| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Department of Biology, Yonsei University, Seoul 120-749, Korea
2 Laboratory of Biochemistry, Konkuk College of Medicine, Chungju 380-701, Korea
Correspondence
Young M. Kim
young547{at}yonsei.ac.kr
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
78 kDa, which cross-reacted with anti-DHAS antiserum and exhibited DHAS activity. Primer-extension analysis revealed that the transcriptional start site of the gene was the nucleotide A located 31 bp upstream from the dasS start codon. RT-PCR showed that dasS was transcribed as a monocistronic message. Northern hybridization and β-galactosidase assay with the putative promoter region of dasS revealed that the gene was transcribed only in cells growing on methanol. The expression of dasS in Mycobacterium sp. strain JC1 was free from catabolite repression.
Present address: Cell Biotech Company, 134 Gaegok-ri, Wolgot-myun, Gimpo, Gyunggi 415-871, Korea.
The GenBank/EMBL/DDBJ accession number for the dasS sequence of Mycobacterium sp. strain JC1 is AY007261.
A figure showing the expression of dasS in E. coli is available as supplementary data with the online version of this paper.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
; de Koning & Harder, 1992; Dijkhuizen et al., 1992; Fig. 1).
|
) is able to grow aerobically not only on carbon monoxide but also on methanol as sole carbon and energy sources (Ro et al., 1997b). Grown on methanol the bacterium exhibits neither hexulose-6-phosphate synthase nor hydroxypyruvate reductase activity, but contains ribulose bisphosphate carboxylase and dihydroxyacetone synthase (DHAS) activities, indicating that the bacterium employs a novel method of C1 assimilation (Park et al., 2003; Ro et al., 1997a, b); i.e. the Calvin cycle and the eukaryote-specific XuMP pathway, instead of the prokaryote-specific RuMP and serine pathways, function in Mycobacterium sp. strain JC1 growing on methanol (Fig. 1
). The assimilation of C1 metabolites in Mycobacterium sp. strain JC1 has been found to begin with the XuMP pathway, followed by both the XuMP pathway and the Calvin cycle (Ro et al., 1997a).
DHAS (EC 2.2.1.3) is the key enzyme responsible for formaldehyde fixation in methylotrophic organisms adapting to the XuMP pathway during growth on methanol as a sole source of carbon and energy (Anthony, 1982; de Koning & Harder, 1992; Dijkhuizen et al., 1992). The enzyme has been regarded as a special transketolase (TKT) because it is able to catalyse the transfer of glycoaldehyde from the donor xylulose 5-phosphate to the acceptor formaldehyde, the first intermediate produced during methanol oxidation (Fig. 1), to form dihydroxyacetone and glyceraldehyde 3-phosphate (Kato et al., 1979; O'Connor & Quayle, 1980; Waites & Quayle, 1980, 1981). DHAS also has properties different from those of the classical TKT in several aspects: it is unstable (Bystrykh et al., 1981; Waites & Quayle, 1980), it is present only in cells grown on methanol (Kato et al., 1979; O'Connor & Quayle, 1980; Waites & Quayle, 1980), and it is active toward a wide range of aldehydes (Kato et al., 1982).
The DHAS from Mycobacterium sp. strain JC1 is composed of two identical subunits of molecular mass 73 kDa, and is present only in cells grown on methanol, as in the case of methylotrophic yeasts, although it shares no immunological properties with the yeast DHAS (Ro et al., 1997a). These results, together with the finding that DHAS proteins are also present in several other methanol-grown mycobacteria (Park et al., 2003), suggest that a mycobacterial group, including Mycobacterium sp. strain JC1, is an evolutionary bridge for C1-compound assimilation between the prokaryotic and eukaryotic methylotrophs.
In this study, we cloned and characterized the gene for DHAS (dasS) of Mycobacterium sp. strain JC1 to investigate the diversity and evolutionary relationships among the prokaryotic and eukaryotic DHASs, and also to elucidate the basic transcriptional characteristics of the Mycobacterium sp. strain JC1 dasS gene.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
. Mycobacterium sp. strain JC1 DSM 3803 (Song et al., 2002) was grown at 30 °C in standard mineral base (SMB) medium supplemented with 0.5 % (v/v) methanol, 0.5 % (w/v) pyruvate, 0.8 % (w/v) nutrient broth, or a gas mixture of 30 % CO/70 % air, as described previously (Ro et al., 1997b). To test the effect of other substrates on the expression of the DHAS gene, the bacterium was cultivated in SMB medium supplemented with 0.5 % (v/v) methanol in the presence of 0.5 % (w/v) pyruvate or 0.8 % (w/v) nutrient broth. Escherichia coli strains were grown at 37 °C in Luria–Bertani medium. Growth was measured with a spectrophotometer by determination of turbidity at 436 nm.
|
. Plasmid DNAs were isolated from E. coli by the alkaline lysis method described by Sambrook et al. (1989). Electrotransformation of E. coli was performed with a Gene Pulser apparatus (Bio-Rad). Competent cells were prepared as described by Dower et al. (1988). Phage lysate preparation and phage DNA isolation were carried out as described by the manufacturer (Promega, 1995).
PCR.
Two synthetic primers, FWD and REV, were synthesized to amplify the region covering the dasS gene of Mycobacterium sp. strain JC1, based on the amino acid sequences conserved in several TKTs and DHASs. Primer FWD was a 32-fold degenerate 20-mer (5'-ccgaattcGCCAARTCSGGYCAYCCRGG-3'), with an 8-mer extension that included an EcoRI site (underlined lower-case type), derived from a consensus amino acid sequence AKSGHPG that is present near the N termini of the DHASs of Hansenula polymorpha (34 YGGGHPG 40; Janowicz et al., 1985) and Candida boidinii (32 YEGGHPG 38; GenBank accession no. AAC83349), and the TKTs of Ralstonia eutropha (28 AKSGHPG 34; Schäferjohann et al., 1993), Rhodobacter sphaeroides (27 AKSGHPG 33; Chen et al., 1991), E. coli (22 AKSGHPG 28; GenBank accession no. CAA48166) and Saccharomyces cerevisiae (26 ANSGHPG 32; Fletcher et al., 1992). Primer REV was a 16-fold degenerate 21-mer (5'-aaggatccCTGWCCSAGCGGKCCGGTSGT-3'), with an 8-mer extension that included a BamHI site (underlined lower-case type), based on the identical amino acid sequence TTGPLGQ, which is found in the N-terminal regions of DHASs in H. polymorpha (126–132; Janowicz et al., 1985) and C. boidinii (124–130; GenBank accession no. AAC83349), and those of TKTs in Ral. eutropha (113–119; Schäferjohann et al., 1993), R. sphaeroides (118–124; Chen et al., 1991), E. coli (113–119; GenBank accession no. CAA48166) and S. cerevisiae (114–120; Fletcher et al., 1992). The PCR mixture contained 200 µM of each dNTP, 20 pmol of each primer, 100 ng template DNA and 0.5 U Taq polymerase in 10 µl reaction buffer (50 mM Tris-HCl, pH 8.3, 250 µg BSA ml–1, 1 %, w/v, Ficoll, 1.5 mM MgCl2). Amplification was carried out in a Fast Air Thermal Capillary Cycler (Daehan Medical Systems) as follows: after primary denaturation for 40 s at 94 °C, 30 cycles each of denaturation for 10 s at 94 °C, annealing for 10 s at 62 °C and elongation for 30 s at 72 °C were performed, and then post-elongation was carried out for 60 s at 72 °C. The PCR products digested with EcoRI and BamHI were eluted from the agarose gel after electrophoresis, purified with the QIAquick gel extraction kit (Qiagen), and cloned into pBluescript II KS+ for sequencing or used as templates to synthesize random-primed probes labelled with [
-32P]dCTP for Southern blotting and plaque hybridization.
Southern hybridization.
DNAs digested with restriction enzymes were subjected to electrophoresis and then transferred to Hybond-N+ membranes (Amersham) by capillary blotting. Hybridization and washing were carried out at 68 °C, as recommended by the manufacturer. Detection of positive bands or plaques was performed according to the methods described by Sambrook et al. (1989).
Cloning and DNA sequencing.
The Mycobacterium sp. strain JC1 DNA partially digested with Sau3AI was ligated to lambda EMBL3 DNA, packaged by using Gigapack III Packaging Extracts (Stratagene), and transduced into E. coli XL1-Blue MRA (P2) cells following the manufacturer's instructions. Plaque replicas were screened with the labelled random-primed probes.
DNA fragments in subclones and nested deletion clones were sequenced by the dideoxy chain-termination method (Sanger et al., 1977) using a T7 Sequenase DNA sequencing kit (version 2.0, Amersham). DNA and deduced amino acid sequences were analysed using DNASIS and PROSIS programs (version 7.00, Hitachi Software Engineering), respectively. The BLAST program was used to search the protein sequence database at the National Center for Biotechnology Information.
RNA isolation.
A 50 ml culture of cells was harvested at the mid-exponential growth phase, washed once with 10 ml of 40 mM Tris-HCl buffer, pH 7.5, and resuspended in 1 ml TRIzol reagent (Invitrogen). Cells in the suspension were then disrupted by agitation four times at maximum speed for 45 s using a FastPrep 120 instrument (Qbiogene). RNAs in the cell lysate were isolated using TRIzol reagent according to the manufacturer's instructions, dried at room temperature, and dissolved in 100 µl nuclease-free water (Promega). The Qiagen RNeasy kit with a DNase I (Promega) digestion step was used to clean up the RNA preparation according to the manufacturer's protocol.
Northern blot analysis and primer extension.
For Northern blot analysis, total RNAs were separated by formaldehyde agarose gel electrophoresis and visualized by ethidium bromide staining (Sambrook et al., 1989). RNAs were then transferred to Hybond-N+ nylon membranes by vacuum blotter, cross-linked by UV irradiation as recommended by the manufacturer, and hybridized with random-primed probes synthesized by using a 1.28 kb SmaI fragment of pSKB7 as template.
A primer-extension experiment was performed with the avian myoblastosis virus reverse transcriptase primer extension system (Promega) and a 30-mer oligonucleotide primer, 5'-CGAATTGGGCTCGGCAAGGATCGCATCTGC-3', which is complementary to nucleotide positions 50–79 bp downstream of the dasS start codon, according to the method of Sambrook et al. (1989).
RT-PCR.
Four synthetic primers, DasSF, DasSR, TalF and TalR, were synthesized to elucidate the transcription unit of the dasS gene by RT-PCR. DasSF and TalF were a 22-mer (5'-GCTTCGACCCCGCTAAGTCCTT-3') and a 20-mer (5'-CCACCCCCACCGTACAACTT-3'), respectively, which correspond to the nucleotide positions 956–977 bp and 8–27 bp downstream of the dasS and the putative tal gene start codons, respectively. DasSR (5'-GAAAGCTGTTCCACGGGCTG-3') and TalR (5'-CGATCGGGGCGAACAGATCA-3') were 20-mers that are complementary to nucleotides 1564–1583 bp and 270–289 bp downstream of the dasS and the putative tal start codons, respectively. The reaction mixture (10 µl) for reverse transcription contained 5 µg RNA, 50 pmol DasSR or TalR, 1 µl each of 2.5 mM dNTP, 1 µl of 0.1 M DTT and 200 U SuperScript II reverse transcriptase (RT; Invitrogen) in First-Strand buffer (Invitrogen). After incubation of the pre-hybridization mix (RNA and primer) for 5 min at 65 °C, all other components were added. Reverse transcription was carried out for 30 min at 42 °C. As no-RT controls, reactions were set up with all ingredients except the RT. The resulting cDNA that covers a part of dasS only (cDNA-DasSR), and the cDNA that possibly contains the whole dasS gene together with part of the putative tal gene (cDNA-TalR) that is transcribed in the same direction immediately downstream of the dasS gene, were directly used for PCR. The PCR mixture contained 200 µM of each dNTP, 20 pmol each of appropriate primers, 1 µl cDNA-DasSR or cDNA-TalR and 0.5 U Taq polymerase in 50 µl reaction buffer (50 mM Tris-HCl, pH 8.3, 250 µg BSA ml–1, 1 %, w/v, Ficoll, 1.5 mM MgCl2). Amplification was carried out in a Mastercycler gradient (Eppendorf) as follows: after primary denaturation for 7 min at 95 °C, 30 cycles each of denaturation for 30 s at 95 °C, annealing for 30 s at 60 °C and elongation for 1 min at 72 °C were performed, and then post-elongation was carried out for 5 min at 72 °C.
Overproduction of the DHAS gene in E. coli.
Based on the deduced amino acid sequence of DHAS, oligonucleotide primers corresponding to the amino acid sequences of the N (5'-ggaattccatATGCGGCCGCCAGAGG-3') and C termini (5'-ccgctcgagTTAGTTGCCTGCCGC-3') with additional NdeI and XhoI sites (underlined) at the 5' ends of N and C termini, respectively, were synthesized to achieve successful cloning of PCR products into the expression vector. The PCR mixture contained 250 µM of each deoxynucleoside triphosphate, 20 pmol of each primer, 100 ng pSKB7 and 2.5 U Taq polymerase in 100 µl reaction buffer. Amplification was performed in a thermal cycler (model 480, Perkin-Elmer) as follows: after initial denaturation at 94 °C for 15 min, 30 cycles each of denaturation at 94 °C for 1 min, annealing at 65 °C for 2 min and elongation at 72 °C for 1 min were carried out, and then post-elongation was performed at 72 °C for 20 min. The amplified products were digested with NdeI and XhoI and cloned into pET-22b(+) (Novagen) to produce a subclone pED18. pED18 harbouring a complete 2193 bp dasS gene was subsequently introduced into E. coli BL21(DE3) pLysS and induced for DHAS by 1 mM IPTG.
Determination of the internal amino acid sequence of DHAS.
DHAS was purified as described previously (Ro et al., 1997a). The enzyme preparation containing 200 µg DHAS was concentrated with a Centricon-10 (Bio-Rad) and left for 30 min at 37 °C. The concentrate was then treated with TCA to a final concentration of 10 % (w/v), left for 30 min at room temperature, and sedimented at 13 000 g for 15 min. The resulting pellet was dissolved in 100 µl 1x SDS sample buffer (Laemmli, 1970) and treated with 2 µl of 2 M NaOH to adjust the pH to 7.8. The polypeptide fragments were then subjected to denaturing PAGE at a constant 80 V and electroblotted onto a PVDF membrane (Schleicher & Schuell). After brief staining and destaining, a deeply stained peptide band was selected and analysed for amino acid sequence by the method of Edman & Begg (1967) with a protein sequencer (Milligen 600B).
Construction of reporter plasmid and transformation.
To amplify the putative dasS gene promoter region covering a direct repeat (GTCAGAACCGTCAGAA) present at 59–44 bp upstream of the dasS transcription start site, two synthetic primers, with a 10-mer extension that included an XbaI site (underlined lower-case type), designated dSF (5'-gctctagagcTGATTGATGGTTCCGCTCATT-3') and dSR (5'-gctctagagcCCTCGGTTGTCCAGTTCAACA-3'), which corresponded to the nucleotides 128–108 bp upstream and 123–143 bp downstream of the dasS transcription start site, respectively, were synthesized. The PCR mixture contained 200 µM of each dNTP, 20 pmol of each primer, 1 µg template DNA and 1 U iMax Taq polymerase in 20 µl reaction buffer (Intron). Amplification was carried out in a Mastercycler gradient (Eppendorf) as follows: after primary denaturation for 300 s at 95 °C, 30 cycles each of denaturation for 60 s at 95 °C, annealing for 90 s at 60 °C and elongation for 30 s at 72 °C were performed, and then post-elongation was carried out for 300 s at 72 °C. The 271 bp PCR products were eluted from the agarose gel after electrophoresis, purified with the QIAquick gel extraction kit, and cloned into the XbaI site of a promoterless vector pDAS1 to create a translational fusion to the lacZ gene, resulting in a reporter plasmid pDAS2. The stable mycobacterial promoter-probing vector pDAS1 was made by incorporation of the blunted NotI–NheI fragment of pCV77 (MediImmune) containing a promoterless lacZ gene into pNBV1 (Nathan et al., 1995) digested with PvuII.
The vectors were introduced into Mycobacterium sp. strain JC1 by electroporation with a Gene Pulser apparatus (Bio-Rad) at 2.5 kV, 800 
and 25 µF.
Enzyme assay.
DHAS activity was assayed at 30 °C by a modification (Ro et al., 1997a) of the method of Kato et al. (1982) using xylulose 5-phosphate, -glycerophosphate dehydrogenase, triosephosphate isomerase, and cell-free extracts or partially purified DHAS. Cell-free extracts and partially purified DHAS expressed in E. coli transformants were prepared according to the method of Ro et al. (1997a). One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 µmol NADH min–1. Protein content was determined by the method of Lowry et al. (1951), using BSA as a standard.
β-Galactosidase assays were performed as described elsewhere (Miller, 1972). Transformants carrying pDAS1 and pDAS2 were grown at 37 °C in 0.8 % (w/v) nutrient broth and SMB medium supplemented with 0.5 % (v/v) methanol or a gas mixture of 30 % CO/70 % air. Cells were harvested at the late-exponential growth phase, washed once with 0.05 M phosphate buffer, pH 7.0, and resuspended in the same buffer. Cells in the suspension were then disrupted by sonic treatment, centrifuged at 15 000 g for 30 min, and the resulting supernatant was used for the assay. Activity was expressed as Miller units per microgram total cell protein.
Electrophoresis.
Denaturing PAGE was carried out following the method of Laemmli (1970), with several modifications described by Kim et al. (1989). Proteins were stained with Coomassie Brilliant Blue (CBB) R-250 by a modification (Kim & Hegeman, 1981) of the method of Weber & Osborn (1969).
Immunoblotting.
Immunoblot analysis was performed with an anti-DHAS antiserum (Ro et al., 1997a) following the ECL (enhanced chemiluminescence) Western blot protocols (Amersham) after transfer of proteins in the denaturing gel to a nitrocellulose membrane (Hybond-ECL, Amersham).
|
RESULTS AND DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Using the two primers, a 0.3 kb DNA fragment was amplified by PCR with Mycobacterium sp. strain JC1 genomic DNA as a template (data not shown). The DNA fragment was sequenced after cloning into pBluescript II KS+ and found to be highly homologous to the sequences in part of the 5'-end regions of DHAS and TKT genes in several yeasts and bacteria (data not shown). Southern hybridization of Mycobacterium sp. strain JC1 genomic DNA with random-primed probes synthesized based on the PCR product revealed that the probes hybridized to one each of BamHI (3.7 kb), EcoRI (>20 kb), PstI (5.6 kb), SacI (7.2 kb) and SalI (4.3 kb) fragments (data not shown).
Two positive clones containing the 3.7 kb BamHI fragment were obtained by plaque hybridization of the lambda library with the random-primed probes. Among the positive clones, lambda 603, which contains an 18 kb insert DNA, was selected for restriction mapping. Based on the restriction map of the 18 kb insert (Fig. 2), a subclone pSKB7 was constructed in pBluescript KS+ for sequence analysis using the 3.7 kb BamHI fragment, which hybridized with the random-primed probes.
|
) and C. boidinii (706 aa; Sakai et al., 1998) DHASs, was considered as a representative ORF (rORF). Among several other potential start codons for ORFs sharing the rORF reading frame, close to the rGTG were an ATG (12u-ATG) and two GTGs (38u-GTG and 40u-GTG) located 12, 38 and 40 amino acids upstream of the rGTG, respectively, and a GTG (52d-GTG) and an ATG (64d-ATG) residing 52 and 64 amino acids downstream of the rGTG, respectively. The deduced amino acid sequence of 64d-ATG ORF is devoid of a conserved critical amino acid H60, which is required for proton transfer during catalysis (Janowicz et al., 1985; Sakai et al., 1998). A potential Shine–Dalgarno (SD) sequence (AGAAG) was present 6 bp upstream of the rGTG. Another potential SD sequence GGA was also identified 2 and 4 nt upstream of the potential start codons 38u-GTG and 52d-GTG, respectively. No SD sequence was found in the 10 bp upstream of the 12u-ATG, 40u-GTG and 64d-ATG potential start codons.
Based on the number of residues and the presence or absence of potential SD sequences and the H60 amino acid, the rORF starting with rGTG was selected as a strong candidate for the dasS gene in Mycobacterium sp. strain JC1. The dasS candidate consisted of 2193 bp and encoded a protein with a calculated molecular mass of 78 197 Da and a pI of 5.42. A part of the amino acid sequence (533 AIPGLDVVGPGDANQVGIAW 552) deduced from the nucleotide sequence of the ORF matched completely with the N-terminal amino acid sequence of an internal peptide fragment of purified DHAS protein. This, together with the calculated molecular mass of a protein encoded by the cloned gene and the estimated molecular mass of a subunit of the purified enzyme (73 kDa; Ro et al., 1997a), suggests that the cloned gene is the structural gene for DHAS.
Further analysis of the downstream region also identified an incomplete putative reading frame. The frame consists of 275 amino acids with 63.5 % identity to the amino acid sequence of the N-terminal region of a Mycobacterium tuberculosis transaldolase (GenBank accession no. AL123456), and starts with the ATG located 103 bp downstream of the dasS stop codon TAA.
Identification of the rORF as dasS
Western blot analysis revealed that a protein with a molecular mass of 78 kDa was produced in E. coli harbouring pED18 induced by IPTG and cross-reacted with antiserum raised against purified DHAS (Supplementary Fig. S1), indicating that the cloned 2193 bp dasS candidate is the DHAS structural gene dasS.
Crude cell-free extracts prepared from the IPTG-induced cells of E. coli harbouring pED18 showed no measurable DHAS activity [<0.001 µmol NADH oxidized min–1 (mg protein)–1)]. Enzyme activity was, however, detected from partially purified enzyme preparations such as the eluates obtained after phenyl-Sepharose [0.013 µmol NADH oxidized min–1 (mg protein)–1] and DEAE–Sephacel [0.02 µmol NADH oxidized min–1 (mg protein)–1] ion-exchange chromatography, further supporting the assumption that the cloned dasS candidate is dasS. Cell-free extracts prepared from Mycobacterium sp. strain JC1 grown on methanol used as a control oxidized 0.02 µmol NADH min–1 (mg protein)–1.
Characteristics of the dasS candidate
The average G+C ratio of the dasS candidate was 67 %. Codon usage analysis showed a strong codon bias for Gs and Cs in the third position; i.e. 56 out of 61 codons used were Gs and Cs. The amino acid sequence deduced from the nucleotide sequence of the dasS candidate was 29.2 and 27.3 % identical to those of C. boidinii (Sakai et al., 1998) and H. polymorpha (Janowicz et al., 1985), respectively, which is in good agreement with an observation that Mycobacterium sp. strain JC1 DHAS shares no antigenic epitopes with the C. boidinii enzyme (Ro et al., 1997a). The amino acid sequences deduced from the nucleotide sequences of the 12u-ATP and 52d-GTG ORFs were 28.7 and 27.4 % and 29.6 and 27.9 % identical to those of C. boidinii (Sakai et al., 1998) and H. polymorpha (Janowicz et al., 1985), respectively. The identity in the amino acid sequences of DHAS between H. polymorpha and C. boidinii is 69.1 %, which is much higher than those between Mycobacterium sp. strain JC1 and the two yeasts. These results confirm the previous observations that the Mycobacterium sp. strain JC1 DHAS has antigenic groups in common with the DHASs of other mycobacteria but not with those of yeast (Park et al., 2003; Ro et al., 1997a), further supporting the previous notion that the gene for DHAS evolved independently in different evolutionary lines or at a very early time before divergence occurred, or that genetic exchange by wide-ranging mechanisms dispersed the common ancestral dasS gene to many different groups of methanol-utilizing organisms at some remote time. The results also suggest that the ability to assimilate methanol through the XuMP pathway in mycobacteria may have been acquired primarily by conservative independent evolution of an ancestral mycobacterium.
Analysis of aligned sequences of the deduced amino acid sequence of the Mycobacterium sp. strain JC1 dasS candidate, two yeast DHASs (Janowicz et al., 1985; Sakai et al., 1998) and an M. tuberculosis TKT (GenBank accession no. AL123456) confirmed that the protein encoded by the rORF is a type of TKT; it has been suggested before that DHAS is a special TKT that acts on xylulose 5-phosphate and formaldehyde (Kato et al., 1979; O'Connor & Quayle, 1980; Ro et al., 1997a; Waites & Quayle, 1980, 1981), and is expressed only in cells grown on methanol (Kato et al., 1979; O'Connor & Quayle, 1980; Ro et al., 1997a; Waites & Quayle, 1980). The primary structure of the Mycobacterium sp. strain JC1 DHAS candidate had residues relatively well conserved among the TKT family, such as those for thiamine pyrophosphate (TPP) binding [H100, G148, L150, G198, E202, D220, I226, H303, D420s, L421s, E460s, F483s, F486s, Y489s and H522s; the superscript ‘s’ indicates a residue from the second subunit (Hawkins et al., 1989; Kato et al., 1979; Robinson & Chun, 1993; Wang et al., 1997)]. Residues for divalent cation binding (D192, N222 and I224), for proton transfer during catalysis (H60, H134 and H522) and for subunit dimerization (P135, G516, E517, G519 and S700) were also conserved (Hawkins et al., 1989; Lindqvist et al., 1992; Sundström et al., 1993; Robinson & Chun, 1993; Wang et al., 1997). The residues for substrate binding (R125, E517 and D518) were identical or conservatively exchanged (Reizer et al., 1993; Schäferjohann et al., 1993).
Transcription of the dasS candidate
Primer extension placed the transcriptional start site of the dasS gene candidate at the A nucleotide located 31 bp upstream of the dasS start codon (Fig. 3). No additional bands outside the band corresponding to the A nucleotide were found on the gel. RT-PCR using the primer DasSR for cDNA-DasSR synthesis, and DasSR and DasSF for PCR with cDNA-DasSR as template, produced a 0.6 kb product (Fig. 4, lane 4) that is almost identical in size to the PCR product (628 bp) estimated from the nucleotide sequence. PCR using the primers TalR and TalF and the template cDNA-TalR obtained after reverse transcription with TalR also amplified a 0.3 kb fragment (Fig. 4, lane 6), which is close to the calculated size of the expected PCR product (282 bp). PCR with the primers TalR and DasSF and cDNA-TalR as template, however, produced no products (Fig. 4, lane 5). These results indicate that the dasS gene of Mycobacterium sp. strain JC1 is transcribed as a monocistronic message.
|
|
), were found upstream of the dasS transcriptional start site. A directly repeated sequence (underlined), GTCAGAACCGTCAGAA, which has been suggested to bind a transcriptional regulator (Ni & Westpheling, 1997), was also identified 59–44 bp upstream of the transcription start site. No repeated sequence was identified in the 150 bp upstream of the ORFs starting with 38u-GTG, 40u-GTG, 52d-GTG and 64d-ATG. These results, together with the number of amino acid residues and the presence or absence of SD sequence and H60, strongly support the supposition that the dasS candidate (rORF) starting with rGTG is the dasS gene in Mycobacterium sp. strain JC1.
The direct repeat located upstream of the dasS transcription start site is a potential site to which a regulator involved in the methanol-dependent expression of dasS gene binds (Ni & Westpheling, 1997). The observations that DHAS was present only in cells of Mycobacterium sp. strain JC1 growing on methanol (Ro et al., 1997a, b) and that a highly similar directly repeated sequence (underlined), TCAGAACATCATCGTCAGAACAT, located 29–7 bp and 91–69 bp upstream of a potential –35 sequence and a translation start codon for cbbL in Hydrogenophaga pseudoflava, respectively, is protected from DNase when DNA fragments covering the direct repeat are treated with DNase I after incubation with the LysR-type transcriptional regulator CbbR purified from Hyd. pseudoflava (S. N. Lee and Y. M. Kim, unpublished results) support this assumption.
Analysis of sequences downstream from the dasS candidate termination codon revealed a large stable GC-rich inverted-repeat sequence (underlined), CGCCGCGGGACGGCCCGATGGCCGTCCCGCGGCG (
G°=–47 kcal mol–1; –197 kJ mol–1), located 27–60 bp downstream of the stop codon and capable of forming a transcriptional termination structure. A poly-T segment was not found downstream of the inverted-repeat sequence. The stem-and-loop was followed by a long tract, at least 80 nt, free of double-stranded segments and containing several short GC-rich regions, suggesting that the termination of dasS candidate transcription may be rho-dependent.
Expression of the dasS gene in Mycobacterium sp. strain JC1
Since the DHAS of Mycobacterium sp. strain JC1 is expressed only in cells growing on methanol (Ro et al., 1997a), efforts were made to determine at which level dasS expression was regulated. Northern hybridization was performed using total RNAs prepared from cells grown on CO, methanol and nutrient broth, and the random-primed probes synthesized by using a 1.28 kb SmaI fragment of pSKB7 as template. A band of 2200 nt was detected in total RNA prepared from methanol-grown cells, but not the RNAs from CO- and nutrient broth-grown cells (Fig. 5), indicating that expression of dasS is regulated at the transcriptional level. This was further supported by a β-galactosidase assay with Mycobacterium sp. strain JC1 harbouring a reporter plasmid that contained the 271 bp PCR product covering the putative promoter region of the dasS gene including the 7 bp direct repeat and the putative –35 and –10 regions; i.e. the β-galactosidase activity in cells grown on methanol was 20- and 16-fold higher than that of the cells grown on CO and nutrient broth, respectively (Fig. 6). The size of the RNA transcript detected in Northern hybridization with total RNAs from methanol-grown cells (Fig. 5) was slightly larger than that of the dasS gene (2193 bp), which supports monocistronic transcription of the Mycobacterium sp. strain JC1 dasS gene.
|
|
). To examine the effect of these compounds on the expression of dasS, cells were cultivated in SMB medium supplemented with 0.5 % (v/v) methanol in the presence of 0.5 % (w/v) pyruvate or 0.8 % (w/v) nutrient broth. Immunoblotting after denaturing PAGE of cell-free extracts prepared from cells grown on methanol in the presence of one of the two compounds showed that expression of dasS was not affected by favourable substrates, suggesting that the expression of dasS is free from catabolic repression.
|
ACKNOWLEDGEMENTS |
|---|
Edited by: D. J. Arp
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Bashyam, M. D., Kaushal, D., Dasgupta, S. K. & Tyagi, A. K. (1996). A study of mycobacterial transcriptional apparatus: identification of novel features in promoter elements. J Bacteriol 178, 4847–4853.
Bystrykh, L. V., Sokolov, A. V. & Trotsenko, Y. A. (1981). Purification and properties of dihydroxyacetone synthase from the methylotrophic yeast Candida boidinii. FEBS Lett 132, 324–328.[CrossRef]
Chen, J. H., Gibson, J. L., McCues, A. L. & Tabita, F. R. (1991). Identification, expression, and deduced primary structure of transketolase and other enzymes encoded within the form II CO2 fixation operon of Rhodobacter sphaeroides. J Biol Chem 266, 20447–20452.
de Koning, W. & Harder, W. (1992). Methanol-utilizing yeast. In Methane and Methanol Utilizers, pp. 207–244. Edited by J. C. Murrell & H. Dalton. New York: Plenum Press.
Dijkhuizen, L., Levering, P. R. & de Vries, G. E. (1992). The physiology and biochemistry of aerobic methanol-utilizing Gram-negative and Gram-positive bacteria. In Methane and Methanol Utilizers, pp. 149–181. Edited by J. C. Murrell & H. Dalton. New York: Plenum Press.
Dower, W. J., Miller, J. F. & Ragsdale, C. W. (1988). High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 16, 6127–6145.
Edman, P. & Begg, G. (1967). A protein sequenator. Eur J Biochem 1, 80–91.[Medline]
Fletcher, T. S., Kwee, I. L., Nakada, T., Largman, C. & Martin, B. M. (1992). DNA sequence of the yeast transketolase gene. Biochemistry 31, 1892–1896.[CrossRef][Medline]
Goldberg, J. B. & Ohman, D. E. (1984). Cloning and expression in Pseudomonas aeruginosa of a gene involved in the production of alginate. J Bacteriol 158, 1115–1121.
Hawkins, C. F., Borges, A. & Perham, R. N. (1989). A common structural motif in thiamine pyrophosphate-binding enzymes. FEBS Lett 255, 77–82.[CrossRef][Medline]
Janowicz, Z. A., Eckart, M. R., Drewke, C., Roggenkamp, R. O. & Hollenberg, C. P. (1985). Cloning and characterization of DAS gene encoding the major methanol assimilatory enzyme from the methylotrophic yeast Hansenula polymorpha. Nucleic Acids Res 13, 3043–3062.
Kato, N., Nishizawa, T., Sakazawa, C., Tani, Y. & Yamada, H. (1979). Xylulose 5-phosphate dependent fixation of formaldehyde in a methanol-utilizing yeast Kloeckera sp. no. 2201. Agric Biol Chem 43, 2013–2015.
Kato, N., Higuchi, T., Sakazawa, C., Nishizawa, T., Tani, Y. & Yamada, H. (1982). Purification and properties of a transketolase responsible for formaldehyde fixation in a methanol utilizing yeast, Candida boidinii (Kloeckera sp.) no. 2201. Biochim Biophys Acta 715, 143–150.[Medline]
Kim, Y. M. & Hegeman, G. D. (1981). Purification and some properties of carbon monoxide dehydrogenase from Pseudomonas carboxyhydrogena. J Bacteriol 148, 904–911.
Kim, K. S., Ro, Y. T. & Kim, Y. M. (1989). Purification and some properties of carbon monoxide dehydrogenase from Acinetobacter sp. strain JC1 DSM 3803. J Bacteriol 171, 958–964.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685.[CrossRef][Medline]
Lindqvist, Y., Schneider, G., Ermler, U. & Sundström, M. (1992). Three-dimensional structure of transketolase, a thiamine diphosphate dependent enzyme, at 2.5 Å resolution. EMBO J 11, 2373–2379.[Medline]
Lowry, O. H., Rosebrough, N. J., Farr, A. L. & Randall, R. J. (1951). Protein measurement with the Folin phenol reagent. J Biol Chem 193, 265–275.
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Nathan, S. H., Gomez, J. E., Ko, C. & Bishi, W. R. (1995). Color selection with a hygromycin-resistance-based Escherichia coli-mycobacterial shuttle vector. Gene 127, 181–182.
Ni, X. & Westpheling, J. (1997). Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction. Proc Natl Acad Sci U S A 94, 13116–13121.
O'Connor, M. L. & Quayle, J. R. (1980). Pentose phosphate-dependent fixation of formaldehyde by methanol-grown Hansenula polymorpha and Candida boidinii. J Gen Microbiol 120, 219–225.
Park, S. W., Hwang, E. H., Park, H., Kim, J. A., Heo, J. H., Lee, K. H., Song, T., Kim, E., Ro, Y. T. & other authors (2003). Growth of mycobacteria on carbon monoxide and methanol. J Bacteriol 185, 142–147.
Promega (1995). Technical Bulletin. Instructions for Use of Product E3030. Madison, WI: Promega.
Reizer, J., Reizer, A., Bairoch, A. & Saier, M. H. (1993). A diverse transketolase family that induces the RecP protein of Streptococcus pneumoniae, a protein implicated in genetic recombination. Res Microbiol 144, 341–347.[Medline]
Ro, Y. T., Eom, C. Y., Song, T., Cho, J. W. & Kim, Y. M. (1997a). Dihydroxyacetone synthase from a methanol-utilizing carboxydobacterium, Acinetobacter sp. strain JC1 DSM 3803. J Bacteriol 179, 6041–6047.
Ro, Y. T., Seo, J. G., Lee, J., Kim, D. M., Chung, I. K., Kim, T. U. & Kim, Y. M. (1997b). Growth on methanol of a carboxydobacterium, Acinetobacter sp. strain JC1 DSM 3803. J Microbiol 35, 30–39.
Robinson, B. H. & Chun, K. (1993). The relationships between transketolase, yeast pyruvate decarboxylase and pyruvate dehydrogenase of pyruvate dehydrogenase complex. FEBS Lett 328, 99–102.[CrossRef][Medline]
Sakai, Y., Nakagawa, T., Shimase, M. & Kato, N. (1998). Regulation and physiological role of the DAS1 gene, encoding dihydroxyacetone synthase, in the methylotrophic yeast Candida boidinii. J Bacteriol 180, 5885–5890.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 74, 5463–5467.
Schäferjohann, J., Yoo, J. G., Kusian, B. & Bowien, B. (1993). The cbb operons of the facultative chemoautotroph Alcaligenes eutrophus encode phosphoglycolate phosphatase. J Bacteriol 175, 7329–7340.
Song, T., Lee, H., Park, Y.-H., Kim, E., Ro, Y. T., Kim, S. W. & Kim, Y. M. (2002). Reclassification of a carboxydobacterium, Acinetobacter sp. strain JC1 DSM 3803, as Mycobacterium sp. strain JC1 DSM 3803. J Microbiol 40, 237–240.
Sundström, M., Lindqvist, Y., Schneider, G., Hellman, U. & Ronne, H. (1993). Yeast TKL1 gene encodes a transketolase that is required for efficient glycolysis and biosynthesis of aromatic amino acids. J Biol Chem 268, 24346–24352.
Waites, M. J. & Quayle, J. R. (1980). Dihydroxyacetone: a product of xylulose 5-phosphate-dependent fixation of formaldehyde by methanol-grown Candida boidinii. J Gen Microbiol 118, 321–327.
Waites, M. J. & Quayle, J. R. (1981). The interrelation between transketolase and dihydroxyacetone synthase activities in the methylotrophic yeast Candida boidinii. J Gen Microbiol 124, 309–316.
Wang, J. J., Martin, P. R. & Singleton, C. K. (1997). Aspartate 155 of human transketolase is essential for thiamine diphosphate–magnesium binding, and cofactor binding is required for dimer formation. Biochim Biophys Acta 1341, 165–172.[CrossRef][Medline]
Weber, K. & Osborn, M. (1969). The reliability of molecular weight determination by dodecyl sulfate-polyacrylamide gel electrophoresis. J Biol Chem 244, 4406–4412.
Received 24 July 2007;
revised 16 August 2007;
accepted 16 August 2007.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
