP-htrA strain was able to form colonies at 37 °C (~20-fold lower frequency than at 30 °C, data not shown). Thus, unexpectedly high growth rates at both 30 °C and 37 °C were observed for the clpP-htrA strain. Survival analyses showed a marked defect at 37 °C for all mutant strains: ~107 c.f.u. ml–1 were measured for the wt strain after 72 h versus ~106 c.f.u. ml–1 for the clpP-htrA and htrA-NZ9000 mutants and ~105 c.f.u. ml–1 for the clpP-NZ9000 mutant (Fig. 4bDown).


Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 4. Influence of clpP and htrA inactivation on growth (a) and survival (b) of L. lactis at 37 °C. Growth of the clpP-htrA strain (bullet) was monitored by OD600 measurements for 10 h at 37 °C and compared to that of the wt ({blacklozenge}), clpP-NZ9000 ({blacksquare}) and htrA-NZ9000 ({blacktriangleup}) strains. Viability was measured for all strains by estimating bacterial populations every 24 h for 3 days.

 
The results observed for growth and viability of the clpP-htrA double mutant strain suggest that in this strain, growth thermosensitivity and lethality are partially alleviated compared to both the clpP- and htrA-NZ9000 single mutant strains, suggesting the occurrence of a secondary suppressive mutation event.

We then evaluated the response of the clpP-htrA mutant to higher temperature, ethanol and oxidative stress conditions as described previously (Foucaud-Scheunemann & Poquet, 2003Down). We first tested temperature stress: briefly, overnight cultures were diluted 100-fold and after ~2 h, once OD600 0.10 was reached, a temperature shift from 30 °C to 39 °C was performed and growth was measured by OD600 for 10 h (Fig. 5aDown). After the temperature upshift, the wt strain grew to OD600 2 whereas the growth of the htrA-NZ9000 strain was rapidly arrested as previously described (Poquet et al., 2000Down; Foucaud-Scheunemann & Poquet, 2003Down). Unexpectedly, but in agreement with the growth characteristics at 37 °C, the clpP-NZ9000 strain grew better than htrA-NZ9000 (OD600 1.2), and the clpP-htrA strain even better (OD600 1.5) (Fig. 5aDown). Again, our data are in agreement with the presence of a secondary suppressor mutation.


Figure 5
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 5. Stress tolerance of the clpP-htrA strain. Growth of the clpP-htrA strain (bullet) at 39 °C (a) or in the presence of 5 % ethanol (b) was monitored by OD600 measurements for 10 h and compared to that of the wt ({blacklozenge}), clpP-NZ9000 ({blacksquare}) and htrA-NZ9000 ({blacktriangleup}) strains. Cultures were grown to OD600 0.10 and temperature shift or ethanol challenge was performed. Growth was monitored by OD600 measurements for 10 h.

 
We then evaluated the growth of the wt, clpP-htrA and clpP- and htrA-NZ9000 strains in the presence of 5 % (v/v) ethanol: growth of the wt and clpP-htrA remained unaffected, in contrast to clpP- and htrA-NZ9000, for which a significant reduction in growth was observed (Fig. 5bUp). Finally, we tested the effect of different concentrations (5, 10 and 15 mM) of hydrogen peroxide (data not shown): growth of all strains was affected to similar extent, as previously observed (Foucaud-Scheunemann & Poquet, 2003Down).

To explain our data, we propose that a secondary suppressor mutation occurred allowing improved growth of the double mutant strain; such an event might have been favoured during the temperature shift necessary to eliminate pGhost from the potential transconjugant candidates. It has previously been shown that in both wt and clpP mutant strains of L. lactis, trmA inactivation increased thermal stress tolerance and proteolysis of puromycyl peptides (the protease involved remained unknown, although different from FtsH or HtrA), without having any effect of oxidative stress tolerance, and TrmA was proposed to be a negative regulator of stress tolerance and proteolysis (Frees et al., 2001Down). Comparing the thermosensitive phenotype of our double mutant strain with a trmA-clpP mutant strain (kindly provided by Karin Hammer, Technical University of Denmark, DK-2800 Lyngby, Denmark) which is known to grow at normal rates in stress conditions (e.g. at 37 °C or in the presence of puromycin), we observed that our double mutant has a lower growth rate than the trmA-clpP mutant (data not shown). Alternatively, htrA suppressors might have arisen, as previously shown in Escherichia coli, where sohA and sohB are multi-copy suppressors of htrA (Baird & Georgopoulos, 1990Down; Baird et al., 1991Down).

Stable production of heterologous proteins in L. lactis clpP-htrA
To determine the capacities of the clpP-htrA strain to produce and secrete heterologous proteins, production of Nuc and Nuc-E7 was compared in wt, clpP-NZ9000, htrA-NZ9000 and clpP-htrA strains. For Nuc protein, Western blot analysis with anti-Nuc antibodies revealed two bands in the cell fractions of wt(pSEC:Nuc) and clpP-NZ9000(pSEC:Nuc) strains that correspond to Nuc precursor (preNuc, synthesized as a preproprotein: ~22 kDa) and to NucB protein (product of preNuc signal peptide maturation: ~19 kDa). Note that separation of preNuc and NucB bands could not be well achieved, perhaps due to the high concentration of SDS-PAGE (15 %) used to separate NucA from NucB. In the supernatant of these strains, a third form of Nuc was detected and it corresponds to NucA protein [product of a secondary cleavage of a 21 aa NucB propeptide: ~19 kDa (Le Loir et al., 1998Down) performed by HtrA in L. lactis (Poquet et al., 2000Down)] plus NucB protein (Fig. 6Down). In contrast, in htrA-NZ9000(pSEC:Nuc) and clpP-htrA(pSEC:Nuc) extracts, no NucA in supernatant fractions was observed, in agreement with the absence of HtrA protease (responsible for NucB-to-NucA processing) in these strains (Poquet et al., 2000Down). Interestingly, supernatant samples of strains htrA-NZ9000(pSEC:Nuc) and clpP-htrA(pSEC:Nuc) showed a slightly higher concentration of NucB as determined by comparison with the signals of known amounts of Nuc by quantitative scanning of blots after immunodetection (Image-Quant; Bermúdez-Humarán et al., 2002Down; data not shown). To confirm these observations, Nuc yields were determined by a Nuc activity test (see Methods). The results revealed that Nuc activity was significantly higher in htrA-NZ9000(pSEC:Nuc) and clpP-htrA(pSEC:Nuc) (94.4±9.9 µg ml–1 and 85.5±5.1 µg ml–1 respectively; means±SD, n=3), than in wt(pSEC:Nuc) and clpP-NZ9000(pSEC:Nuc) supernatants fractions (73±4.4 µg ml–1 and 62.9±7.3 µg ml–1, respectively), confirming higher Nuc secretion in our double mutant strain than in wt and clpP strains.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. Production and secretion of staphylococcal nuclease (Nuc) by the clpP-htrA strain: Western blot analysis of induced exponential-phase cultures (10 ng nisin ml–1) of wt, clpP-htrA, clpP-NZ9000 and htrA-NZ9000 strains containing pSEC:Nuc. Arrows indicate the positions of NucB, NucA and precursor form. C, cell lysates; S, supernatant fraction.

 
In the case of Nuc-E7, Western blot analysis with anti-E7 antibodies revealed three bands in the cell fractions of the wt(pSEC:Nuc-E7) strain that correspond to: (i) Nuc-E7 precursor (preNuc-E7); (ii) Nuc-E7 mature form; and (iii) a putative product resulting from secondary proteolytic cleavage of Nuc-E7 as previously observed (Bermúdez-Humarán et al., 2002Down, 2003bDown). In the supernatant, one major band corresponding to the secreted Nuc-E7 fusion was observed (Fig. 7Down). In the cell fractions of the clpP-NZ9000(pSEC:Nuc-E7) strain, preNuc-E7 and Nuc-E7 forms were detected. Surprisingly, no Nuc-E7 signal was observed in the supernatant, suggesting that secretion of this protein in a single clpP mutant cannot be achieved. This observation could be explained by the lower metabolism of the clpP mutant once induced with nisin. Indeed, in the induced L. lactis cultures for the preparation of proteins, the OD600 reached by the clpP mutant was ~15-fold lower than other strains, suggesting significant decreases both of growth rate and of protein synthesis. We can conclude that the clpP strain is not a good candidate for heterologous protein production with the NICE system. In the cell fractions of htrA-NZ9000(pSEC:Nuc-E7) and clpP-htrA(pSEC:Nuc-E7) strains, Western blotting revealed the same three bands observed in the wt strain (Fig. 7Down). Strikingly, the amounts of Nuc-E7 in the supernatant fractions of these two strains were about threefold higher in htrA-NZ9000(pSEC:Nuc-E7) and clpP-htrA(pSEC:Nuc-E7) strains compared to the wt(pSEC:Nuc-E7) strain.


Figure 7
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7. Production and secretion of the human papillomavirus E7 protein fused to Nuc (Nuc-E7) by the clpP-htrA strain: Western blot analysis of induced exponential-phase cultures (10 ng ng nisin ml–1) of wt, clpP-htrA, clpP-NZ9000 and htrA-NZ9000 strains containing pSEC:Nuc-E7. Arrows indicate positions of Nuc-E7 and precursor form as well as a putative product resulting from secondary proteolytic cleavage. C, cell lysates; S, supernatant fraction.

 
Altogether, these results revealed that htrA-NZ9000 and clpP-htrA strains could be better hosts for stable production and secretion of heterologous proteins than wt and clpP-NZ9000 strains. Indeed, we previously reported that htrA inactivation in L. lactis allows high-level production of heterologous proteins. However, thermosensitivity of the htrA-NZ9000 mutant limits its use to overproduce heterologous proteins. Strikingly, the clpP-htrA strain has better resistance to both temperature and ethanol stresses than the htrA-NZ9000 and even the clpP-NZ9000 strain. This feature makes the clpP-htrA strain a more suitable vector for heterologous protein production and delivery in foodstuffs or in the digestive tract. Furthermore, as the study of new protein degradation pathways generally requires the inactivation of known proteases, the clpP-htrA strain described in this work could be a good tool for the identification of new proteolytic enzymes.


    ACKNOWLEDGEMENTS
 
L. G. Bermúdez-Humarán is a recipient of a first grant from INRA and Région Ile-de-France and then of a second grant from Association pour la Recherche sur le Cancer (ARC). N. G. Cortes-Perez is a recipient of a grant from INRA and Région Ile-de-France. M. Oliveira is a recipient of a France-Brazil CAPES-Cofecub grant. We thank Claude Gaillardin and Xavier Leverve for their efficient support.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Baird, L. & Georgopoulos, C. (1990). Identification, cloning, and characterization of the Escherichia coli sohA gene, a suppressor of the HtrA (DegP) null phenotype. J Bacteriol 172, 1587–1594.[Abstract/Free Full Text]

Baird, L., Lipinska, B., Raina, S. & Georgopoulos, C. (1991). Identification of the Escherichia coli sohB gene, a multicopy suppressor of the HtrA (DegP) null phenotype. J Bacteriol 173, 5763–5770.[Abstract/Free Full Text]

Bermúdez-Humarán, L. G., Langella, P., Miyoshi, A., Gruss, A., Guerra, R. T., Montes de Oca-Luna, R. & Le Loir, Y. (2002). Production of human papillomavirus type 16 E7 protein in Lactococcus lactis. Appl Environ Microbiol 68, 917–922.[Abstract/Free Full Text]

Bermúdez-Humarán, L. G., Langella, P., Commissaire, J., Gilbert, S., Le Loir, Y., L'Haridon, R. & Corthier, G. (2003a). Controlled intra or extracellular production of staphylococcal nuclease and ovine omega interferon in Lactococcus lactis. FEMS Microbiol Lett 224, 307–313.[CrossRef][Medline]

Bermúdez-Humarán, L. G., Cortes-Perez, N. G., Le Loir, Y., Gruss, A., Rodriguez-Padilla, C., Saucedo-Cardenas, O., Langella, P., Montes de Oca-Luna, R. (2003b). Fusion to a carrier protein and a synthetic propeptide enhances E7 HPV-16 production and secretion in Lactococcus lactis. Biotechnol Prog 19, 1101–1104.[CrossRef][Medline]

Delorme, C., Godon, J. J., Ehrlich, S. D. & Renault, P. (1993). Gene inactivation in Lactococcus lactis: histidine biosynthesis. J Bacteriol 175, 4391–4399.[Abstract/Free Full Text]

Foucaud-Scheunemann, C. & Poquet, I. (2003). HtrA is a key factor in the response to specific stress conditions in Lactococcus lactis. FEMS Microbiol Lett 224, 53–59.[CrossRef][Medline]

Frees, D. & Ingmer, H. (1999). ClpP participates in the degradation of misfolded protein in Lactococcus lactis. Mol Microbiol 31, 79–87.[CrossRef][Medline]

Frees, D., Varmanen, P. & Ingmer, H. (2001). Inactivation of a gene that is highly conserved in Gram-positive bacteria stimulates degradation of non-native proteins and concomitantly increases stress tolerance in Lactococcus lactis. Mol Microbiol 41, 93–103.[CrossRef][Medline]

Gasson, M. J. (1983). Plasmid complements of Streptococcus lactis NCDO 712 and other lactic acid streptococci after protoplast-induced curing. J Bacteriol 154, 1–9.[Abstract/Free Full Text]

Heins, J., Suniano, J., Taniuchi, H. & Anfinsen, C. (1967). Characterization of a nuclease produced by Staphylococcus aureus. J Biol Chem 242, 1016–1020.[Abstract/Free Full Text]

Kuipers, O. P., de Ruyter, P. J., Kleerebezem, M. & de Vos, W. M. (1998). Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64, 15–21.

Langella, P. & Chopin, A. (1989). Conjugal transfer of plasmid pIP501 from Lactococcus lactis to Lactobacillus delbruckii subsp. bulgaricus and Lactobacillus helveticus. FEMS Microbiol Lett 51, 149–152.[CrossRef][Medline]

Langella, P., Le Loir, Y., Ehrlich, S. D. & Gruss, A. (1993). Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis. J Bacteriol 175, 5806–5813.[Abstract/Free Full Text]

Le Loir, Y., Gruss, A., Ehrlich, S. D. & Langella, P. (1998). A nine-residue synthetic propeptide enhances secretion efficiency of heterologous proteins in Lactococcus lactis. J Bacteriol 180, 1895–1903.[Abstract/Free Full Text]

Le Loir, Y., Azevedo, V., Oliveira, S. C. & 12 other authors (2005). Protein secretion in Lactococcus lactis: an efficient way to increase the overall heterologous protein production. Microb Cell Fact 4, 2.[CrossRef][Medline]

Madsen, S. M., Albrechtsen, B., Hansen, E. B. & Israelsen, H. (1996). Cloning and transcriptional analysis of two threonine biosynthetic genes from Lactococcus lactis MG1614. J Bacteriol 178, 3689–3694.[Abstract/Free Full Text]

Maguin, E., Duwat, P., Hege, T., Ehrlich, D. & Gruss, A. (1992). New thermosensitive plasmid for gram-positive bacteria. J Bacteriol 174, 5633–5638.[Abstract/Free Full Text]

Miyoshi, A., Poquet, I., Azevedo, V. & 7 other authors (2002). Controlled production of stable heterologous proteins in Lactococcus lactis. Appl Environ Microbiol 68, 3141–3146.[Abstract/Free Full Text]

Poquet, I., Saint, V., Seznec, E., Simoes, N., Bolotin, A. & Gruss, A. (2000). HtrA is the unique surface housekeeping protease in Lactococcus lactis and is required for natural protein processing. Mol Microbiol 35, 1042–1051.[CrossRef][Medline]

Rigoulay, C., Poquet, I., Madsen, S. M. & Gruss, A. (2004). Expression of the Staphylococcus aureus surface proteins HtrA1 and HtrA2 in Lactococcus lactis. FEMS Microbiol Lett 237, 279–288.[Medline]

van Asseldonk, M., Rutten, G., Oteman, M., Siezen, R. J., de Vos, W. M. & Simons, G. (1990). Cloning of usp45, a gene encoding a secreted protein from Lactococcus lactis subsp. lactis MG1363. Gene 95, 155–160.[CrossRef][Medline]

Received 18 November 2005; revised 10 April 2006; accepted 28 April 2006.


This article has been cited by other articles:


Home page
Appl. Environ. Microbiol.Home page
Y. P. Tan, P. M. Giffard, D. G. Barry, W. M. Huston, and M. S. Turner
Random Mutagenesis Identifies Novel Genes Involved in the Secretion of Antimicrobial, Cell Wall-Lytic Enzymes by Lactococcus lactis
Appl. Envir. Microbiol., December 15, 2008; 74(24): 7490 - 7496.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
K. Sriraman and G. Jayaraman
HtrA Is Essential for Efficient Secretion of Recombinant Proteins by Lactococcus lactis
Appl. Envir. Microbiol., December 1, 2008; 74(23): 7442 - 7446.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. Sanchez, J. Borrero, B. Gomez-Sala, A. Basanta, C. Herranz, L. M. Cintas, and P. E. Hernandez
Cloning and Heterologous Production of Hiracin JM79, a Sec-Dependent Bacteriocin Produced by Enterococcus hirae DCH5, in Lactic Acid Bacteria and Pichia pastoris
Appl. Envir. Microbiol., April 15, 2008; 74(8): 2471 - 2479.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
Y. Redko, P. Courtin, C. Mezange, C. Huard, and M.-P. Chapot-Chartier
Lactococcus lactis Gene yjgB Encodes a {gamma}-D-Glutaminyl-L-Lysyl- Endopeptidase Which Hydrolyzes Peptidoglycan
Appl. Envir. Microbiol., September 15, 2007; 73(18): 5825 - 5831.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cortes-Perez, N. G.
Right arrow Articles by Bermúdez-Humarán, L. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cortes-Perez, N. G.
Right arrow Articles by Bermúdez-Humarán, L. G.
Agricola
Right arrow Articles by Cortes-Perez, N. G.
Right arrow Articles by Bermúdez-Humarán, L. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2006 Society for General Microbiology.